Accession ID: MIRT043345 [miRNA, hsa-miR-331-3p :: TNFRSF10B, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-331LinkOut: [miRBase ]
Synonyms MIRN331, hsa-mir-331, MIR331
Description Homo sapiens miR-331 stem-loop
Comment This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-331-3p
Mature Sequence 61| GCCCCUGGGCCUAUCCUAGAA |81
Evidence Experimental
Experiments Cloned
Putative hsa-miR-331-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol TNFRSF10B LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CD262, DR5, KILLER, KILLER/DR5, TRAIL-R2, TRAILR2, TRICK2, TRICK2A, TRICK2B, TRICKB, ZTNFR9
Description tumor necrosis factor receptor superfamily, member 10b
Transcript NM_0038    LinkOut: [ RefSeq ]
Other Transcripts NM_1471   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on TNFRSF10B LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of TNFRSF10B
(miRNA target sites are highlighted)
>TNFRSF10B|NM_0038|3'UTR
   1 TAAGTGTGATTCTCTTCAGGAAGTCAGACCTTCCCTGGTTTACCTTTTTTCTGGAAAAAGCCCAACTGGACTCCAGTCAG
  81 TAGGAAAGTGCCACAATTGTCACATGACCGGTACTGGAAGAAACTCTCCCATCCAACATCACCCAGTGGATGGAACATCC
 161 TGTAACTTTTCACTGCACTTGGCATTATTTTTATAAGCTGAATGTGATAATAAGGACACTATGGAAATGTCTGGATCATT
 241 CCGTTTGTGCGTACTTTGAGATTTGGTTTGGGATGTCATTGTTTTCACAGCACTTTTTTATCCTAATGTAAATGCTTTAT
 321 TTATTTATTTGGGCTACATTGTAAGATCCATCTACACAGTCGTTGTCCGACTTCACTTGATACTATATGATATGAACCTT
 401 TTTTGGGTGGGGGGTGCGGGGCAGTTCACTCTGTCTCCCAGGCTGGAGTGCAATGGTGCAATCTTGGCTCACTATAGCCT
 481 TGACCTCTCAGGCTCAAGCGATTCTCCCACCTCAGCCATCCAAATAGCTGGGACCACAGGTGTGCACCACCACGCCCGGC
 561 TAATTTTTTGTATTTTGTCTAGATATAGGGGCTCTCTATGTTGCTCAGGGTGGTCTCGAATTCCTGGACTCAAGCAGTCT
 641 GCCCACCTCAGACTCCCAAAGCGGTGGAATTAGAGGCGTGAGCCCCCATGCTTGGCCTTACCTTTCTACTTTTATAATTC
 721 TGTATGTTATTATTTTATGAACATGAAGAAACTTTAGTAAATGTACTTGTTTACATAGTTATGTGAATAGATTAGATAAA
 801 CATAAAAGGAGGAGACATACAATGGGGGAAGAAGAAGAAGTCCCCTGTAAGATGTCACTGTCTGGGTTCCAGCCCTCCCT
 881 CAGATGTACTTTGGCTTCAATGATTGGCAACTTCTACAGGGGCCAGTCTTTTGAACTGGACAACCTTACAAGTATATGAG
 961 TATTATTTATAGGTAGTTGTTTACATATGAGTCGGGACCAAAGAGAACTGGATCCACGTGAAGTCCTGTGTGTGGCTGGT
1041 CCCTACCTGGGCAGTCTCATTTGCACCCATAGCCCCCATCTATGGACAGGCTGGGACAGAGGCAGATGGGTTAGATCACA
1121 CATAACAATAGGGTCTATGTCATATCCCAAGTGAACTTGAGCCCTGTTTGGGCTCAGGAGATAGAAGACAAAATCTGTCT
1201 CCCACGTCTGCCATGGCATCAAGGGGGAAGAGTAGATGGTGCTTGAGAATGGTGTGAAATGGTTGCCATCTCAGGAGTAG
1281 ATGGCCCGGCTCACTTCTGGTTATCTGTCACCCTGAGCCCATGAGCTGCCTTTTAGGGTACAGATTGCCTACTTGAGGAC
1361 CTTGGCCGCTCTGTAAGCATCTGACTCATCTCAGAAATGTCAATTCTTAAACACTGTGGCAACAGGACCTAGAATGGCTG
1441 ACGCATTAAGGTTTTCTTCTTGTGTCCTGTTCTATTATTGTTTTAAGACCTCAGTAACCATTTCAGCCTCTTTCCAGCAA
1521 ACCCTTCTCCATAGTATTTCAGTCATGGAAGGATCATTTATGCAGGTAGTCATTCCAGGAGTTTTTGGTCTTTTCTGTCT
1601 CAAGGCATTGTGTGTTTTGTTCCGGGACTGGTTTGGGTGGGACAAAGTTAGAATTGCCTGAAGATCACACATTCAGACTG
1681 TTGTGTCTGTGGAGTTTTAGGAGTGGGGGGTGACCTTTCTGGTCTTTGCACTTCCATCCTCTCCCACTTCCATCTGGCAT
1761 CCCACGCGTTGTCCCCTGCACTTCTGGAAGGCACAGGGTGCTGCTGCCTCCTGGTCTTTGCCTTTGCTGGGCCTTCTGTG
1841 CAGGACGCTCAGCCTCAGGGCTCAGAAGGTGCCAGTCCGGTCCCAGGTCCCTTGTCCCTTCCACAGAGGCCTTCCTAGAA
