Accession ID: MIRT043675 [miRNA, hsa-miR-342-3p :: ATXN7, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-342LinkOut: [miRBase ]
Synonyms MIRN342, hsa-mir-342, MIR342
Description Homo sapiens miR-342 stem-loop
Comment This sequence was predicted by homology to a rat miRNA .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-342-3p
Mature Sequence 61| UCUCACACAGAAAUCGCACCCGU |83
Evidence Experimental
Experiments Cloned
Putative hsa-miR-342-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-342-3p :: ATXN7    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 5'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' tgCCCACG---CT--AAAGACACACTct 5'
            ||||||    |  ||||| | |||  
Target 5' --GGGTGCTTTTATTTTTCTCTTTGAtt 3'
1 - 26
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
295 hsa-miR-342-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005881 GEMIN4 gem (nuclear organelle) associated protein 4 3 2
MIRT005882 BMP7 bone morphogenetic protein 7 2 1
MIRT006443 DNMT1 DNA (cytosine-5-)-methyltransferase 1 3 1
MIRT043661 TMEM98 transmembrane protein 98 1 1
MIRT043662 IDH3B isocitrate dehydrogenase 3 (NAD+) beta 1 1
MIRT043663 KPNA2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1 1
MIRT043664 PRKCE protein kinase C, epsilon 1 1
MIRT043665 TRMT61A tRNA methyltransferase 61 homolog A (S. cerevisiae) 1 1
MIRT043666 ZNF766 zinc finger protein 766 1 1
MIRT043667 FIGN fidgetin 1 1
MIRT043668 FIBP fibroblast growth factor (acidic) intracellular binding protein 1 1
MIRT043669 ARIH2 ariadne homolog 2 (Drosophila) 1 1
MIRT043670 KCTD15 potassium channel tetramerisation domain containing 15 1 1
MIRT043671 RPS3A ribosomal protein S3A 1 1
MIRT043672 NCAN neurocan 1 1
MIRT043673 SLC6A12 solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 1 1
MIRT043674 RPS9 ribosomal protein S9 1 1
MIRT043675 ATXN7 ataxin 7 1 1
MIRT043676 ISOC2 isochorismatase domain containing 2 1 1
MIRT043677 CRB2 crumbs homolog 2 (Drosophila) 1 2
MIRT043678 PPIE peptidylprolyl isomerase E (cyclophilin E) 1 1
MIRT043679 PSAT1 phosphoserine aminotransferase 1 1 1
MIRT043680 GJA1 gap junction protein, alpha 1, 43kDa 1 1
MIRT043681 CANX calnexin 1 1
MIRT043682 NOP2 NOP2 nucleolar protein homolog (yeast) 1 1
MIRT043683 VAPB VAMP (vesicle-associated membrane protein)-associated protein B and C 1 1
MIRT043684 ATF4 activating transcription factor 4 (tax-responsive enhancer element B67) 1 1
MIRT043685 BPTF bromodomain PHD finger transcription factor 1 1
MIRT043686 RPL26 ribosomal protein L26 1 1
MIRT043687 NGRN neugrin, neurite outgrowth associated 1 1
MIRT043688 TNS3 tensin 3 1 2
MIRT043689 RPL15 ribosomal protein L15 1 1
MIRT043690 FN3KRP fructosamine 3 kinase related protein 1 1
MIRT043691 METTL2A methyltransferase like 2A 1 1
MIRT043692 VPS35 vacuolar protein sorting 35 homolog (S. cerevisiae) 1 1
MIRT043693 IDS iduronate 2-sulfatase 1 1
MIRT043694 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 1 1
MIRT043695 ABL1 c-abl oncogene 1, non-receptor tyrosine kinase 1 1
