Accession ID: MIRT043944 [miRNA, hsa-miR-378a-3p :: HSP90AA1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-378aLinkOut: [miRBase ]
Description Homo sapiens miR-378a stem-loop
Comment miR-422b was the most abundant miRNA cloned from human promyelocytic leukemia (HL-60) cells . Further, mir-378 and mir-422a loci are unrelated. miR-422b is thus renamed miR-378 here.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-378a-3p
Mature Sequence 43| ACUGGACUUGGAGUCAGAAGGC |64
Evidence Experimental
Experiments Cloned
Putative hsa-miR-378a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol HSP90AA1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms FLJ31884, HSP86, HSP89A, HSP90A, HSP90N, HSPC1, HSPCA, HSPCAL1, HSPCAL4, HSPN, Hsp89, Hsp90, LAP2
Description heat shock protein 90kDa alpha (cytosolic), class A member 1
Transcript NM_0010179    LinkOut: [ RefSeq ]
Other Transcripts NM_0053   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on HSP90AA1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of HSP90AA1
(miRNA target sites are highlighted)
>HSP90AA1|NM_0010179|3'UTR
   1 TAATCTCTGGCTGAGGGATGACTTACCTGTTCAGTACTCTACAATTCCTCTGATAATATATTTTCAAGGATGTTTTTCTT
  81 TATTTTTGTTAATATTAAAAAGTCTGTATGGCATGACAACTACTTTAAGGGGAAGATAAGATTTCTGTCTACTAAGTGAT
 161 GCTGTGATACCTTAGGCACTAAAGCAGAGCTAGTAATGCTTTTTGAGTTTCATGTTGGTTTATTTTCACAGATTGGGGTA
 241 ACGTGCACTGTAAGACGTATGTAACATGATGTTAACTTTGTGGTCTAAAGTGTTTAGCTGTCAAGCCGGATGCCTAAGTA
 321 GACCAAATCTTGTTATTGAAGTGTTCTGAGCTGTATCTTGATGTTTAGAAAAGTATTCGTTACATCTTGTAGGATCTACT
 401 TTTTGAACTTTTCATTCCCTGTAGTTGACAATTCTGCATGTACTAGTCCTCTAGAAATAGGTTAAACTGAAGCAACTTGA
 481 TGGAAGGATCTCTCCACAGGGCTTGTTTTCCAAAGAAAAGTATTGTTTGGAGGAGCAAAGTTAAAAGCCTACCTAAGCAT
 561 ATCGTAAAGCTGTTCAAAAATAACTCAGACCCAGTCTTGTGGATGGAAATGTAGTGCTCGAGTCACATTCTGCTTAAAGT
 641 TGTAACAAATACAGATGAGTTAAAAGATATTGTGTGACAGTGTCTTATTTAGGGGGAAAGGGGAGTATCTGGATGACAGT
 721 TAGTGCCAAAATGTAAAACATGAGGCGCTAGCAGGAGATGGTTAAACACTAGCTGCTCCAAGGGTTGACATGGTCTTCCC
 801 AGCATGTACTCAGCAGGTGTGGGGTGGAGCACACGTAGGCACAGAAAACAGGAATGCAGACAACATGCATCCCCTGCGTC
 881 CATGAGTTACATGTGTTCTCTTAGTGTCCACGTTGTTTTGATGTTATTCATGGAATACCTTCTGTGTTAAATACAGTCAC
 961 TTAATTCCTTGGCCTTAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cggAAGAC-UG-AGGUUCAGGuca 5'
             ||||| |: | | |||||   
Target 5' caaTTCTGCATGTACTAGTCCtct 3'
429 - 452 119.00 -10.32
2
miRNA  3' cggaagACUGAG-GUUCAGGUCa 5'
                |||||: |  ||:||| 
Target 5' gagggaTGACTTACCTGTTCAGt 3'
13 - 35 112.00 -14.80
3
miRNA  3' cggaAGACUGAGGUUCAGGUCa 5'
              || ||| || ||||: | 
Target 5' taacTCAGAC-CC-AGTCTTGt 3'
581 - 600 108.00 -10.50
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-378a-3p :: HSP90AA1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' ggAAGACTGAGGTTCAGGTCa 5'
            |||||:||:| ||||::| 
Target 5' --TTCTGGCTTC-AGTCTGGa 3'
1 - 18
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
122 hsa-miR-378a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000670 SUFU suppressor of fused homolog (Drosophila) 1 2
MIRT004277 VEGFA vascular endothelial growth factor A 2 1
MIRT004423 TUSC2 tumor suppressor candidate 2 1 2
MIRT005422 NPNT nephronectin 3 1
MIRT005424 GALNT7 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) 3 1
MIRT005482 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 3 1
