Accession ID: MIRT043692 [miRNA, hsa-miR-342-3p :: VPS35, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-342LinkOut: [miRBase ]
Synonyms MIRN342, hsa-mir-342, MIR342
Description Homo sapiens miR-342 stem-loop
Comment This sequence was predicted by homology to a rat miRNA .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-342-3p
Mature Sequence 61| UCUCACACAGAAAUCGCACCCGU |83
Evidence Experimental
Experiments Cloned
Putative hsa-miR-342-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol VPS35 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms DKFZp434E1211, DKFZp434P1672, FLJ10752, FLJ13588, FLJ20388, MEM3
Description vacuolar protein sorting 35 homolog (S. cerevisiae)
Transcript NM_0182    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on VPS35 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of VPS35
(miRNA target sites are highlighted)
>VPS35|NM_0182|3'UTR
   1 TAAAAAGGAAATAGCTCACCATACTCCTTTCCATGTACATCCAGTGAGGGTTTTATTACGCTAGGTTTCCCTTCCATAGA
  81 TTGTGCCTTTCAGAAATGCTGAGGTAGGTTTCCCATTTCTTACCTGTGATGTGTTTTACCCAGCACCTCCGGACACTCAC
 161 CTTCAGGACCTTAATAAAATTATTCACTTGGTAAGTGTTCAAGTCTTTCTGATCACCCCAAGTAGCATGACTGATCTGCA
 241 ATTTAAAATTCCTGTGATCTGTAAAAAAAAAAAAAAAAAAAAAAACAAAACCCACAAGCACTTATCTTGGCTACTAATGA
 321 AGCTCTCCTTTTTTTTGTTTGTTTGTTTGCTTCATTGTTGATTGTGTATTTTCTTCATTCCTGGGGAGTACTAACCCAAA
 401 AGCGTCTGTCTCTTGTTTTCTAGTCCAGTTTGAGATTAATTTAGAAGAAAGGAATACTGTATGTGAAATTCATCTTGGGC
 481 TTTCCCCTAAATTGCAAGATAAGGCCATGTGTAAGATTTTCCCTAAAACTAGAATATATTAATGCATGTTTGAGAATTTT
 561 AAAGCACCATGGTCAAAACCAGAAGCTATATTTTGCATATTTGGACTCAGCCATCCATTAAGAACCCATGTTGTCCTCTG
 641 GACATATTTATCAATATAATTGGGTTTTAAATAGTATAAAAGAAAACTTGTGATCTATATAATTTATGTATCACCTTCAT
 721 TGTAAATTTAGCAGGAAATGCATCACAATTATGATTTTTTTTTTTGCACCAGTGAAACAATAAAGATGCTATTAACAAAA
 801 AAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugcccACGCUAAAGACACACUCu 5'
               | | | | | || |||| 
Target 5' ttgttTTCTAGTCCAGTTTGAGa 3'
413 - 435 118.00 -6.70
2
miRNA  3' ugcccacgcUAAAGACACACUCu 5'
                   ||   ||| |||| 
Target 5' aatatattaATGCATGTTTGAGa 3'
533 - 555 114.00 -7.00
3
miRNA  3' ugcccacgcuaaagACACACUCu 5'
                        ||||| || 
Target 5' gcaagataaggccaTGTGTAAGa 3'
494 - 516 113.00 -6.80
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-342-3p :: VPS35    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
83 hsa-miR-342-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005881 GEMIN4 gem (nuclear organelle) associated protein 4 2 1
MIRT005882 BMP7 bone morphogenetic protein 7 2 1
MIRT006443 DNMT1 DNA (cytosine-5-)-methyltransferase 1 3 1
MIRT043661 TMEM98 transmembrane protein 98 1 1
MIRT043662 IDH3B isocitrate dehydrogenase 3 (NAD+) beta 1 1
MIRT043663 KPNA2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1 1
MIRT043664 PRKCE protein kinase C, epsilon 1 1
MIRT043665 TRMT61A tRNA methyltransferase 61 homolog A (S. cerevisiae) 1 1
MIRT043666 ZNF766 zinc finger protein 766 1 1
MIRT043667 FIGN fidgetin 1 1
MIRT043668 FIBP fibroblast growth factor (acidic) intracellular binding protein 1 1
MIRT043669 ARIH2 ariadne homolog 2 (Drosophila) 1 1
MIRT043670 KCTD15 potassium channel tetramerisation domain containing 15 1 1
MIRT043671 RPS3A ribosomal protein S3A 1 1
MIRT043672 NCAN neurocan 1 1
MIRT043673 SLC6A12 solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 1 1
MIRT043674 RPS9 ribosomal protein S9 1 1
MIRT043675 ATXN7 ataxin 7 1 1
MIRT043676 ISOC2 isochorismatase domain containing 2 1 1
MIRT043677 CRB2 crumbs homolog 2 (Drosophila) 1 1
MIRT043678 PPIE peptidylprolyl isomerase E (cyclophilin E) 1 1
MIRT043679 PSAT1 phosphoserine aminotransferase 1 1 1
