Accession ID: MIRT043753 [miRNA, hsa-miR-328-3p :: EWSR1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-328LinkOut: [miRBase ]
Synonyms MIRN328, hsa-mir-328, MIR328
Description Homo sapiens miR-328 stem-loop
Comment This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-328-3p
Mature Sequence 48| CUGGCCCUCUCUGCCCUUCCGU |69
Evidence Experimental
Experiments Cloned
Putative hsa-miR-328-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol EWSR1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms EWS, bK984G1.4
Description Ewing sarcoma breakpoint region 1
Transcript NM_0011632    LinkOut: [ RefSeq ]
Other Transcripts NM_0011632 , NM_0011632 , NM_0052 , NM_0139   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on EWSR1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of EWSR1
(miRNA target sites are highlighted)
>EWSR1|NM_0011632|3'UTR
   1 TAGATGCAGAGACCCCGCAGAGCTGCATTGACTACCAGATTTATTTTTTAAACCAGAAAATGTTTTAAATTTATAATTCC
  81 ATATTTATAATGTTGGCCACAACATTATGATTATTCCTTGTCTGTACTTTAGTATTTTTCACCATTTGTGAAGAAACATT
 161 AAAACAAGTTAAATGGTAGTGTGCGGAGTTTTTTTTTCTTCCTTCTTTTAAAAATGGTTGTTTAAGACTTTAACAATGGG
 241 AACCCCTTGTGAGCATGCTCAGTATCATTGTGGAGAACCAAGAGGGCCTCTTAACTGTAACAATGTTCATGGTTGTGATG
 321 TTTTTTTTTTTTTTTTAAATAAAATTCCAAATGTTTATAAAGAGTCAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugcCUUCCCGUCUCUCCCGGuc 5'
             |:||  |  ||||||||  
Target 5' tgtGGAGAACCAAGAGGGCCtc 3'
269 - 290 139.00 -20.30
2
miRNA  3' ugccuucccgucucucCCGGUc 5'
                          ||||| 
Target 5' ccatatttataatgttGGCCAc 3'
79 - 100 100.00 -6.00
3
miRNA  3' ugccuuccCGUCUC-------UCCCGGUc 5'
                  ||||||       || ||:: 
Target 5' ---tagatGCAGAGACCCCGCAGAGCTGc 3'
1 - 26 86.00 -11.52
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-328-3p :: EWSR1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' tgcCTTCCCGTCTCTCCCGGtc 5'
             |:||| |: :|||| ||  
Target 5' agaGGAGGACGTGGAGGACCtg 3'
15 - 36
2
miRNA  3' tgccttcccgtCTCTCCcggtc 5'
                     |:||||     
Target 5' -------agatGGGAGGaagaa 3'
1 - 15
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
91 hsa-miR-328-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000080 BACE1 beta-site APP-cleaving enzyme 1 2 2
MIRT000081 ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 4 3
MIRT000989 CD44 CD44 molecule (Indian blood group) 2 1
MIRT006477 PTPRJ protein tyrosine phosphatase, receptor type, J 2 1
MIRT019531 H2AFX H2A histone family, member X 3 1
MIRT043741 AEBP2 AE binding protein 2 1 1
MIRT043742 GMPPB GDP-mannose pyrophosphorylase B 1 1
MIRT043743 FGF3 fibroblast growth factor 3 (murine mammary tumor virus integration site (v-int-2) oncogene homolog) 1 1
MIRT043744 RPL5 ribosomal protein L5 1 1
MIRT043745 HSDL2 hydroxysteroid dehydrogenase like 2 1 1
MIRT043746 SLC7A1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT043747 TCERG1 transcription elongation regulator 1 1 1
MIRT043748 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT043749 RNASEH2B ribonuclease H2, subunit B 1 1
MIRT043750 RCBTB1 regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1 1 1
MIRT043751 NUP214 nucleoporin 214kDa 1 1
MIRT043752 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 1 1
MIRT043753 EWSR1 Ewing sarcoma breakpoint region 1 1 1
MIRT043754 PKM pyruvate kinase, muscle 1 1
MIRT043755 ABT1 activator of basal transcription 1 1 1
MIRT043756 SPEN spen homolog, transcriptional regulator (Drosophila) 1 1
MIRT043757 RPL36A ribosomal protein L36a 1 1
MIRT043758 RALGAPB Ral GTPase activating protein, beta subunit (non-catalytic) 1 1
MIRT043759 GDI2 GDP dissociation inhibitor 2 1 1
MIRT043760 APP amyloid beta (A4) precursor protein 1 1
MIRT043761 VPS28 vacuolar protein sorting 28 homolog (S. cerevisiae) 1 1
MIRT043762 SNAPIN SNAP-associated protein 1 1