1921 GATGCATCTAGAGTGTCAGCCTTATCAGTGTTTAAGATTTTTCTTTTATTTTTAATTTTTTTGAGACAGAATCTCACTCT
2001 CTCGCCCAGGCTGGAGTGCAACGGTACGATCTTGGCTCAGTGCAACCTCCGCCTCCTGGGTTCAAGCGATTCTCGTGCCT
2081 CAGCCTCCGGAGTAGCTGGGATTGCAGGCACCCGCCACCACGCCTGGCTAATTTTTGTATTTTTAGTAGAGACGGGGTTT
2161 CACCATGTTGGTCAGGCTGGTCTCGAACTCCTGACCTCAGGTGATCCACCTTGGCCTCCGAAAGTGCTGGGATTACAGGC
2241 GTGAGCCACCAGCCAGGCCAAGCTATTCTTTTAAAGTAAGCTTCCTGACGACATGAAATAATTGGGGGTTTTGTTGTTTA
2321 GTTACATTAGGCTTTGCTATATCCCCAGGCCAAATAGCATGTGACACAGGACAGCCATAGTATAGTGTGTCACTCGTGGT
2401 TGGTGTCCTTTCATGCTTCTGCCCTGTCAAAGGTCCCTATTTGAAATGTGTTATAATACAAACAAGGAAGCACATTGTGT
2481 ACAAAATACTTATGTATTTATGAATCCATGACCAAATTAAATATGAAACCTTATATAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' aaGAUCCUAUCCGGGUCCCcg 5'
            ||| | |  ||:|||||  
Target 5' ctCTATGTT--GCTCAGGGtg 3'
594 - 612 123.00 -14.80
2
miRNA  3' aagaUCCU---A-UCCGGGUCCCcg 5'
              ||||   | || |:|||||  
Target 5' gtgcAGGACGCTCAGCCTCAGGGct 3'
1838 - 1862 121.00 -15.90
3
miRNA  3' aagauccuauccggGUCCCCg 5'
                        |||||| 
Target 5' attggcaacttctaCAGGGGc 3'
903 - 923 120.00 -15.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-331-3p :: TNFRSF10B    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' aagatcctATCCGGGTCCCCg 5'
                  |:|||:|||| | 
Target 5' --------TGGGCTCAGGAGa 3'
1 - 13
2
miRNA  3' aagatcctatccGGGTCCccg 5'
                      |||| |   
Target 5' caaaatctgtctCCCACGtct 3'
21 - 41
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
339 hsa-miR-331-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005805 ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) 4 2
MIRT006364 FHIT fragile histidine triad gene 1 1
MIRT006506 E2F1 E2F transcription factor 1 2 1
MIRT006887 DOHH deoxyhypusine hydroxylase/monooxygenase 3 1
MIRT019230 WDR60 WD repeat domain 60 1 1
MIRT019231 RNF7 ring finger protein 7 1 1
MIRT019232 ARL8A ADP-ribosylation factor-like 8A 1 1
MIRT019233 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT019234 ZNF721 zinc finger protein 721 1 1
MIRT019235 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 1 1
MIRT019236 NRP2 neuropilin 2 1 1
MIRT019237 VMA21 VMA21 vacuolar H+-ATPase homolog (S. cerevisiae) 1 1
MIRT019238 TNPO2 transportin 2 1 1
MIRT019239 ZC3H4 zinc finger CCCH-type containing 4 1 2
MIRT019240 DCLRE1B DNA cross-link repair 1B (PSO2 homolog, S. cerevisiae) 1 1
MIRT019241 SCML2 sex comb on midleg-like 2 (Drosophila) 1 1
MIRT019242 METTL21D chromosome 14 open reading frame 138 1 1
MIRT019243 MIER3 mesoderm induction early response 1, family member 3 1 1
MIRT019244 HNRNPUL2 heterogeneous nuclear ribonucleoprotein U-like 2 1 1
MIRT019245 ABI2 abl-interactor 2 1 1
MIRT019246 HOXC4 homeobox C4 1 1
MIRT035562 CDCA5 cell division cycle associated 5 1 1
MIRT035563 KIF23 kinesin family member 23 1 1
MIRT043258 TMF1 TATA element modulatory factor 1 1 1
MIRT043260 CEP112 coiled-coil domain containing 46 1 1
MIRT043261 CEP44 KIAA1712 1 1
MIRT043262 GNPAT glyceronephosphate O-acyltransferase 1 1
MIRT043263 UTRN utrophin 1 1
