Accession ID: MIRT043074 [miRNA, hsa-miR-324-5p :: CKB, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-324LinkOut: [miRBase ]
Synonyms MIRN324, hsa-mir-324, MIR324
Description Homo sapiens miR-324 stem-loop
Comment This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue has a 1 nt 3' extension (U), which is incompatible with the genome sequence.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-324-5p
Mature Sequence 16| CGCAUCCCCUAGGGCAUUGGUGU |38
Evidence Experimental
Experiments Cloned
Expression Profile
Putative hsa-miR-324-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CKB LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms B-CK, CKBB
Description creatine kinase, brain
Transcript NM_0018    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CKB LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CKB
(miRNA target sites are highlighted)
>CKB|NM_0018|3'UTR
   1 TGAAGCCCGGCCCACACCCGACACCAGCCCTGCTGCTTCCTAACTTATTGCCTGGGCAGTGCCCACCATGCACCCCTGAT
  81 GTTCGCCGTCTGGCGAGCCCTTAGCCTTGCTGTAGAGACTTCCGTCACCCTTGGTAGAGTTTATTTTTTTGATGGCTAAG
 161 ATACTGCTGATGCTGAAATAAACTAGGGTTTTGGCCTGCCTGCGTCTG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugUGGUUACGGGAUCCCC--UACGc 5'
            ||: ||  |||  |||  :||| 
Target 5' taACTTATTGCCT--GGGCAGTGCc 3'
41 - 63 101.00 -12.30
2
miRNA  3' ugugguuacgggaucccCUACGc 5'
                           ||||| 
Target 5' atggctaagatactgctGATGCt 3'
152 - 174 100.00 -7.80
3
miRNA  3' ugUGGUUACGGGAUCCCCUACGc 5'
            ||:|: |:::|  ||  ||| 
Target 5' aaACTAGGGTTTT--GGCCTGCc 3'
180 - 200 93.00 -8.82
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-324-5p :: CKB    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' tgTG-GTTACGGGATCCCCTACGc 5'
            || :: ||  || | ||:||| 
Target 5' -tACGTGCTGAGCTCGCGGGTGCg 3'
1 - 23
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
245 hsa-miR-324-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000527 SMO smoothened homolog (Drosophila) 3 2
MIRT000530 GLI1 GLI family zinc finger 1 3 2
MIRT043016 TNKS tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 1 1
MIRT043017 RAB6A RAB6A, member RAS oncogene family 1 1
MIRT043018 PUM1 pumilio homolog 1 (Drosophila) 1 1
MIRT043019 KIAA0907 KIAA0907 1 1
MIRT043020 FAM43B family with sequence similarity 43, member B 1 1
MIRT043021 KIAA1462 KIAA1462 1 1
MIRT043022 ZMYND11 zinc finger, MYND domain containing 11 1 1
MIRT043023 PXDN peroxidasin homolog (Drosophila) 1 1
MIRT043024 TAX1BP3 Tax1 (human T-cell leukemia virus type I) binding protein 3 1 1
MIRT043025 SRRM1 serine/arginine repetitive matrix 1 1 1
MIRT043026 PPIAL4G peptidylprolyl isomerase A (cyclophilin A)-like 4G 1 1
MIRT043027 HIST2H3A histone cluster 2, H3a 1 1
MIRT043028 PSMD2 proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 1 1
MIRT043029 PSMA4 proteasome (prosome, macropain) subunit, alpha type, 4 1 1
MIRT043030 RPS2 ribosomal protein S2 1 1
MIRT043031 APOF apolipoprotein F 1 1
MIRT043032 HSPD1 heat shock 60kDa protein 1 (chaperonin) 1 1
MIRT043033 HNRNPH2 protein-coding 1 1
MIRT043034 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT043035 WHSC1 Wolf-Hirschhorn syndrome candidate 1 1 1
MIRT043036 PAX3 paired box 3 1 1
