Accession ID: MIRT044155 [miRNA, hsa-miR-30e-5p :: HSP90AA1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-30eLinkOut: [miRBase ]
Description Homo sapiens miR-30e stem-loop
Comment This sequence is the predicted human homologue of mouse miR-30e .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-30e-5p
Mature Sequence 17| UGUAAACAUCCUUGACUGGAAG |38
Evidence Experimental
Experiments Cloned
Expression Profile
Putative hsa-miR-30e-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol HSP90AA1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms HSP86, HSP89A, HSP90A, HSP90N, HSPC1, HSPCA, HSPCAL1, HSPCAL4, HSPN, Hsp89, Hsp90, LAP2
Description heat shock protein 90kDa alpha (cytosolic), class A member 1
Transcript NM_001017963    LinkOut: [ RefSeq ]
Other Transcripts NM_005348   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on HSP90AA1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of HSP90AA1
(miRNA target sites are highlighted)
>HSP90AA1|NM_001017963|3'UTR
   1 TCTCTGGCTGAGGGATGACTTACCTGTTCAGTACTCTACAATTCCTCTGATAATATATTTTCAAGGATGTTTTTCTTTAT
  81 TTTTGTTAATATTAAAAAGTCTGTATGGCATGACAACTACTTTAAGGGGAAGATAAGATTTCTGTCTACTAAGTGATGCT
 161 GTGATACCTTAGGCACTAAAGCAGAGCTAGTAATGCTTTTTGAGTTTCATGTTGGTTTATTTTCACAGATTGGGGTAACG
 241 TGCACTGTAAGACGTATGTAACATGATGTTAACTTTGTGGTCTAAAGTGTTTAGCTGTCAAGCCGGATGCCTAAGTAGAC
 321 CAAATCTTGTTATTGAAGTGTTCTGAGCTGTATCTTGATGTTTAGAAAAGTATTCGTTACATCTTGTAGGATCTACTTTT
 401 TGAACTTTTCATTCCCTGTAGTTGACAATTCTGCATGTACTAGTCCTCTAGAAATAGGTTAAACTGAAGCAACTTGATGG
 481 AAGGATCTCTCCACAGGGCTTGTTTTCCAAAGAAAAGTATTGTTTGGAGGAGCAAAGTTAAAAGCCTACCTAAGCATATC
 561 GTAAAGCTGTTCAAAAATAACTCAGACCCAGTCTTGTGGATGGAAATGTAGTGCTCGAGTCACATTCTGCTTAAAGTTGT
 641 AACAAATACAGATGAGTTAAAAGATATTGTGTGACAGTGTCTTATTTAGGGGGAAAGGGGAGTATCTGGATGACAGTTAG
 721 TGCCAAAATGTAAAACATGAGGCGCTAGCAGGAGATGGTTAAACACTAGCTGCTCCAAGGGTTGACATGGTCTTCCCAGC
 801 ATGTACTCAGCAGGTGTGGGGTGGAGCACACGTAGGCACAGAAAACAGGAATGCAGACAACATGCATCCCCTGCGTCCAT
 881 GAGTTACATGTGTTCTCTTAGTGTCCACGTTGTTTTGATGTTATTCATGGAATACCTTCTGTGTTAAATACAGTCACTTA
 961 ATTCCTTGGCCTTA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gaAGGUCAGUUCCUACAAAUgu 5'
            | ::||| |  :||||||  
Target 5' ttTGTGGTCTAAAGTGTTTAgc 3'
274 - 295 136.00 -7.50
2
miRNA  3' gaaggucAGUUCCUACAAAugu 5'
                 ||||||||||||   
Target 5' tatatttTCAAGGATGTTTttc 3'
54 - 75 135.00 -14.90
3
miRNA  3' gaaggucaguucCUACAAAUgu 5'
                      ||||||||  
Target 5' gagctgtatcttGATGTTTAga 3'
345 - 366 130.00 -7.80
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-30e-5p :: HSP90AA1    [ Functional MTI ]
Validation Method
Article - Hafner, M. Landthaler, M. Burger, L. et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-30e-5p :: HSP90AA1    [ Functional MTI ]
Validation Method
Article - Memczak, S. Jens, M. Elefsinioti, A. Torti, et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-30e-5p :: HSP90AA1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000216281.8 | 3UTR | ACUUACCUGUUCAGUACUCUACAAUUCCUCUGAUAAUAUAUUUUCAAGGAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000216281.8 | 3UTR | ACUUACCUGUUCAGUACUCUACAAUUCCUCUGAUAAUAUAUUUUCAAGGAUGUUUUUCUUUAUUUUUGUUAAUAUUAAAAAGUCUGUAUGGCAUGACAACUACUUUAAGGGGAAGAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000216281.8 | 3UTR | ACUUACCUGUUCAGUACUCUACAAUUCCUCUGAUAAUAUAUUUUCAAGGAUGUUUUUCUUUAUUUUUGUUAAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000216281.8 | 3UTR | UACUCUACAAUUCCUCUGAUAAUAUAUUUUCAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000216281.8 | 3UTR | ACUUACCUGUUCAGUACUCUACAAUUCCUCUGAUAAUAUAUUUUCAAGGAUGUUUUUCUUUAUUUUUGUUAAUAUUAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