MIRT043264 DLX2 distal-less homeobox 2 1 1
MIRT043265 WDR96 chromosome 10 open reading frame 79 1 1
MIRT043266 RPS2 ribosomal protein S2 1 1
MIRT043267 CTC1 chromosome 17 open reading frame 68 1 1
MIRT043268 TOMM20 translocase of outer mitochondrial membrane 20 homolog (yeast) 1 1
MIRT043269 TRMT61B tRNA methyltransferase 61 homolog B (S. cerevisiae) 1 1
MIRT043270 ZNF512 zinc finger protein 512 1 1
MIRT043271 CTNND1 catenin (cadherin-associated protein), delta 1 1 1
MIRT043272 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT043273 ZNF607 zinc finger protein 607 1 1
MIRT043274 WNK1 WNK lysine deficient protein kinase 1 1 1
MIRT043275 PPARD peroxisome proliferator-activated receptor delta 1 1
MIRT043276 RARS arginyl-tRNA synthetase 1 1
MIRT043277 CARF amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8 1 1
MIRT043278 YY1 YY1 transcription factor 1 1
MIRT043279 SFPQ splicing factor proline/glutamine-rich 1 1
MIRT043280 SEC31A SEC31 homolog A (S. cerevisiae) 1 1
MIRT043281 SMG5 Smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans) 1 1
MIRT043282 PTP4A2 protein tyrosine phosphatase type IVA, member 2 1 1
MIRT043283 ZNF483 zinc finger protein 483 1 1
MIRT043284 LARS leucyl-tRNA synthetase 1 1
MIRT043285 CYTH4 cytohesin 4 1 1
MIRT043286 HPS1 Hermansky-Pudlak syndrome 1 1 1
MIRT043287 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT043288 DEF8 differentially expressed in FDCP 8 homolog (mouse) 1 1
MIRT043289 SMPD4 sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3) 1 1
MIRT043290 ADCY1 adenylate cyclase 1 (brain) 1 1
MIRT043291 IRS4 insulin receptor substrate 4 1 1
MIRT043292 SLC39A8 solute carrier family 39 (zinc transporter), member 8 1 1
MIRT043293 PIK3R3 phosphoinositide-3-kinase, regulatory subunit 3 (gamma) 1 1
MIRT043294 TIA1 TIA1 cytotoxic granule-associated RNA binding protein 1 1
MIRT043295 CDCA4 cell division cycle associated 4 1 1
MIRT043296 PSMD6 proteasome (prosome, macropain) 26S subunit, non-ATPase, 6 1 1
MIRT043297 ACTG1 actin, gamma 1 1 1
MIRT043298 MED22 mediator complex subunit 22 1 1
MIRT043299 GOLGA8A golgin A8 family, member A 1 1
MIRT043300 TPI1 triosephosphate isomerase 1 1 1
MIRT043301 PLCH2 phospholipase C, eta 2 1 1
MIRT043302 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT043303 QKI quaking homolog, KH domain RNA binding (mouse) 1 1
MIRT043304 FAM168B family with sequence similarity 168, member B 1 1
MIRT043305 EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa 1 1
MIRT043306 TMEM64 transmembrane protein 64 1 1
MIRT043307 NEURL neuralized homolog (Drosophila) 1 1
MIRT043308 GSS glutathione synthetase 1 1
MIRT043309 GNAS GNAS complex locus 1 1
MIRT043310 RDX radixin 1 1
MIRT043311 CAMK2G calcium/calmodulin-dependent protein kinase II gamma 1 1
MIRT043312 UBQLN1 ubiquilin 1 1 1
MIRT043313 NAGA N-acetylgalactosaminidase, alpha- 1 1
MIRT043314 PRRC2A HLA-B associated transcript 2 1 1
MIRT043315 CDIPT CDP-diacylglycerol--inositol 3-phosphatidyltransferase 1 1
MIRT043316 PKIG protein kinase (cAMP-dependent, catalytic) inhibitor gamma 1 1
