Accession ID: MIRT044051 [miRNA, hsa-miR-362-5p :: EWSR1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-362LinkOut: [miRBase ]
Synonyms MIRN362, hsa-mir-362, MIR362
Description Homo sapiens miR-362 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-362-5p
Mature Sequence 5| AAUCCUUGGAACCUAGGUGUGAGU |28
Evidence Experimental
Experiments Array-cloned
Putative hsa-miR-362-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol EWSR1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms EWS, bK984G1.4
Description Ewing sarcoma breakpoint region 1
Transcript NM_0011632    LinkOut: [ RefSeq ]
Other Transcripts NM_0011632 , NM_0011632 , NM_0052 , NM_0139   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on EWSR1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of EWSR1
(miRNA target sites are highlighted)
>EWSR1|NM_0011632|3'UTR
   1 TAGATGCAGAGACCCCGCAGAGCTGCATTGACTACCAGATTTATTTTTTAAACCAGAAAATGTTTTAAATTTATAATTCC
  81 ATATTTATAATGTTGGCCACAACATTATGATTATTCCTTGTCTGTACTTTAGTATTTTTCACCATTTGTGAAGAAACATT
 161 AAAACAAGTTAAATGGTAGTGTGCGGAGTTTTTTTTTCTTCCTTCTTTTAAAAATGGTTGTTTAAGACTTTAACAATGGG
 241 AACCCCTTGTGAGCATGCTCAGTATCATTGTGGAGAACCAAGAGGGCCTCTTAACTGTAACAATGTTCATGGTTGTGATG
 321 TTTTTTTTTTTTTTTTAAATAAAATTCCAAATGTTTATAAAGAGTCAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-362-5p :: EWSR1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
3 hsa-miR-362-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT044050 TMF1 TATA element modulatory factor 1 1 1
MIRT044051 EWSR1 Ewing sarcoma breakpoint region 1 1 1
MIRT044052 NOMO3 NODAL modulator 3 1 1