MIRT043696 SLC30A9 solute carrier family 30 (zinc transporter), member 9 1 1
MIRT043697 RPL27A ribosomal protein L27a 1 1
MIRT043698 GOT2 glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2) 1 1
MIRT043699 PRKCSH protein kinase C substrate 80K-H 1 1
MIRT043700 RRM2 ribonucleotide reductase M2 1 1
MIRT043701 RFX3 regulatory factor X, 3 (influences HLA class II expression) 1 1
MIRT043702 CCND2 cyclin D2 1 1
MIRT043703 GART phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase 1 1
MIRT043704 ZNF430 zinc finger protein 430 1 1
MIRT043705 NAPG N-ethylmaleimide-sensitive factor attachment protein, gamma 1 1
MIRT043706 GTF2H2C general transcription factor IIH, polypeptide 2C 1 1
MIRT043707 FAM3C family with sequence similarity 3, member C 1 1
MIRT043708 PWP2 PWP2 periodic tryptophan protein homolog (yeast) 1 1
MIRT043709 PTRF polymerase I and transcript release factor 1 2
MIRT043710 ZC3H12C zinc finger CCCH-type containing 12C 1 1
MIRT043711 ACTG1 actin, gamma 1 1 1
MIRT043712 TRERF1 transcriptional regulating factor 1 1 2
MIRT043713 CBX1 chromobox homolog 1 1 1
MIRT043714 TOMM70A translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae) 1 1
MIRT043715 ZSCAN29 zinc finger and SCAN domain containing 29 1 2
MIRT043716 NABP2 nucleic acid binding protein 2 1 1
MIRT043717 HARS histidyl-tRNA synthetase 1 1
MIRT043718 INO80D INO80 complex subunit D 1 1
MIRT043719 RALGAPB Ral GTPase activating protein, beta subunit (non-catalytic) 1 1
MIRT043720 EEF1A2 eukaryotic translation elongation factor 1 alpha 2 1 1
MIRT043721 PA2G4 proliferation-associated 2G4, 38kDa 1 1
MIRT043722 STRN striatin, calmodulin binding protein 1 1
MIRT043723 CCDC6 coiled-coil domain containing 6 1 1
MIRT043724 EXOSC1 exosome component 1 1 1
MIRT043725 EPB41 erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) 1 2
MIRT043726 ZFC3H1 zinc finger, C3H1-type containing 1 1
MIRT043727 XPOT exportin, tRNA 1 1
MIRT043728 JUN jun proto-oncogene 1 1
MIRT043729 SOD2 superoxide dismutase 2, mitochondrial 1 1
MIRT043730 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT043731 TCP1 t-complex 1 1 1
MIRT043732 TCF3 transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47) 1 1
MIRT043733 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT043734 TRAP1 TNF receptor-associated protein 1 1 1
MIRT043735 FOSL2 FOS-like antigen 2 1 1
MIRT043736 APTX aprataxin 1 1
MIRT043737 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT043738 SF3B2 splicing factor 3b, subunit 2, 145kDa 1 1
MIRT043739 TACC1 transforming, acidic coiled-coil containing protein 1 1 1
MIRT043740 CXADR coxsackie virus and adenovirus receptor 1 1
MIRT054884 ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 3 1
MIRT102908 INSIG1 insulin induced gene 1 1 2
MIRT407297 IGFBP5 insulin-like growth factor binding protein 5 1 2
MIRT437733 RMND5A required for meiotic nuclear division 5 homolog A (S. cerevisiae) 2 1
MIRT437734 SYNPO2L synaptopodin 2-like 2 1
MIRT437735 CAMK2N1 calcium/calmodulin-dependent protein kinase II inhibitor 1 2 1