MIRT043317 CLEC16A C-type lectin domain family 16, member A 1 1
MIRT043318 PRRC2B HLA-B associated transcript 2-like 1 1 1
MIRT043319 TAOK2 TAO kinase 2 1 1
MIRT043320 VPS11 vacuolar protein sorting 11 homolog (S. cerevisiae) 1 1
MIRT043321 ZNF714 zinc finger protein 714 1 1
MIRT043322 SALL2 sal-like 2 (Drosophila) 1 1
MIRT043323 PSMC4 proteasome (prosome, macropain) 26S subunit, ATPase, 4 1 1
MIRT043324 COASY CoA synthase 1 1
MIRT043325 EARS2 glutamyl-tRNA synthetase 2, mitochondrial (putative) 1 1
MIRT043326 CDHR3 cadherin-related family member 3 1 1
MIRT043327 DDX6 DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 1 1
MIRT043328 C10orf88 chromosome 10 open reading frame 88 1 1
MIRT043329 CBWD1 COBW domain containing 1 1 1
MIRT043330 RPL36A ribosomal protein L36a 1 1
MIRT043331 SYNM synemin, intermediate filament protein 1 1
MIRT043332 LRP3 low density lipoprotein receptor-related protein 3 1 1
MIRT043333 ICMT isoprenylcysteine carboxyl methyltransferase 1 1
MIRT043334 SEC16A SEC16 homolog A (S. cerevisiae) 1 1
MIRT043335 AP2A2 adaptor-related protein complex 2, alpha 2 subunit 1 1
MIRT043336 GTF3C4 general transcription factor IIIC, polypeptide 4, 90kDa 1 1
MIRT043337 SH3PXD2A SH3 and PX domains 2A 1 1
MIRT043338 RPS9 ribosomal protein S9 1 1
MIRT043339 ASXL1 additional sex combs like 1 (Drosophila) 1 1
MIRT043340 FBXO44 F-box protein 44 1 1
MIRT043341 GPI glucose-6-phosphate isomerase 1 1
MIRT043342 RPL34 ribosomal protein L34 1 1
MIRT043343 PCBD1 pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha 1 1
MIRT043344 DEPDC1 DEP domain containing 1 1 1
MIRT043345 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 1 1
MIRT043346 SS18 synovial sarcoma translocation, chromosome 18 1 1
MIRT043347 SPTAN1 spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) 1 1
MIRT043348 TMEM2 transmembrane protein 2 1 1
MIRT043349 LRRC10B leucine rich repeat containing 10B 1 1
MIRT043350 ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) 1 1
MIRT043351 ANKRD13D ankyrin repeat domain 13 family, member D 1 1
MIRT043352 ATP5J ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6 1 1
MIRT043353 LRRC59 leucine rich repeat containing 59 1 1
MIRT043354 MPLKIP chromosome 7 open reading frame 11 1 1
MIRT043355 RHOV ras homolog gene family, member V 1 1
MIRT043356 EFNB2 ephrin-B2 1 1
MIRT043357 TMEM120B transmembrane protein 120B 1 1
MIRT043358 ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 1
MIRT043359 HSPD1 heat shock 60kDa protein 1 (chaperonin) 1 1
MIRT043360 RPS14 ribosomal protein S14 1 1
MIRT043361 SLC50A1 recombination activating gene 1 activating protein 1 1 1
MIRT043362 HAX1 HCLS1 associated protein X-1 1 1
MIRT043363 TSG101 tumor susceptibility gene 101 1 1
MIRT043364 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 1
MIRT043365 VAPB VAMP (vesicle-associated membrane protein)-associated protein B and C 1 1
MIRT043366 GEMIN4 gem (nuclear organelle) associated protein 4 1 1
MIRT043367 HIST1H2AD histone cluster 1, H2ad 1 1