MIRT005483 TOB2 transducer of ERBB2, 2 3 1
MIRT006681 MSC musculin 1 1
MIRT006759 CYP19A1 cytochrome P450, family 19, subfamily A, polypeptide 1 1 1
MIRT007278 GRB2 growth factor receptor-bound protein 2 1 1
MIRT019654 VPS37B vacuolar protein sorting 37 homolog B (S. cerevisiae) 1 1
MIRT019655 DDX39A DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 1 1
MIRT019656 C3orf38 chromosome 3 open reading frame 38 1 1
MIRT019657 GMEB2 glucocorticoid modulatory element binding protein 2 1 1
MIRT019658 DCLRE1B DNA cross-link repair 1B (PSO2 homolog, S. cerevisiae) 1 1
MIRT019659 LAMP1 lysosomal-associated membrane protein 1 1 2
MIRT019660 CMTM6 CKLF-like MARVEL transmembrane domain containing 6 1 1
MIRT019661 ZBTB14 zinc finger protein 161 homolog (mouse) 1 1
MIRT019662 CHAMP1 zinc finger protein 828 1 1
MIRT019663 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 1 1
MIRT043859 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT043860 TRAF1 TNF receptor-associated factor 1 1 1
MIRT043861 B4GALNT3 beta-1,4-N-acetyl-galactosaminyl transferase 3 1 1
MIRT043862 KLF10 Kruppel-like factor 10 1 1
MIRT043863 ZNF100 zinc finger protein 100 1 1
MIRT043864 EEF1B2 eukaryotic translation elongation factor 1 beta 2 1 1
MIRT043865 USMG5 up-regulated during skeletal muscle growth 5 homolog (mouse) 1 1
MIRT043866 ALDOB aldolase B, fructose-bisphosphate 1 1
MIRT043867 TRAFD1 TRAF-type zinc finger domain containing 1 1 1
MIRT043868 BRWD3 bromodomain and WD repeat domain containing 3 1 1
MIRT043869 RBAK RB-associated KRAB zinc finger 1 1
MIRT043870 TMEM199 transmembrane protein 199 1 1
MIRT043871 DHX15 DEAH (Asp-Glu-Ala-His) box polypeptide 15 1 1
MIRT043872 TCP1 t-complex 1 1 1
MIRT043873 SLC25A2 solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 2 1 1
MIRT043874 KIAA1468 KIAA1468 1 1
MIRT043875 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT043876 ZNF239 zinc finger protein 239 1 1
MIRT043877 NDE1 nudE nuclear distribution gene E homolog 1 (A. nidulans) 1 1
MIRT043878 ID2 inhibitor of DNA binding 2, dominant negative helix-loop-helix protein 1 1
MIRT043879 CASC3 cancer susceptibility candidate 3 1 1
MIRT043880 ZNF473 zinc finger protein 473 1 1
MIRT043881 NDFIP2 Nedd4 family interacting protein 2 1 1
MIRT043882 CPNE1 copine I 1 1
MIRT043883 ERRFI1 ERBB receptor feedback inhibitor 1 1 1
MIRT043884 TRA2B transformer 2 beta homolog (Drosophila) 1 1
MIRT043885 HIST1H3H histone cluster 1, H3h 1 1
MIRT043886 TXNIP thioredoxin interacting protein 1 1
MIRT043887 KDM5C lysine (K)-specific demethylase 5C 1 1
MIRT043888 ZNHIT3 zinc finger, HIT type 3 1 1
MIRT043889 BPTF bromodomain PHD finger transcription factor 1 1
MIRT043890 CPSF7 cleavage and polyadenylation specific factor 7, 59kDa 1 1
MIRT043891 EDARADD EDAR-associated death domain 1 1
MIRT043892 CHCHD4 coiled-coil-helix-coiled-coil-helix domain containing 4 1 1
MIRT043893 DCTN4 dynactin 4 (p62) 1 1
MIRT043894 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT043895 GOLGA8B golgin A8 family, member B 1 1
MIRT043896 ENO1 enolase 1, (alpha) 1 1
MIRT043897 NDFIP1 Nedd4 family interacting protein 1 1 1
MIRT043898 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT043899 DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 1 1
MIRT043900 HIC2 hypermethylated in cancer 2 1 1
MIRT043901 MXD4 MAX dimerization protein 4 1 1