MIRT437736 CPEB4 cytoplasmic polyadenylation element binding protein 4 2 1
MIRT437737 C20orf11 GID complex subunit 8 homolog (S. cerevisiae) 2 1
MIRT437738 TIAM1 T-cell lymphoma invasion and metastasis 1 2 1
MIRT437783 ANKRD49 ankyrin repeat domain 49 2 2
MIRT438066 SREBF1 sterol regulatory element binding transcription factor 1 3 1
MIRT438067 SREBF2 sterol regulatory element binding transcription factor 2 3 1
MIRT446662 MXI1 MAX interactor 1 1 2
MIRT451848 TXNDC5 thioredoxin domain containing 5 (endoplasmic reticulum) 1 1
MIRT454440 QRFPR pyroglutamylated RFamide peptide receptor 1 1
MIRT457188 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT463394 ZDHHC20 zinc finger, DHHC-type containing 20 1 1
MIRT464518 UBXN7 UBX domain protein 7 1 1
MIRT469230 RHOBTB3 Rho-related BTB domain containing 3 1 1
MIRT472349 NETO2 neuropilin (NRP) and tolloid (TLL)-like 2 1 1
MIRT503514 USP51 ubiquitin specific peptidase 51 1 3
MIRT510418 ZNF268 zinc finger protein 268 1 2
MIRT511283 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT524562 CALR calreticulin 1 1
MIRT527248 ASB3 ankyrin repeat and SOCS box containing 3 1 1
MIRT528806 RAB32 RAB32, member RAS oncogene family 1 1
MIRT529775 ZNF486 zinc finger protein 486 1 1
MIRT530278 CIRH1A cirrhosis, autosomal recessive 1A (cirhin) 1 2
MIRT531817 GPR75-ASB3 GPR75-ASB3 readthrough 1 1
MIRT534376 SETD7 SET domain containing (lysine methyltransferase) 7 1 1
MIRT534784 RAD23B RAD23 homolog B (S. cerevisiae) 1 1
MIRT539662 EID1 EP300 interacting inhibitor of differentiation 1 1 5
MIRT539827 KLF8 Kruppel-like factor 8 1 1
MIRT540117 KLF17 Kruppel-like factor 17 1 1
MIRT540474 MLLT6 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 1 3
MIRT540605 CD3D CD3d molecule, delta (CD3-TCR complex) 1 1
MIRT540671 LHFPL3 lipoma HMGIC fusion partner-like 3 1 2
MIRT540697 ATG10 autophagy related 10 1 2
MIRT540765 RALGPS1 Ral GEF with PH domain and SH3 binding motif 1 1 2
MIRT541057 SEPHS1 selenophosphate synthetase 1 1 1
MIRT541345 FRMD3 FERM domain containing 3 1 2
MIRT541479 ARF3 ADP-ribosylation factor 3 1 3
MIRT541574 SYT5 synaptotagmin V 1 3
MIRT541714 TMEM33 transmembrane protein 33 1 1
MIRT541893 LY6G5B lymphocyte antigen 6 complex, locus G5B 1 1
MIRT541944 NBPF10 neuroblastoma breakpoint family, member 10 1 2
MIRT542038 FAM180B family with sequence similarity 180, member B 1 5
MIRT542120 EPHB3 EPH receptor B3 1 4
MIRT542150 EGR3 early growth response 3 1 2
MIRT547498 MBNL3 muscleblind-like splicing regulator 3 1 2
MIRT551163 UBTF upstream binding transcription factor, RNA polymerase I 1 2
MIRT557042 HOXB3 homeobox B3 1 1
MIRT560204 AK4 adenylate kinase 4 1 1
MIRT565953 RRAGD Ras-related GTP binding D 1 1
MIRT566178 PTPN14 protein tyrosine phosphatase, non-receptor type 14 1 1
MIRT569210 SHC3 SHC (Src homology 2 domain containing) transforming protein 3 1 1
MIRT570179 RCBTB1 regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1 1 1
MIRT571553 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide 1 1
MIRT572159 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 1