MIRT043037 ASF1B ASF1 anti-silencing function 1 homolog B (S. cerevisiae) 1 1
MIRT043038 PPIA peptidylprolyl isomerase A (cyclophilin A) 1 1
MIRT043039 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT043040 NME3 non-metastatic cells 3, protein expressed in 1 1
MIRT043041 TP53 tumor protein p53 1 1
MIRT043042 TBCB tubulin folding cofactor B 1 1
MIRT043043 HMGXB3 HMG box domain containing 3 1 1
MIRT043044 TUBA1B tubulin, alpha 1b 1 1
MIRT043045 TUBA1C tubulin, alpha 1c 1 1
MIRT043046 TUBA1A tubulin, alpha 1a 1 1
MIRT043047 RPL27 ribosomal protein L27 1 1
MIRT043048 PA2G4 proliferation-associated 2G4, 38kDa 1 1
MIRT043049 TIMELESS timeless homolog (Drosophila) 1 1
MIRT043050 WIZ widely interspaced zinc finger motifs 1 1
MIRT043051 GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 1 1
MIRT043052 TCF7L2 transcription factor 7-like 2 (T-cell specific, HMG-box) 1 1
MIRT043053 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT043054 FLNA filamin A, alpha 1 1
MIRT043055 VPS51 chromosome 11 open reading frame 2 1 1
MIRT043056 PALM paralemmin 1 1
MIRT043057 EDC3 enhancer of mRNA decapping 3 homolog (S. cerevisiae) 1 1
MIRT043058 MDC1 mediator of DNA-damage checkpoint 1 1 1
MIRT043059 SCD5 stearoyl-CoA desaturase 5 1 1
MIRT043060 DNAL1 dynein, axonemal, light chain 1 1 1
MIRT043061 PSMD11 proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 1 1
MIRT043062 SEC23IP SEC23 interacting protein 1 1
MIRT043063 PPM1F protein phosphatase, Mg2+/Mn2+ dependent, 1F 1 1
MIRT043064 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide 1 1
MIRT043065 LACC1 chromosome 13 open reading frame 31 1 1
MIRT043066 SEPT8 septin 8 1 1
MIRT043067 CCND3 cyclin D3 1 1
MIRT043068 LDHA lactate dehydrogenase A 1 1
MIRT043069 FOXC1 forkhead box C1 1 1
MIRT043070 RPL37 ribosomal protein L37 1 1
MIRT043071 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT043072 OSTC oligosaccharyltransferase complex subunit 1 1
MIRT043073 RBBP4 retinoblastoma binding protein 4 1 1
MIRT043074 CKB creatine kinase, brain 1 1
MIRT043075 RARS arginyl-tRNA synthetase 1 1
MIRT043076 NANS N-acetylneuraminic acid synthase 1 1
MIRT043077 NELFB cofactor of BRCA1 1 1
MIRT043078 UNKL unkempt homolog (Drosophila)-like 1 1
MIRT043079 MZT2A family with sequence similarity 128, member A 1 1
MIRT043080 AHNAK AHNAK nucleoprotein 1 1
MIRT043081 SLC39A10 solute carrier family 39 (zinc transporter), member 10 1 1
MIRT043082 H3F3B H3 histone, family 3B (H3.3B) 1 1
MIRT043083 PSMD4 proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 1 1
MIRT043084 ITPR2 inositol 1,4,5-triphosphate receptor, type 2 1 1
MIRT043085 KIAA0196 KIAA0196 1 1
MIRT043086 ALDOA aldolase A, fructose-bisphosphate 1 1
MIRT043087 ATXN2L ataxin 2-like 1 1
MIRT043088 AK3 adenylate kinase 3 1 1
MIRT043089 FBL fibrillarin 1 1
MIRT043090 PKD1 polycystic kidney disease 1 (autosomal dominant) 1 1
MIRT043091 COX5A cytochrome c oxidase subunit Va 1 1
MIRT043092 DBT dihydrolipoamide branched chain transacylase E2 1 1
MIRT043093 CTTNBP2NL CTTNBP2 N-terminal like 1 1
MIRT043094 SARS2 seryl-tRNA synthetase 2, mitochondrial 1 1
MIRT043095 SLC26A2 solute carrier family 26 (sulfate transporter), member 2 1 1
MIRT043096 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT043097 NUP188 nucleoporin 188kDa 1 1