MIRT043368 ZNF608 zinc finger protein 608 1 1
MIRT043369 RPL7A ribosomal protein L7a 1 1
MIRT043370 FASN fatty acid synthase 1 1
MIRT043371 UBE2Q2 ubiquitin-conjugating enzyme E2Q family member 2 1 1
MIRT043372 DEPDC5 DEP domain containing 5 1 1
MIRT043373 NXT1 NTF2-like export factor 1 1 1
MIRT043374 NUP214 nucleoporin 214kDa 1 1
MIRT043375 KLC2 kinesin light chain 2 1 1
MIRT043376 TJAP1 tight junction associated protein 1 (peripheral) 1 1
MIRT043377 ATP8B2 ATPase, class I, type 8B, member 2 1 1
MIRT043378 MECR mitochondrial trans-2-enoyl-CoA reductase 1 1
MIRT043379 USP21 ubiquitin specific peptidase 21 1 1
MIRT043380 POLR2M glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A 1 1
MIRT043381 PSMD2 proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 1 1
MIRT043382 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT043383 ATRX alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae) 1 1
MIRT043384 FUS fused in sarcoma 1 1
MIRT043385 GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 1 1
MIRT043386 DDX21 DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 1 1
MIRT043387 POLR2L polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa 1 1
MIRT043388 FLNA filamin A, alpha 1 1
MIRT043389 SCAF4 splicing factor, arginine/serine-rich 15 1 1
MIRT043390 SMO smoothened homolog (Drosophila) 1 1
MIRT043391 YME1L1 YME1-like 1 (S. cerevisiae) 1 1
MIRT043392 TCP1 t-complex 1 1 1
MIRT043393 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT043394 RPLP0 ribosomal protein, large, P0 1 1
MIRT043395 HIST1H1E histone cluster 1, H1e 1 1
MIRT043396 GNB2 guanine nucleotide binding protein (G protein), beta polypeptide 2 1 1
MIRT043397 TKT transketolase 1 1
MIRT043398 TFCP2 transcription factor CP2 1 1
MIRT043399 PPIL1 peptidylprolyl isomerase (cyclophilin)-like 1 1 1
MIRT043400 WASH3P WAS protein family homolog 3 pseudogene 1 1
MIRT043401 NRSN2 neurensin 2 1 1
MIRT043402 RNMT RNA (guanine-7-) methyltransferase 1 1
MIRT043403 RNF40 ring finger protein 40 1 1
MIRT043404 GRSF1 G-rich RNA sequence binding factor 1 1 1
MIRT043405 STX16 syntaxin 16 1 1
MIRT043406 FANCD2 Fanconi anemia, complementation group D2 1 1
MIRT043407 NCAPD2 non-SMC condensin I complex, subunit D2 1 1
MIRT043408 RPS27 ribosomal protein S27 1 1
MIRT043409 SH3BP2 SH3-domain binding protein 2 1 1
MIRT043410 KCTD20 potassium channel tetramerisation domain containing 20 1 1
MIRT043411 SSR4 signal sequence receptor, delta (translocon-associated protein delta) 1 1
MIRT043412 AKAP10 A kinase (PRKA) anchor protein 10 1 1
MIRT043413 COPS3 COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis) 1 1
MIRT043414 IGFBP5 insulin-like growth factor binding protein 5 1 1
MIRT043415 EPHA7 EPH receptor A7 1 1
MIRT043416 CDKN2D cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4) 1 1
MIRT043417 HNRNPH1 heterogeneous nuclear ribonucleoprotein H1 (H) 1 1
MIRT043418 RNF145 ring finger protein 145 1 1
MIRT043419 ILF2 interleukin enhancer binding factor 2, 45kDa 1 1
MIRT043420 EXOC6B exocyst complex component 6B 1 1