MIRT572574 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 1 1
MIRT573183 P2RX3 purinergic receptor P2X, ligand-gated ion channel, 3 1 1
MIRT575398 Zdhhc22 zinc finger, DHHC-type containing 22 1 1
MIRT575406 Rnf152 ring finger protein 152 1 1
MIRT576117 Klf6 Kruppel-like factor 6 1 1
MIRT576239 Rgs4 regulator of G-protein signaling 4 1 1
MIRT576246 Asah2 N-acylsphingosine amidohydrolase 2 1 1
MIRT607088 RNF152 ring finger protein 152 1 3
MIRT607211 ASAH2 N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2 1 3
MIRT607280 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 2
MIRT609144 ZNF610 zinc finger protein 610 1 1
MIRT609878 RAD54L2 RAD54-like 2 (S. cerevisiae) 1 2
MIRT610080 CRLF1 cytokine receptor-like factor 1 1 1
MIRT610223 HDAC9 histone deacetylase 9 1 1
MIRT610232 ACOT9 acyl-CoA thioesterase 9 1 2
MIRT610558 NBPF14 neuroblastoma breakpoint family, member 14 1 1
MIRT610699 ZNF548 zinc finger protein 548 1 1
MIRT611213 CLN8 ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation) 1 3
MIRT611288 PAGR1 PAXIP1 associated glutamate-rich protein 1 1 1
MIRT611307 ZDHHC22 zinc finger, DHHC-type containing 22 1 1
MIRT611504 HIPK3 homeodomain interacting protein kinase 3 1 1
MIRT611759 PLA2G7 phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma) 1 3
MIRT611976 ZNF175 zinc finger protein 175 1 1
MIRT612318 UBE2H ubiquitin-conjugating enzyme E2H 1 1
MIRT612387 TCTE1 t-complex-associated-testis-expressed 1 1 4
MIRT612411 SPAG7 sperm associated antigen 7 1 1
MIRT612514 SH3PXD2A SH3 and PX domains 2A 1 2
MIRT612542 RPAP2 RNA polymerase II associated protein 2 1 1
MIRT612812 LMX1A LIM homeobox transcription factor 1, alpha 1 1
MIRT613262 C2orf72 chromosome 2 open reading frame 72 1 2
MIRT613327 ANTXR2 anthrax toxin receptor 2 1 1
MIRT613372 ACVR1B activin A receptor, type IB 1 1
MIRT614341 PVRIG poliovirus receptor related immunoglobulin domain containing 1 2
MIRT614774 SLC41A2 solute carrier family 41, member 2 1 2
MIRT615053 DCAF12 DDB1 and CUL4 associated factor 12 1 1
MIRT615063 CRIM1 cysteine rich transmembrane BMP regulator 1 (chordin-like) 1 1
MIRT615345 LONRF1 LON peptidase N-terminal domain and ring finger 1 1 1
MIRT615628 F11R F11 receptor 1 2
MIRT615687 ZNF280B zinc finger protein 280B 1 1
MIRT616247 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 1 2
MIRT616521 ASAH2B N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2B 1 1
MIRT616579 FAM107A family with sequence similarity 107, member A 1 1
MIRT617567 RPSAP58 ribosomal protein SA pseudogene 58 1 2
MIRT617921 WDR73 WD repeat domain 73 1 1
MIRT618484 SIGLEC15 sialic acid binding Ig-like lectin 15 1 1
MIRT618697 KIF13A kinesin family member 13A 1 1
MIRT620429 ATP6V1G3 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3 1 1
MIRT620696 RFTN2 raftlin family member 2 1 1
MIRT622433 NUDT19 nudix (nucleoside diphosphate linked moiety X)-type motif 19 1 1
MIRT623125 NEURL1B neuralized homolog 1B (Drosophila) 1 1
MIRT623435 KIAA1161 KIAA1161 1 1