MIRT043098 MTHFD1 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase 1 1
MIRT043099 SPEN spen homolog, transcriptional regulator (Drosophila) 1 1
MIRT043100 PARM1 prostate androgen-regulated mucin-like protein 1 1 1
MIRT043101 ASS1 argininosuccinate synthase 1 1 1
MIRT043102 GNB2 guanine nucleotide binding protein (G protein), beta polypeptide 2 1 1
MIRT043103 COL14A1 collagen, type XIV, alpha 1 1 1
MIRT043104 PGAM1 phosphoglycerate mutase 1 (brain) 1 1
MIRT043105 NDUFS1 NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase) 1 1
MIRT043106 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT043107 CDS1 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1 1 1
MIRT043108 RPL36AL ribosomal protein L36a-like 1 1
MIRT043109 PACS1 phosphofurin acidic cluster sorting protein 1 1 1
MIRT043110 HNRNPL heterogeneous nuclear ribonucleoprotein L 1 1
MIRT043111 UBE2I ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) 1 1
MIRT043112 RELA v-rel reticuloendotheliosis viral oncogene homolog A (avian) 1 1
MIRT043113 ITM2C integral membrane protein 2C 1 1
MIRT043114 TUBGCP6 tubulin, gamma complex associated protein 6 1 1
MIRT043115 DDX11 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (CHL1-like helicase homolog, S. cerevisiae) 1 1
MIRT043116 TRAFD1 TRAF-type zinc finger domain containing 1 1 1
MIRT043117 DAP3 death associated protein 3 1 1
MIRT043118 ELOVL5 ELOVL family member 5, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) 1 1
MIRT043119 HTT huntingtin 1 1
MIRT043120 NKX2-5 NK2 transcription factor related, locus 5 (Drosophila) 1 1
MIRT043121 XPO6 exportin 6 1 1
MIRT043122 MPI mannose phosphate isomerase 1 1
MIRT043123 STXBP4 syntaxin binding protein 4 1 1
MIRT043124 ABCC4 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 1 1
MIRT043125 LARS2 leucyl-tRNA synthetase 2, mitochondrial 1 1
MIRT043126 SEC61B Sec61 beta subunit 1 1
MIRT043127 PIN1 peptidylprolyl cis/trans isomerase, NIMA-interacting 1 1 1
MIRT043128 DYRK1B dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B 1 1
MIRT043129 ACIN1 apoptotic chromatin condensation inducer 1 1 1
MIRT043130 MID2 midline 2 1 1
MIRT043131 SAP18 Sin3A-associated protein, 18kDa 1 1
MIRT043132 RAB11FIP1 RAB11 family interacting protein 1 (class I) 1 1
MIRT043133 AGAP1 ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 1 1
MIRT043134 TRPC4AP transient receptor potential cation channel, subfamily C, member 4 associated protein 1 1
MIRT043135 PSME1 proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) 1 1
MIRT043136 RAB1B RAB1B, member RAS oncogene family 1 1
MIRT043137 NSMF nasal embryonic LHRH factor 1 1
MIRT043138 VANGL1 vang-like 1 (van gogh, Drosophila) 1 1
MIRT043139 MSH6 mutS homolog 6 (E. coli) 1 1
MIRT043140 CS citrate synthase 1 1
MIRT043141 ACTB actin, beta 1 1
MIRT043142 BOP1 block of proliferation 1 1 1
MIRT043143 TCOF1 Treacher Collins-Franceschetti syndrome 1 1 1
MIRT043144 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT043145 POLR2A polymerase (RNA) II (DNA directed) polypeptide A, 220kDa 1 1
MIRT043146 PSMC5 proteasome (prosome, macropain) 26S subunit, ATPase, 5 1 1
MIRT043147 BIVM basic, immunoglobulin-like variable motif containing 1 1