MIRT043421 ARSD arylsulfatase D 1 1
MIRT043422 COCH coagulation factor C homolog, cochlin (Limulus polyphemus) 1 1
MIRT043423 NRBF2 nuclear receptor binding factor 2 1 1
MIRT043424 SRF serum response factor (c-fos serum response element-binding transcription factor) 1 1
MIRT043425 RANGAP1 Ran GTPase activating protein 1 1 1
MIRT043426 MYH9 myosin, heavy chain 9, non-muscle 1 1
MIRT043427 UBR5 ubiquitin protein ligase E3 component n-recognin 5 1 1
MIRT043428 EIF4A2 eukaryotic translation initiation factor 4A2 1 1
MIRT043429 NIPAL1 NIPA-like domain containing 1 1 1
MIRT043430 NCS1 neuronal calcium sensor 1 1 1
MIRT043431 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT043432 AURKAIP1 aurora kinase A interacting protein 1 1 1
MIRT043433 POLR3H polymerase (RNA) III (DNA directed) polypeptide H (22.9kD) 1 1
MIRT043434 LAMTOR4 chromosome 7 open reading frame 59 1 1
MIRT043435 DYNC2H1 dynein, cytoplasmic 2, heavy chain 1 1 1
MIRT043436 PI4KB phosphatidylinositol 4-kinase, catalytic, beta 1 1
MIRT043437 MECP2 methyl CpG binding protein 2 (Rett syndrome) 1 1
MIRT043438 ARID1A AT rich interactive domain 1A (SWI-like) 1 1
MIRT043439 DGKZ diacylglycerol kinase, zeta 104kDa 1 1
MIRT043440 PSME1 proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) 1 1
MIRT043441 DMAP1 DNA methyltransferase 1 associated protein 1 1 1
MIRT043442 SUV39H1 suppressor of variegation 3-9 homolog 1 (Drosophila) 1 1
MIRT043443 SYK spleen tyrosine kinase 1 1
MIRT043444 ABLIM1 actin binding LIM protein 1 1 1
MIRT043445 PSMD1 proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 1 1
MIRT043446 KAT2A K(lysine) acetyltransferase 2A 1 1
MIRT043447 PLXNB2 plexin B2 1 1
MIRT043448 GTPBP1 GTP binding protein 1 1 1
MIRT043449 MTPN myotrophin 1 1
MIRT043450 DDX56 DEAD (Asp-Glu-Ala-Asp) box polypeptide 56 1 1
MIRT043451 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT043452 TSFM Ts translation elongation factor, mitochondrial 1 1
MIRT043453 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT043454 STK35 serine/threonine kinase 35 1 1
MIRT043455 PRKACA protein kinase, cAMP-dependent, catalytic, alpha 1 1
MIRT043456 ZNF512B zinc finger protein 512B 1 1
MIRT043457 PLA2G4F phospholipase A2, group IVF 1 1
MIRT043458 SIRT1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 1 1
MIRT043459 C14orf166 chromosome 14 open reading frame 166 1 1
MIRT043460 MPC1 brain protein 44-like 1 1
MIRT043461 RPS3 ribosomal protein S3 1 1
MIRT043462 PLEKHG4 pleckstrin homology domain containing, family G (with RhoGef domain) member 4 1 1
MIRT043463 EXOC7 exocyst complex component 7 1 1
MIRT043464 TRIM65 tripartite motif-containing 65 1 1
MIRT043465 SPEN spen homolog, transcriptional regulator (Drosophila) 1 1
MIRT043466 BAG6 HLA-B associated transcript 3 1 1
MIRT043467 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT043468 IRGQ immunity-related GTPase family, Q 1 1
MIRT043469 APBB1 amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65) 1 1
MIRT043470 PGAM1 phosphoglycerate mutase 1 (brain) 1 1
