Accession ID: MIRT044051 [miRNA, hsa-miR-362-5p :: EWSR1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-362LinkOut: [miRBase ]
Synonyms MIRN362, hsa-mir-362, MIR362
Description Homo sapiens miR-362 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-362-5p
Mature Sequence 5| AAUCCUUGGAACCUAGGUGUGAGU |28
Evidence Experimental
Experiments Array-cloned
Putative hsa-miR-362-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol EWSR1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms EWS, bK984G1.4
Description Ewing sarcoma breakpoint region 1
Transcript NM_001163285    LinkOut: [ RefSeq ]
Other Transcripts NM_001163286 , NM_005243 , NM_013986   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on EWSR1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of EWSR1
(miRNA target sites are highlighted)
>EWSR1|NM_001163285|3'UTR
   1 CCTGAAGGCTTCCTCCCGCCACCCTTTCCGCCCCCGGGTGGTGATCGTGGCAGAGGTGGCCCTGGTGGCATGCGGGGAGG
  81 AAGAGGTGGCCTCATGGATCGTGGTGGTCCCGGTGGAATGTTCAGAGGTGGCCGTGGTGGAGACAGAGGTGGCTTCCGTG
 161 GTGGCCGGGGCATGGACCGAGGTGGCTTTGGTGGAGGAAGACGAGGTGGCCCTGGGGGGCCCCCTGGACCTTTGATGGAA
 241 CAGATGGGAGGAAGAAGAGGAGGACGTGGAGGACCTGGAAAAATGGATAAAGGCGAGCACCGTCAGGAGCGCAGAGATCG
 321 GCCCTACTAGATGCAGAGACCCCGCAGAGCTGCATTGACTACCAGATTTATTTTTTAAACCAGAAAATGTTTTAAATTTA
 401 TAATTCCATATTTATAATGTTGGCCACAACATTATGATTATTCCTTGTCTGTACTTTAGTATTTTTCACCATTTGTGAAG
 481 AAACATTAAAACAAGTTAAATGGTAGTGTGCGGAGTTTTTTTTTCTTCCTTCTTTTAAAAATGGTTGTTTAAGACTTTAA
 561 CAATGGGAACCCCTTGTGAGCATGCTCAGTATCATTGTGGAGAACCAAGAGGGCCTCTTAACTGTAACAATGTTCATGGT
 641 TGTGATGTTTTTTTTTTTTTTTTAAATAAAATTCCAAATGTTTATAAAGAGTCA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugaguguggaUCCA---AGGUUCCUAa 5'
                    ||||    :|| |||| 
Target 5' ggggaggaagAGGTGGCCTCATGGATc 3'
74 - 100 114.00 -9.70
2
miRNA  3' ugagUGUGG-A-UCCAAG-GUUCCUAa 5'
              :|||| | |||  | ||: ||| 
Target 5' gcgaGCACCGTCAGGAGCGCAGAGATc 3'
293 - 319 108.00 -14.50
3
miRNA  3' ugagugUGGAUCCAAGGUUCCUaa 5'
                :|| :||   || |||  
Target 5' gtggtgGCCGGGG---CATGGAcc 3'
158 - 178 95.00 -10.27
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-362-5p :: EWSR1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' tgaGTGT-GGATCCAAG-------GTTCCTAa 5'
             :|:| || || | |       ||:|| | 
Target 5' accTATAGCCAAGCTGCAGCGCAGCAGGGCTa 3'
4 - 35
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
56 hsa-miR-362-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT044050 TMF1 TATA element modulatory factor 1 1 1
MIRT044051 EWSR1 Ewing sarcoma breakpoint region 1 1 1
MIRT044052 NOMO3 NODAL modulator 3 1 1
MIRT053602 CYLD cylindromatosis (turban tumor syndrome) 3 2
MIRT186882 CCNT1 cyclin T1 1 1
MIRT443324 SLC35G1 solute carrier family 35, member G1 1 1
MIRT445198 FAXC failed axon connections homolog (Drosophila) 1 1