MIRT043902 UBA52 ubiquitin A-52 residue ribosomal protein fusion product 1 1 1
MIRT043903 HIST1H2BD histone cluster 1, H2bd 1 1
MIRT043904 CYB5R3 cytochrome b5 reductase 3 1 1
MIRT043905 PCCB propionyl CoA carboxylase, beta polypeptide 1 1
MIRT043906 ACTB actin, beta 1 1
MIRT043907 KLF14 Kruppel-like factor 14 1 1
MIRT043908 TSEN2 tRNA splicing endonuclease 2 homolog (S. cerevisiae) 1 1
MIRT043909 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT043910 CPT2 carnitine palmitoyltransferase 2 1 1
MIRT043911 NLGN2 neuroligin 2 1 1
MIRT043912 MLX MAX-like protein X 1 1
MIRT043913 SOD1 superoxide dismutase 1, soluble 1 1
MIRT043914 PNISR splicing factor, arginine/serine-rich 18 1 1
MIRT043915 PHACTR2 phosphatase and actin regulator 2 1 1
MIRT043916 ASB16-AS1 chromosome 17 open reading frame 65 1 1
MIRT043917 SEC31A SEC31 homolog A (S. cerevisiae) 1 1
MIRT043918 TTC28 tetratricopeptide repeat domain 28 1 1
MIRT043919 PML promyelocytic leukemia 1 1
MIRT043920 CCND2 cyclin D2 1 1
MIRT043921 PTMA prothymosin, alpha 1 1
MIRT043922 ECH1 enoyl CoA hydratase 1, peroxisomal 1 1
MIRT043923 AGK acylglycerol kinase 1 1
MIRT043924 STARD7 StAR-related lipid transfer (START) domain containing 7 1 1
MIRT043925 ACSL4 acyl-CoA synthetase long-chain family member 4 1 1
MIRT043926 E2F5 E2F transcription factor 5, p130-binding 1 1
MIRT043927 DVL1 dishevelled, dsh homolog 1 (Drosophila) 1 1
MIRT043928 PSMA3 proteasome (prosome, macropain) subunit, alpha type, 3 1 1
MIRT043929 EIF4H eukaryotic translation initiation factor 4H 1 1
MIRT043930 ACAP2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 1 1
MIRT043931 OCRL oculocerebrorenal syndrome of Lowe 1 1
MIRT043932 MRPL37 mitochondrial ribosomal protein L37 1 1
MIRT043933 FOXC1 forkhead box C1 1 1
MIRT043934 TIGD1 tigger transposable element derived 1 1 1
MIRT043935 CSTF3 cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa 1 1
MIRT043936 FOXRED2 FAD-dependent oxidoreductase domain containing 2 1 1
MIRT043937 NME4 non-metastatic cells 4, protein expressed in 1 1
MIRT043938 PTBP1 polypyrimidine tract binding protein 1 1 1
MIRT043939 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT043940 SLC22A23 solute carrier family 22, member 23 1 1
MIRT043941 OXSR1 oxidative-stress responsive 1 1 1
MIRT043942 RTN3 reticulon 3 1 1
MIRT043943 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT043944 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT043945 BYSL bystin-like 1 1
MIRT043946 VPS13C vacuolar protein sorting 13 homolog C (S. cerevisiae) 1 1
MIRT043947 BLOC1S3 biogenesis of lysosomal organelles complex-1, subunit 3 1 1
MIRT043948 RPS7 ribosomal protein S7 1 1
MIRT043949 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT043950 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT043951 MLF1 myeloid leukemia factor 1 1 1
MIRT043952 STXBP1 syntaxin binding protein 1 1 1
MIRT043953 STXBP3 syntaxin binding protein 3 1 1
MIRT043954 WNK1 WNK lysine deficient protein kinase 1 1 1
MIRT043955 FLNA filamin A, alpha 1 1
MIRT043956 FAM118A family with sequence similarity 118, member A 1 1
MIRT043957 RABEP2 rabaptin, RAB GTPase binding effector protein 2 1 1
MIRT043958 RNPS1 RNA binding protein S1, serine-rich domain 1 1
MIRT043959 LDHA lactate dehydrogenase A 1 1
MIRT043960 CEP164 centrosomal protein 164kDa 1 1