MIRT043471 PITPNA phosphatidylinositol transfer protein, alpha 1 1
MIRT043472 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 1 1
MIRT043473 HNRNPM heterogeneous nuclear ribonucleoprotein M 1 1
MIRT043474 IARS isoleucyl-tRNA synthetase 1 1
MIRT043475 PSME3 proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) 1 1
MIRT043476 SOLH small optic lobes homolog (Drosophila) 1 1
MIRT043477 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT043478 MRPS26 mitochondrial ribosomal protein S26 1 1
MIRT043479 FBXL5 F-box and leucine-rich repeat protein 5 1 1
MIRT043480 LEPREL2 leprecan-like 2 1 1
MIRT043481 COX7C cytochrome c oxidase subunit VIIc 1 1
MIRT043482 ZDHHC5 zinc finger, DHHC-type containing 5 1 1
MIRT043483 XRCC5 X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining) 1 1
MIRT043484 NARS asparaginyl-tRNA synthetase 1 1
MIRT043485 FASTK Fas-activated serine/threonine kinase 1 1
MIRT043486 LETM1 leucine zipper-EF-hand containing transmembrane protein 1 1 1
MIRT043487 DDX17 DEAD (Asp-Glu-Ala-Asp) box polypeptide 17 1 1
MIRT043488 KIAA1244 KIAA1244 1 1
MIRT043489 CAD carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase 1 1
MIRT043490 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT043491 SLC25A4 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4 1 1
MIRT043492 PTPN13 protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase) 1 1
MIRT043493 EIF4A3 eukaryotic translation initiation factor 4A3 1 1
MIRT043494 ATF3 activating transcription factor 3 1 1
MIRT043495 HMGA1 high mobility group AT-hook 1 1 1
MIRT043496 PLEKHF1 pleckstrin homology domain containing, family F (with FYVE domain) member 1 1 1
MIRT043497 DHX8 DEAH (Asp-Glu-Ala-His) box polypeptide 8 1 1
MIRT043498 PHLDB3 pleckstrin homology-like domain, family B, member 3 1 1
MIRT043499 POLDIP3 polymerase (DNA-directed), delta interacting protein 3 1 1
MIRT043500 PSMD7 proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 1 1
MIRT043501 NOP2 NOP2 nucleolar protein homolog (yeast) 1 1
MIRT043502 SLC25A14 solute carrier family 25 (mitochondrial carrier, brain), member 14 1 1
MIRT043503 RASL10B RAS-like, family 10, member B 1 1
MIRT043504 NLRX1 NLR family member X1 1 1
MIRT043505 PDXP pyridoxal (pyridoxine, vitamin B6) phosphatase 1 1
MIRT043506 BCL9L B-cell CLL/lymphoma 9-like 1 1
MIRT043507 PHGDH phosphoglycerate dehydrogenase 1 1
MIRT043508 NCLN nicalin homolog (zebrafish) 1 1
MIRT043509 RNASEH1 ribonuclease H1 1 1
MIRT043510 C21orf33 chromosome 21 open reading frame 33 1 1
MIRT043511 PIGS phosphatidylinositol glycan anchor biosynthesis, class S 1 1
MIRT043512 SLC9A1 solute carrier family 9 (sodium/hydrogen exchanger), member 1 1 1
MIRT043513 RRBP1 ribosome binding protein 1 homolog 180kDa (dog) 1 1
MIRT043514 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT043515 FLII flightless I homolog (Drosophila) 1 1
MIRT043516 RPS12 ribosomal protein S12 1 1
MIRT043517 SMG6 Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans) 1 1
MIRT043518 MYBBP1A MYB binding protein (P160) 1a 1 1