329 hsa-miR-30e-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003339 UBE2I ubiquitin-conjugating enzyme E2I 4 2
MIRT004715 MUC17 mucin 17, cell surface associated 3 1
MIRT006045 MYBL2 v-myb myeloblastosis viral oncogene homolog (avian)-like 2 4 2
MIRT006609 Snai1 snail homolog 1 (Drosophila) 1 1
MIRT006764 SNAI1 snail homolog 1 (Drosophila) 3 1
MIRT044127 ZNF207 zinc finger protein 207 1 1
MIRT044128 MIER1 mesoderm induction early response 1 homolog (Xenopus laevis) 1 1
MIRT044129 GPBP1L1 GC-rich promoter binding protein 1-like 1 1 1
MIRT044130 PSMA6 proteasome (prosome, macropain) subunit, alpha type, 6 1 1
MIRT044131 TRAPPC9 trafficking protein particle complex 9 1 1
MIRT044132 LYRM7 LYR motif containing 7 1 1
MIRT044133 BTBD9 BTB (POZ) domain containing 9 1 1
MIRT044134 RPIA ribose 5-phosphate isomerase A 1 1
MIRT044135 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 1
MIRT044136 EHMT1 euchromatic histone-lysine N-methyltransferase 1 1 1
MIRT044137 ZBTB21 zinc finger protein 295 1 1
MIRT044138 MSANTD2 Myb/SANT-like DNA-binding domain containing 2 1 1
MIRT044139 TNKS2 tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2 1 1
MIRT044140 LIMCH1 LIM and calponin homology domains 1 1 1
MIRT044141 RPS8 ribosomal protein S8 1 1
MIRT044142 NOL12 nucleolar protein 12 1 1
MIRT044143 CANX calnexin 1 1
MIRT044144 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 1 2
MIRT044145 WDR26 WD repeat domain 26 1 1
MIRT044146 POLRMT polymerase (RNA) mitochondrial (DNA directed) 1 1
MIRT044147 TBC1D8B TBC1 domain family, member 8B (with GRAM domain) 1 1
MIRT044148 PCNT pericentrin 1 1
MIRT044149 PSMB5 proteasome (prosome, macropain) subunit, beta type, 5 1 1
MIRT044150 POLDIP3 polymerase (DNA-directed), delta interacting protein 3 1 1
MIRT044151 ATP5O ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit 1 1
MIRT044152 RPLP0 ribosomal protein, large, P0 1 1
MIRT044153 ZYG11A zyg-11 homolog A (C. elegans) 1 1
MIRT044154 RPS7 ribosomal protein S7 1 1
MIRT044155 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 4
MIRT044156 RELA v-rel reticuloendotheliosis viral oncogene homolog A (avian) 1 1
MIRT044157 STAU1 staufen, RNA binding protein, homolog 1 (Drosophila) 1 2
MIRT044158 CCT6A chaperonin containing TCP1, subunit 6A (zeta 1) 1 1
MIRT044159 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT044160 VPS13B vacuolar protein sorting 13 homolog B (yeast) 1 1
MIRT044161 EXO1 exonuclease 1 1 1
MIRT044162 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 1 1
MIRT044163 C1orf123 chromosome 1 open reading frame 123 1 1
MIRT053588 BMI1 BMI1 polycomb ring finger oncogene 4 1
MIRT054897 MTTP microsomal triglyceride transfer protein 1 1
MIRT057361 PCGF5 polycomb group ring finger 5 1 1
MIRT057486 KIF11 kinesin family member 11 1 2
MIRT057678 LCOR ligand dependent nuclear receptor corepressor 1 1
MIRT059178 SLC35C1 solute carrier family 35, member C1 1 1
MIRT067979 TFDP1 transcription factor Dp-1 1 3
MIRT068119 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT068389 S100PBP S100P binding protein 1 1