MIRT043680 GJA1 gap junction protein, alpha 1, 43kDa 1 1
MIRT043681 CANX calnexin 1 1
MIRT043682 NOP2 NOP2 nucleolar protein homolog (yeast) 1 1
MIRT043683 VAPB VAMP (vesicle-associated membrane protein)-associated protein B and C 1 1
MIRT043684 ATF4 activating transcription factor 4 (tax-responsive enhancer element B67) 1 1
MIRT043685 BPTF bromodomain PHD finger transcription factor 1 1
MIRT043686 RPL26 ribosomal protein L26 1 1
MIRT043687 NGRN neugrin, neurite outgrowth associated 1 1
MIRT043688 TNS3 tensin 3 1 1
MIRT043689 RPL15 ribosomal protein L15 1 1
MIRT043690 FN3KRP fructosamine 3 kinase related protein 1 1
MIRT043691 METTL2A methyltransferase like 2A 1 1
MIRT043692 VPS35 vacuolar protein sorting 35 homolog (S. cerevisiae) 1 1
MIRT043693 IDS iduronate 2-sulfatase 1 1
MIRT043694 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 1 1
MIRT043695 ABL1 c-abl oncogene 1, receptor tyrosine kinase 1 1
MIRT043696 SLC30A9 solute carrier family 30 (zinc transporter), member 9 1 1
MIRT043697 RPL27A ribosomal protein L27a 1 1
MIRT043698 GOT2 glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2) 1 1
MIRT043699 PRKCSH protein kinase C substrate 80K-H 1 1
MIRT043700 RRM2 ribonucleotide reductase M2 1 1
MIRT043701 RFX3 regulatory factor X, 3 (influences HLA class II expression) 1 1
MIRT043702 CCND2 cyclin D2 1 1
MIRT043703 GART phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase 1 1
MIRT043704 ZNF430 zinc finger protein 430 1 1
MIRT043705 NAPG N-ethylmaleimide-sensitive factor attachment protein, gamma 1 1
MIRT043706 GTF2H2C general transcription factor IIH, polypeptide 2C 1 1
MIRT043707 FAM3C family with sequence similarity 3, member C 1 1
MIRT043708 PWP2 PWP2 periodic tryptophan protein homolog (yeast) 1 1
MIRT043709 PTRF polymerase I and transcript release factor 1 1
MIRT043710 ZC3H12C zinc finger CCCH-type containing 12C 1 1
MIRT043711 ACTG1 actin, gamma 1 1 1
MIRT043712 TRERF1 transcriptional regulating factor 1 1 1
MIRT043713 CBX1 chromobox homolog 1 (HP1 beta homolog Drosophila ) 1 1
MIRT043714 TOMM70A translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae) 1 1
MIRT043715 ZSCAN29 zinc finger and SCAN domain containing 29 1 1
MIRT043716 NABP2 oligonucleotide/oligosaccharide-binding fold containing 2B 1 1
MIRT043717 HARS histidyl-tRNA synthetase 1 1
MIRT043718 INO80D INO80 complex subunit D 1 1
MIRT043719 RALGAPB Ral GTPase activating protein, beta subunit (non-catalytic) 1 1
MIRT043720 EEF1A2 eukaryotic translation elongation factor 1 alpha 2 1 1
MIRT043721 PA2G4 proliferation-associated 2G4, 38kDa 1 1
MIRT043722 STRN striatin, calmodulin binding protein 1 1
MIRT043723 CCDC6 coiled-coil domain containing 6 1 1
MIRT043724 EXOSC1 exosome component 1 1 1
MIRT043725 EPB41 erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) 1 1
MIRT043726 ZFC3H1 zinc finger, C3H1-type containing 1 1
MIRT043727 XPOT exportin, tRNA (nuclear export receptor for tRNAs) 1 1
MIRT043728 JUN jun oncogene 1 1
MIRT043729 SOD2 superoxide dismutase 2, mitochondrial 1 1
MIRT043730 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT043731 TCP1 t-complex 1 1 1
MIRT043732 TCF3 transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47) 1 1
MIRT043733 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT043734 TRAP1 TNF receptor-associated protein 1 1 1
MIRT043735 FOSL2 FOS-like antigen 2 1 1
MIRT043736 APTX aprataxin 1 1
MIRT043737 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT043738 SF3B2 splicing factor 3b, subunit 2, 145kDa 1 1
MIRT043739 TACC1 transforming, acidic coiled-coil containing protein 1 1 1
MIRT043740 CXADR coxsackie virus and adenovirus receptor 1 1