MIRT466480 TECPR2 tectonin beta-propeller repeat containing 2 1 3
MIRT466995 SSRP1 structure specific recognition protein 1 1 1
MIRT468254 SFXN4 sideroflexin 4 1 1
MIRT472035 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT478447 DAZAP2 DAZ associated protein 2 1 1
MIRT479487 CDK2 cyclin-dependent kinase 2 1 1
MIRT481911 ANKRD40 ankyrin repeat domain 40 1 3
MIRT485457 IVNS1ABP influenza virus NS1A binding protein 1 1
MIRT494883 CERS4 ceramide synthase 4 1 1
MIRT497336 GCM2 glial cells missing homolog 2 (Drosophila) 1 1
MIRT501306 RPS6KB1 ribosomal protein S6 kinase, 70kDa, polypeptide 1 1 1
MIRT506046 PRDX3 peroxiredoxin 3 1 3
MIRT510226 PLEKHG3 pleckstrin homology domain containing, family G (with RhoGef domain) member 3 1 4
MIRT511422 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 3
MIRT512462 POLR3G polymerase (RNA) III (DNA directed) polypeptide G (32kD) 1 1
MIRT513057 LYPD6 LY6/PLAUR domain containing 6 1 3
MIRT528607 ZNF326 zinc finger protein 326 1 1
MIRT530251 LOH12CR1 loss of heterozygosity, 12, chromosomal region 1 1 1
MIRT537520 FAM104A family with sequence similarity 104, member A 1 1
MIRT538181 DCDC2 doublecortin domain containing 2 1 1
MIRT552647 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT575028 Tecpr2 tectonin beta-propeller repeat containing 2 1 1
MIRT619090 OMA1 OMA1 zinc metallopeptidase homolog (S. cerevisiae) 1 1
MIRT624364 CHD1 chromodomain helicase DNA binding protein 1 1 1
MIRT627832 PPIC peptidylprolyl isomerase C (cyclophilin C) 1 1
MIRT638267 SIX1 SIX homeobox 1 1 1
MIRT639824 GPRC5A G protein-coupled receptor, family C, group 5, member A 1 2
MIRT641073 HHIPL1 HHIP-like 1 1 1
MIRT641572 RAX retina and anterior neural fold homeobox 1 1
MIRT642053 KCNN3 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3 1 1
MIRT642478 C16orf58 chromosome 16 open reading frame 58 1 1
MIRT643789 DCLK3 doublecortin-like kinase 3 1 1
MIRT643827 SP140L SP140 nuclear body protein-like 1 1
MIRT645476 NTM neurotrimin 1 1
MIRT653103 SRSF7 serine/arginine-rich splicing factor 7 1 1
MIRT654263 RICTOR RPTOR independent companion of MTOR, complex 2 1 1
MIRT656696 LONRF2 LON peptidase N-terminal domain and ring finger 2 1 1
MIRT657023 KCNK5 potassium channel, subfamily K, member 5 1 1
MIRT657188 IKZF5 IKAROS family zinc finger 5 (Pegasus) 1 1
MIRT657900 GDF7 growth differentiation factor 7 1 1
MIRT658810 EFNA5 ephrin-A5 1 1
MIRT664884 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT668534 ERGIC2 ERGIC and golgi 2 1 1
MIRT697551 ZBTB44 zinc finger and BTB domain containing 44 1 1
MIRT708350 CT62 cancer/testis antigen 62 1 1
MIRT713095 QSER1 glutamine and serine rich 1 1 1
MIRT720631 ZNF585B zinc finger protein 585B 1 1
MIRT723352 SCRT1 scratch homolog 1, zinc finger protein (Drosophila) 1 1
MIRT724373 ASGR1 asialoglycoprotein receptor 1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*