MIRT043148 MKLN1 muskelin 1, intracellular mediator containing kelch motifs 1 1
MIRT043149 RAD51D RAD51-like 3 (S. cerevisiae) 1 1
MIRT043150 GMNN geminin, DNA replication inhibitor 1 1
MIRT043151 PGK1 phosphoglycerate kinase 1 1 1
MIRT043152 PDXP pyridoxal (pyridoxine, vitamin B6) phosphatase 1 1
MIRT043153 TUBB tubulin, beta 1 1
MIRT043154 GTF3C1 general transcription factor IIIC, polypeptide 1, alpha 220kDa 1 1
MIRT043155 MYO1C myosin IC 1 1
MIRT043156 TIMM50 translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) 1 1
MIRT043157 CENPB centromere protein B, 80kDa 1 1
MIRT043158 MEA1 male-enhanced antigen 1 1 1
MIRT043159 BTN3A1 butyrophilin, subfamily 3, member A1 1 1
MIRT043160 POLR3H polymerase (RNA) III (DNA directed) polypeptide H (22.9kD) 1 1
MIRT043161 ANXA7 annexin A7 1 1
MIRT043162 COPS3 COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis) 1 1
MIRT043163 SYNGR2 synaptogyrin 2 1 1
MIRT043164 ANXA6 annexin A6 1 1
MIRT043165 DEAF1 deformed epidermal autoregulatory factor 1 (Drosophila) 1 1
MIRT043166 CLPB ClpB caseinolytic peptidase B homolog (E. coli) 1 1
MIRT043167 RPP30 ribonuclease P/MRP 30kDa subunit 1 1
MIRT043168 ARID5A AT rich interactive domain 5A (MRF1-like) 1 1
MIRT043169 CBS cystathionine-beta-synthase 1 1
MIRT043170 SLC25A3 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 1 1
MIRT043171 ATP5H ATP synthase, H+ transporting, mitochondrial Fo complex, subunit d 1 1
MIRT043172 ARHGEF10L Rho guanine nucleotide exchange factor (GEF) 10-like 1 1
MIRT043173 CELF2 CUGBP, Elav-like family member 2 1 1
MIRT043174 HSD17B4 hydroxysteroid (17-beta) dehydrogenase 4 1 1
MIRT043175 ARF1 ADP-ribosylation factor 1 1 1
MIRT043176 DNAJC11 DnaJ (Hsp40) homolog, subfamily C, member 11 1 1
MIRT043177 USPL1 ubiquitin specific peptidase like 1 1 1
MIRT043178 BAI2 brain-specific angiogenesis inhibitor 2 1 1
MIRT043179 ARFGAP2 ADP-ribosylation factor GTPase activating protein 2 1 1
MIRT043180 CLN6 ceroid-lipofuscinosis, neuronal 6, late infantile, variant 1 1
MIRT043181 SNX7 sorting nexin 7 1 1
MIRT043182 SF3B2 splicing factor 3b, subunit 2, 145kDa 1 1
MIRT043183 CUEDC2 CUE domain containing 2 1 1
MIRT043184 TMEM129 transmembrane protein 129 1 1
MIRT043185 TRAP1 TNF receptor-associated protein 1 1 1
MIRT043186 TUFM Tu translation elongation factor, mitochondrial 1 1
MIRT043187 UBL5 ubiquitin-like 5 1 1
MIRT043188 IPO5 importin 5 1 1
MIRT043189 NUP160 nucleoporin 160kDa 1 1
MIRT043190 GID8 chromosome 20 open reading frame 11 1 1
MIRT043191 DDX20 DEAD (Asp-Glu-Ala-Asp) box polypeptide 20 1 1
MIRT043192 WBP2 WW domain binding protein 2 1 1
MIRT043193 POLE polymerase (DNA directed), epsilon 1 1
MIRT043194 BTBD2 BTB (POZ) domain containing 2 1 1
MIRT043195 CRY1 cryptochrome 1 (photolyase-like) 1 1
MIRT043196 UBA1 ubiquitin-like modifier activating enzyme 1 1 1
MIRT043197 GANAB glucosidase, alpha; neutral AB 1 1
MIRT043198 LDHB lactate dehydrogenase B 1 1
MIRT043199 DYRK1A dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A 1 1
MIRT043200 RUSC2 RUN and SH3 domain containing 2 1 1
MIRT043201 ARPP19 cAMP-regulated phosphoprotein, 19kDa 1 1
MIRT043202 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT043203 RER1 RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae) 1 1