MIRT043763 ADNP activity-dependent neuroprotector homeobox 1 1
MIRT043764 MAP4 microtubule-associated protein 4 1 1
MIRT043765 BTBD10 BTB (POZ) domain containing 10 1 1
MIRT043766 TMEM33 transmembrane protein 33 1 1
MIRT043767 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 1
MIRT043768 KATNB1 katanin p80 (WD repeat containing) subunit B 1 1 1
MIRT043769 SKA1 spindle and kinetochore associated complex subunit 1 1 1
MIRT043770 RPS9 ribosomal protein S9 1 1
MIRT043771 CEP164 centrosomal protein 164kDa 1 1
MIRT043772 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT043773 FKBP4 FK506 binding protein 4, 59kDa 1 1
MIRT043774 MRFAP1 Mof4 family associated protein 1 1 1
MIRT043775 ND6 NADH dehydrogenase, subunit 6 (complex I) 1 1
MIRT043776 FKBP5 FK506 binding protein 5 1 1
MIRT043777 DDX56 DEAD (Asp-Glu-Ala-Asp) box polypeptide 56 1 1
MIRT043778 DNAJA3 DnaJ (Hsp40) homolog, subfamily A, member 3 1 1
MIRT043779 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT043780 DCDC2 doublecortin domain containing 2 1 1
MIRT043781 VPS53 vacuolar protein sorting 53 homolog (S. cerevisiae) 1 1
MIRT043782 COPS6 COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) 1 1
MIRT043783 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT043784 SZRD1 chromosome 1 open reading frame 144 1 1
MIRT043785 MED13L mediator complex subunit 13-like 1 1
MIRT043786 SMC1A structural maintenance of chromosomes 1A 1 1
MIRT043787 HNRNPK heterogeneous nuclear ribonucleoprotein K 1 1
MIRT043788 RRP12 ribosomal RNA processing 12 homolog (S. cerevisiae) 1 1
MIRT043789 BSG basigin (Ok blood group) 1 1
MIRT043790 POM121 POM121 membrane glycoprotein (rat) 1 1
MIRT043791 SNX12 sorting nexin 12 1 1
MIRT043792 NDUFA1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa 1 1
MIRT043793 OTUD5 OTU domain containing 5 1 1
MIRT043794 HIF1AN hypoxia inducible factor 1, alpha subunit inhibitor 1 1
MIRT043795 TYW3 tRNA-yW synthesizing protein 3 homolog (S. cerevisiae) 1 1
MIRT043796 HNRNPL heterogeneous nuclear ribonucleoprotein L 1 1
MIRT043797 EZR ezrin 1 1
MIRT043798 HMGB1 high-mobility group box 1 1 1
MIRT043799 SLC25A40 solute carrier family 25, member 40 1 1
MIRT043800 POLR2I polymerase (RNA) II (DNA directed) polypeptide I, 14.5kDa 1 1
MIRT043801 SLC25A44 solute carrier family 25, member 44 1 1
MIRT043802 RPS2 ribosomal protein S2 1 1
MIRT043803 ARHGEF25 RhoA/RAC/CDC42 exchange factor 1 1
MIRT043804 CBX4 chromobox homolog 4 (Pc class homolog, Drosophila) 1 1
MIRT043805 GMEB2 glucocorticoid modulatory element binding protein 2 1 1
MIRT043806 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide 1 1
MIRT043807 DIAPH1 diaphanous homolog 1 (Drosophila) 1 1
MIRT043808 PIKFYVE phosphoinositide kinase, FYVE finger containing 1 1
MIRT043809 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT043810 IRAK1 interleukin-1 receptor-associated kinase 1 1 1
MIRT043811 UBE2O ubiquitin-conjugating enzyme E2O 1 1
MIRT043812 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT043813 CBX6 chromobox homolog 6 1 1
MIRT043814 HIST2H4B histone cluster 2, H4b 1 1
MIRT043815 ATRAID chromosome 2 open reading frame 28 1 1
MIRT043816 BCOR BCL6 corepressor 1 1
MIRT043817 STT3A STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae) 1 1
MIRT043818 SYNE3 chromosome 14 open reading frame 49 1 1
MIRT043819 GCN1L1 GCN1 general control of amino-acid synthesis 1-like 1 (yeast) 1 1
MIRT043820 MTFP1 mitochondrial protein 18 kDa 1 1
MIRT043821 LPHN1 latrophilin 1 1 1
MIRT043822 COPS3 COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis) 1 1
MIRT043823 CDC42EP1 CDC42 effector protein (Rho GTPase binding) 1 1 1
MIRT043824 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT043825 HIST1H4D histone cluster 1, H4d 1 1
MIRT043826 ALDH1B1 aldehyde dehydrogenase 1 family, member B1 1 1