MIRT623633 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT623758 GRID1 glutamate receptor, ionotropic, delta 1 1 1
MIRT624078 DUSP6 dual specificity phosphatase 6 1 1
MIRT624149 DIAPH1 diaphanous homolog 1 (Drosophila) 1 1
MIRT625971 PKP1 plakophilin 1 (ectodermal dysplasia/skin fragility syndrome) 1 1
MIRT626853 IREB2 iron-responsive element binding protein 2 1 1
MIRT627799 PXDN peroxidasin homolog (Drosophila) 1 1
MIRT628216 FOXJ3 forkhead box J3 1 1
MIRT628728 IKZF3 IKAROS family zinc finger 3 (Aiolos) 1 1
MIRT628742 ZC3H12B zinc finger CCCH-type containing 12B 1 1
MIRT628913 DARS aspartyl-tRNA synthetase 1 1
MIRT630686 HUNK hormonally up-regulated Neu-associated kinase 1 2
MIRT631701 C1QTNF6 C1q and tumor necrosis factor related protein 6 1 1
MIRT631987 CLSTN3 calsyntenin 3 1 2
MIRT632221 YME1L1 YME1-like 1 (S. cerevisiae) 1 1
MIRT632387 SLITRK4 SLIT and NTRK-like family, member 4 1 1
MIRT632429 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 1
MIRT632639 OSMR oncostatin M receptor 1 1
MIRT633415 TMEM120B transmembrane protein 120B 1 1
MIRT634312 SNTN sentan, cilia apical structure protein 1 1
MIRT634424 PHKG2 phosphorylase kinase, gamma 2 (testis) 1 1
MIRT634486 OR7D2 olfactory receptor, family 7, subfamily D, member 2 1 1
MIRT635142 PLEKHA2 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2 1 1
MIRT637088 SELPLG selectin P ligand 1 1
MIRT637595 PLD6 phospholipase D family, member 6 1 1
MIRT637685 PPM1D protein phosphatase, Mg2+/Mn2+ dependent, 1D 1 1
MIRT638438 PLXNA4 plexin A4 1 1
MIRT638660 GGCX gamma-glutamyl carboxylase 1 1
MIRT638775 EMC7 ER membrane protein complex subunit 7 1 1
MIRT638956 BHLHB9 basic helix-loop-helix domain containing, class B, 9 1 1
MIRT640594 TM9SF4 transmembrane 9 superfamily protein member 4 1 1
MIRT646836 TLDC1 KIAA1609 1 1
MIRT648283 TRAPPC2L trafficking protein particle complex 2-like 1 1
MIRT650728 TNFSF8 tumor necrosis factor (ligand) superfamily, member 8 1 1
MIRT652628 TIMM10B fracture callus 1 homolog (rat) 1 1
MIRT653036 STRN3 striatin, calmodulin binding protein 3 1 1
MIRT655877 NFASC neurofascin 1 1
MIRT656165 MRRF mitochondrial ribosome recycling factor 1 1
MIRT659533 CHD9 chromodomain helicase DNA binding protein 9 1 1
MIRT659637 CDK6 cyclin-dependent kinase 6 1 1
MIRT661112 FPR1 formyl peptide receptor 1 1 1
MIRT661503 EIF1AD eukaryotic translation initiation factor 1A domain containing 1 1
MIRT661660 ZNF623 zinc finger protein 623 1 1
MIRT662095 ZNF419 zinc finger protein 419 1 1
MIRT665496 VAPA VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa 1 1
MIRT665750 TMEM55A transmembrane protein 55A 1 1
MIRT665777 TMEM236 transmembrane protein 236 1 1
MIRT665952 TAL1 T-cell acute lymphocytic leukemia 1 1 2
MIRT670473 TMEM105 transmembrane protein 105 1 1
MIRT670999 PTGIS prostaglandin I2 (prostacyclin) synthase 1 1
MIRT671254 ATP6V0E1 ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 1 1
MIRT671291 RPL37A ribosomal protein L37a 1 1
MIRT671600 RILPL1 Rab interacting lysosomal protein-like 1 1 1
MIRT671611 C6orf25 chromosome 6 open reading frame 25 1 1