MIRT043204 NUP85 nucleoporin 85kDa 1 1
MIRT043205 TRERF1 transcriptional regulating factor 1 1 1
MIRT043206 NFIX nuclear factor I/X (CCAAT-binding transcription factor) 1 1
MIRT043207 SPOPL speckle-type POZ protein-like 1 1
MIRT043208 POLD1 polymerase (DNA directed), delta 1, catalytic subunit 125kDa 1 1
MIRT043209 KLHDC3 kelch domain containing 3 1 1
MIRT043210 MYADM myeloid-associated differentiation marker 1 1
MIRT043211 PSME3 proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) 1 1
MIRT043212 SMAD2 SMAD family member 2 1 1
MIRT043213 MTMR12 myotubularin related protein 12 1 1
MIRT043214 ACTN4 actinin, alpha 4 1 1
MIRT043215 CDC123 cell division cycle 123 homolog (S. cerevisiae) 1 1
MIRT043216 KCNG1 potassium voltage-gated channel, subfamily G, member 1 1 1
MIRT043217 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT043218 SCARB1 scavenger receptor class B, member 1 1 1
MIRT043219 FAM83H family with sequence similarity 83, member H 1 1
MIRT043220 SOBP sine oculis binding protein homolog (Drosophila) 1 1
MIRT043221 UBE2S ubiquitin-conjugating enzyme E2S 1 1
MIRT043222 COL6A1 collagen, type VI, alpha 1 1 1
MIRT043223 PMS2 PMS2 postmeiotic segregation increased 2 (S. cerevisiae) 1 1
MIRT043224 AARS alanyl-tRNA synthetase 1 1
MIRT043225 HOXA9 homeobox A9 1 1
MIRT043226 MYOD1 myogenic differentiation 1 1 1
MIRT043227 PIAS4 protein inhibitor of activated STAT, 4 1 1
MIRT043228 PTK7 PTK7 protein tyrosine kinase 7 1 1
MIRT043229 POTEG POTE ankyrin domain family, member G 1 1
MIRT043230 CHCHD10 coiled-coil-helix-coiled-coil-helix domain containing 10 1 1
MIRT043231 SMARCD2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2 1 1
MIRT043232 KIF3B kinesin family member 3B 1 1
MIRT043233 CACHD1 cache domain containing 1 1 1
MIRT043234 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT043235 C8orf33 chromosome 8 open reading frame 33 1 1
MIRT043236 ARNT aryl hydrocarbon receptor nuclear translocator 1 1
MIRT043237 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT043238 RAP2B RAP2B, member of RAS oncogene family 1 1
MIRT043239 TBC1D10B TBC1 domain family, member 10B 1 1
MIRT043240 PAK4 p21 protein (Cdc42/Rac)-activated kinase 4 1 1
MIRT043241 DEF8 differentially expressed in FDCP 8 homolog (mouse) 1 1
MIRT043242 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT043243 ZIC5 Zic family member 5 (odd-paired homolog, Drosophila) 1 1
MIRT043244 ESD esterase D 1 1
MIRT043245 PDRG1 p53 and DNA-damage regulated 1 1 1
MIRT043246 SAP30BP SAP30 binding protein 1 1
MIRT043247 MRPL14 mitochondrial ribosomal protein L14 1 1
MIRT043248 RNF26 ring finger protein 26 1 1
MIRT043249 ZBED1 zinc finger, BED-type containing 1 1 1
MIRT043250 GEMIN5 gem (nuclear organelle) associated protein 5 1 1
MIRT043251 GIGYF1 GRB10 interacting GYF protein 1 1 1
MIRT043252 TMEM8B transmembrane protein 8B 1 1
MIRT043253 ARID1B AT rich interactive domain 1B (SWI1-like) 1 1
MIRT043254 CFL1 cofilin 1 (non-muscle) 1 1
MIRT043255 TMEM63B transmembrane protein 63B 1 1
MIRT043256 USP16 ubiquitin specific peptidase 16 1 1
MIRT043257 PPP1R18 KIAA1949 1 1
MIRT043259 TACC3 transforming, acidic coiled-coil containing protein 3 1 1