MIRT069738 FOXG1 forkhead box G1 1 2
MIRT074378 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT075442 PSMD7 proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 1 3
MIRT079948 RNF138 ring finger protein 138, E3 ubiquitin protein ligase 1 2
MIRT080961 LRRC8B leucine rich repeat containing 8 family, member B 1 1
MIRT081081 LDLR low density lipoprotein receptor 1 1
MIRT081716 ZNF507 zinc finger protein 507 1 2
MIRT082856 ZNF543 zinc finger protein 543 1 2
MIRT084236 PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 1 1
MIRT087148 HIC2 hypermethylated in cancer 2 1 4
MIRT088449 LCLAT1 lysocardiolipin acyltransferase 1 1 1
MIRT088682 EML4 echinoderm microtubule associated protein like 4 1 2
MIRT088938 ASB3 ankyrin repeat and SOCS box containing 3 1 1
MIRT090506 SLC35G2 solute carrier family 35, member G2 1 1
MIRT091580 FBXO45 F-box protein 45 1 1
MIRT095099 SEC24A SEC24 family, member A (S. cerevisiae) 1 1
MIRT096086 SFXN1 sideroflexin 1 1 1
MIRT098039 SOBP sine oculis binding protein homolog (Drosophila) 1 1
MIRT099798 SOX4 SRY (sex determining region Y)-box 4 1 2
MIRT100771 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) 1 2
MIRT100911 CD2AP CD2-associated protein 1 1
MIRT103200 SP4 Sp4 transcription factor 1 4
MIRT104523 PEG10 paternally expressed 10 1 1
MIRT105036 FAM91A1 family with sequence similarity 91, member A1 1 1
MIRT106747 RAD23B RAD23 homolog B (S. cerevisiae) 1 1
MIRT110578 KIF5B kinesin family member 5B 1 3
MIRT115925 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 1 1
MIRT118145 ZNF264 zinc finger protein 264 1 1
MIRT128248 STRIP1 striatin interacting protein 1 1 1
MIRT131798 CEP350 centrosomal protein 350kDa 1 1
MIRT131874 IER5 immediate early response 5 1 1
MIRT134335 MTR 5-methyltetrahydrofolate-homocysteine methyltransferase 1 1
MIRT135679 ZBTB39 zinc finger and BTB domain containing 39 1 1
MIRT136221 STX12 syntaxin 12 1 1
MIRT137020 WDFY2 WD repeat and FYVE domain containing 2 1 1
MIRT137127 TPRG1L tumor protein p63 regulated 1-like 1 1
MIRT138286 RNF220 ring finger protein 220 1 1
MIRT139251 JDP2 Jun dimerization protein 2 1 1
MIRT140644 PLEKHO2 pleckstrin homology domain containing, family O member 2 1 1
MIRT140883 GLCE glucuronic acid epimerase 1 1
MIRT142594 IL21R interleukin 21 receptor 1 2
MIRT143353 PAPD5 PAP associated domain containing 5 1 1
MIRT144541 ZNRF1 zinc and ring finger 1, E3 ubiquitin protein ligase 1 1
MIRT145451 RNF135 ring finger protein 135 1 1
MIRT148355 GALNT1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) 1 1
MIRT149122 LRRC8D leucine rich repeat containing 8 family, member D 1 1
MIRT150765 MAST3 microtubule associated serine/threonine kinase 3 1 1
MIRT152419 ARID3A AT rich interactive domain 3A (BRIGHT-like) 1 2
MIRT154956 RRM2 ribonucleotide reductase M2 1 2
MIRT155251 IFNAR2 interferon (alpha, beta and omega) receptor 2 1 1
MIRT159122 NRBP1 nuclear receptor binding protein 1 1 1
MIRT159250 RASGRP3 RAS guanyl releasing protein 3 (calcium and DAG-regulated) 1 1
MIRT160856 PLXNA1 plexin A1 1 1
MIRT164237 GAB1 GRB2-associated binding protein 1 1 1
MIRT165600 PPARGC1B peroxisome proliferator-activated receptor gamma, coactivator 1 beta 1 1
MIRT167511 PRDM1 PR domain containing 1, with ZNF domain 1 1
MIRT170159 KLHDC10 kelch domain containing 10 1 1