MIRT671769 PLA2G4A phospholipase A2, group IVA (cytosolic, calcium-dependent) 1 1
MIRT672458 POU2F3 POU class 2 homeobox 3 1 1
MIRT672625 IGF2R insulin-like growth factor 2 receptor 1 2
MIRT672805 PPM1L protein phosphatase, Mg2+/Mn2+ dependent, 1L 1 1
MIRT673029 RBBP4 retinoblastoma binding protein 4 1 1
MIRT674322 POLR1B polymerase (RNA) I polypeptide B, 128kDa 1 1
MIRT674576 KIF3A kinesin family member 3A 1 1
MIRT675032 SNX1 sorting nexin 1 1 1
MIRT675155 NDRG1 N-myc downstream regulated 1 1 1
MIRT675211 TTC9C tetratricopeptide repeat domain 9C 1 1
MIRT675221 UGDH UDP-glucose 6-dehydrogenase 1 1
MIRT678334 TAF8 TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa 1 1
MIRT683473 RGS4 regulator of G-protein signaling 4 1 1
MIRT689825 HIST1H2BJ histone cluster 1, H2bj 1 1
MIRT697534 ZBTB46 zinc finger and BTB domain containing 46 1 1
MIRT697709 WAC WW domain containing adaptor with coiled-coil 1 1
MIRT703498 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT704278 DGS2 DiGeorge syndrome/velocardiofacial syndrome complex 2 1 1
MIRT705829 AIFM2 apoptosis-inducing factor, mitochondrion-associated, 2 1 1
MIRT708261 PGPEP1 pyroglutamyl-peptidase I 1 1
MIRT708690 LRPAP1 low density lipoprotein receptor-related protein associated protein 1 1 1
MIRT708892 ZNF780A zinc finger protein 780A 1 1
MIRT709317 HMBOX1 homeobox containing 1 1 1
MIRT709582 LETMD1 LETM1 domain containing 1 1 1
MIRT710166 MTRF1L mitochondrial translational release factor 1-like 1 1
MIRT711301 ACOX1 acyl-CoA oxidase 1, palmitoyl 1 1
MIRT711508 ESCO1 establishment of cohesion 1 homolog 1 (S. cerevisiae) 1 1
MIRT711644 LIPG lipase, endothelial 1 1
MIRT711758 CCDC59 coiled-coil domain containing 59 1 1
MIRT712005 F9 coagulation factor IX 1 1
MIRT712260 PTPRN2 protein tyrosine phosphatase, receptor type, N polypeptide 2 1 1
MIRT712796 KCTD16 potassium channel tetramerisation domain containing 16 1 1
MIRT714112 TMED9 transmembrane emp24 protein transport domain containing 9 1 1
MIRT714533 ZBTB39 zinc finger and BTB domain containing 39 1 1
MIRT714569 GALNT10 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10) 1 1
MIRT714940 ZNF330 zinc finger protein 330 1 1
MIRT715509 MAPKBP1 mitogen-activated protein kinase binding protein 1 1 1
MIRT715573 CYP4F11 cytochrome P450, family 4, subfamily F, polypeptide 11 1 1
MIRT715977 TFRC transferrin receptor (p90, CD71) 1 1
MIRT716139 LSAMP limbic system-associated membrane protein 1 1
MIRT720215 KCNK1 potassium channel, subfamily K, member 1 1 1
MIRT721332 IFNAR2 interferon (alpha, beta and omega) receptor 2 1 1
MIRT722069 TP53INP2 tumor protein p53 inducible nuclear protein 2 1 1
MIRT722189 DNAJC9 DnaJ (Hsp40) homolog, subfamily C, member 9 1 1
MIRT722969 SLC25A26 solute carrier family 25 (S-adenosylmethionine carrier), member 26 1 1
MIRT723246 TMLHE trimethyllysine hydroxylase, epsilon 1 1
MIRT724116 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT725378 MLXIP MLX interacting protein 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*