MIRT043519 FUT11 fucosyltransferase 11 (alpha (1,3) fucosyltransferase) 1 1
MIRT043520 APOPT1 chromosome 14 open reading frame 153 1 1
MIRT043521 SNRNP70 small nuclear ribonucleoprotein 70kDa (U1) 1 1
MIRT043522 PDPK1 3-phosphoinositide dependent protein kinase-1 1 1
MIRT043523 UBA1 ubiquitin-like modifier activating enzyme 1 1 1
MIRT043524 PTPRT protein tyrosine phosphatase, receptor type, T 1 1
MIRT043525 RPL29 ribosomal protein L29 1 1
MIRT043526 TMEM254 chromosome 10 open reading frame 57 1 1
MIRT043527 AARS alanyl-tRNA synthetase 1 1
MIRT043528 MARCKSL1 MARCKS-like 1 1 1
MIRT043529 ANKRD52 ankyrin repeat domain 52 1 1
MIRT043530 NDST1 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 1 1
MIRT043531 MARK3 MAP/microtubule affinity-regulating kinase 3 1 1
MIRT043532 TRAP1 TNF receptor-associated protein 1 1 1
MIRT043533 AMBRA1 autophagy/beclin-1 regulator 1 1 1
MIRT043534 RRP7A ribosomal RNA processing 7 homolog A (S. cerevisiae) 1 1
MIRT043535 IGF2BP2 insulin-like growth factor 2 mRNA binding protein 2 1 1
MIRT043536 TUBB4B tubulin, beta 2C 1 1
MIRT043537 VPS37B vacuolar protein sorting 37 homolog B (S. cerevisiae) 1 1
MIRT043538 ZNF598 zinc finger protein 598 1 1
MIRT043539 FLT4 fms-related tyrosine kinase 4 1 1
MIRT043540 SREBF2 sterol regulatory element binding transcription factor 2 1 1
MIRT043541 SPTB spectrin, beta, erythrocytic 1 1
MIRT043542 PITX1 paired-like homeodomain 1 1 1
MIRT043543 SPTBN1 spectrin, beta, non-erythrocytic 1 1 1
MIRT043544 BOK BCL2-related ovarian killer 1 1
MIRT043545 GGT7 gamma-glutamyltransferase 7 1 1
MIRT043546 HIST2H4B histone cluster 2, H4b 1 1
MIRT043547 C12orf65 chromosome 12 open reading frame 65 1 1
MIRT043548 VARS valyl-tRNA synthetase 1 1
MIRT043549 AKIRIN1 akirin 1 1 1
MIRT043550 MAP4 microtubule-associated protein 4 1 1
MIRT043551 EPB41L2 erythrocyte membrane protein band 4.1-like 2 1 1
MIRT043552 PINX1 PIN2/TERF1 interacting, telomerase inhibitor 1 1 1
MIRT043553 GSE1 KIAA0182 1 1
MIRT043554 LDHA lactate dehydrogenase A 1 1
MIRT043555 EN2 engrailed homeobox 2 1 1
MIRT043556 MNT MAX binding protein 1 1
MIRT043557 ZNF286A zinc finger protein 286A 1 1
MIRT043558 YTHDF1 YTH domain family, member 1 1 1
MIRT043559 ADCY9 adenylate cyclase 9 1 1
MIRT043560 SEPN1 selenoprotein N, 1 1 1
MIRT043561 C19orf55 chromosome 19 open reading frame 55 1 1
MIRT043562 IL4R interleukin 4 receptor 1 1
MIRT043563 SF3B2 splicing factor 3b, subunit 2, 145kDa 1 1
MIRT043564 BRPF1 bromodomain and PHD finger containing, 1 1 1
MIRT043565 RRP1B ribosomal RNA processing 1 homolog B (S. cerevisiae) 1 1
MIRT043566 ZER1 zer-1 homolog (C. elegans) 1 1
MIRT043567 ZNF629 zinc finger protein 629 1 1
MIRT043568 CUEDC2 CUE domain containing 2 1 1
MIRT043569 PHF23 PHD finger protein 23 1 1
MIRT043570 TCFL5 transcription factor-like 5 (basic helix-loop-helix) 1 1
MIRT043571 COTL1 coactosin-like 1 (Dictyostelium) 1 1
MIRT043572 ZNF503 zinc finger protein 503 1 1
MIRT043573 ARHGEF1 Rho guanine nucleotide exchange factor (GEF) 1 1 1
MIRT043574 E2F2 E2F transcription factor 2 1 1