MIRT171358 PHTF2 putative homeodomain transcription factor 2 1 2
MIRT171556 DBF4 DBF4 homolog (S. cerevisiae) 1 1
MIRT173419 MTDH metadherin 1 1
MIRT176038 JADE3 PHD finger protein 16 1 1
MIRT177713 ADO 2-aminoethanethiol (cysteamine) dioxygenase 1 1
MIRT185105 LYPLAL1 lysophospholipase-like 1 1 1
MIRT188275 RAP1B RAP1B, member of RAS oncogene family 1 1
MIRT192229 MKRN3 makorin ring finger protein 3 1 1
MIRT194173 IREB2 iron-responsive element binding protein 2 1 1
MIRT197650 DHX40 DEAH (Asp-Glu-Ala-His) box polypeptide 40 1 1
MIRT206183 RAB10 RAB10, member RAS oncogene family 1 1
MIRT206890 XPO1 exportin 1 (CRM1 homolog, yeast) 1 1
MIRT210819 SETD5 SET domain containing 5 1 1
MIRT212864 N4BP2 NEDD4 binding protein 2 1 1
MIRT215133 MFAP3 microfibrillar-associated protein 3 1 1
MIRT218373 FAM8A1 family with sequence similarity 8, member A1 1 1
MIRT244295 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 1 1
MIRT252102 NAPG N-ethylmaleimide-sensitive factor attachment protein, gamma 1 1
MIRT257172 TBPL1 TBP-like 1 1 1
MIRT258127 UBE3C ubiquitin protein ligase E3C 1 1
MIRT258179 CBX3 chromobox homolog 3 1 1
MIRT270742 TMED2 transmembrane emp24 domain trafficking protein 2 1 1
MIRT283404 CCNF cyclin F 1 1
MIRT289634 CBX2 chromobox homolog 2 1 1
MIRT292170 CDC7 cell division cycle 7 homolog (S. cerevisiae) 1 1
MIRT292817 MTF2 metal response element binding transcription factor 2 1 1
MIRT293788 SAE1 SUMO1 activating enzyme subunit 1 1 1
MIRT294578 ZNF460 zinc finger protein 460 1 2
MIRT302904 FOXN2 forkhead box N2 1 1
MIRT306845 FYTTD1 forty-two-three domain containing 1 1 1
MIRT313777 MIER3 mesoderm induction early response 1, family member 3 1 2
MIRT322690 BAG4 BCL2-associated athanogene 4 1 1
MIRT368810 MZT1 mitotic spindle organizing protein 1 1 1
MIRT379730 ZXDB zinc finger, X-linked, duplicated B 1 1
MIRT387958 H6PD hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) 1 1
MIRT437491 NOTCH1 notch 1 3 1
MIRT437495 TP53 tumor protein p53 3 1
MIRT439095 ZEB2 zinc finger E-box binding homeobox 2 0 1
MIRT444596 TGFA transforming growth factor, alpha 1 1
MIRT446447 CHST15 carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15 1 1
MIRT448491 SEC61A2 Sec61 alpha 2 subunit (S. cerevisiae) 1 1
MIRT448512 ROCK2 Rho-associated, coiled-coil containing protein kinase 2 1 1
MIRT448651 NCOA3 nuclear receptor coactivator 3 1 1
MIRT448784 GNA13 guanine nucleotide binding protein (G protein), alpha 13 1 2
MIRT449707 TSPYL1 TSPY-like 1 1 1
MIRT450761 PGGT1B protein geranylgeranyltransferase type I, beta subunit 1 1
MIRT452139 PPP2R1B protein phosphatase 2, regulatory subunit A, beta 1 1
MIRT463404 ZDHHC20 zinc finger, DHHC-type containing 20 1 1
MIRT464288 VASH1 vasohibin 1 1 1
MIRT467408 SOCS3 suppressor of cytokine signaling 3 1 1
MIRT467624 SLC7A5 solute carrier family 7 (amino acid transporter light chain, L system), member 5 1 1
MIRT470403 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT471077 PIK3C2B phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta 1 2
MIRT471152 PHF13 PHD finger protein 13 1 3
MIRT472474 NAP1L1 nucleosome assembly protein 1-like 1 1 4
MIRT472491 NACC2 NACC family member 2, BEN and BTB (POZ) domain containing 1 1
MIRT473653 MARCKSL1 MARCKS-like 1 1 1
MIRT473696 MAPK8 mitogen-activated protein kinase 8 1 2
MIRT474082 LMBR1L limb region 1 homolog (mouse)-like 1 2
MIRT474282 LARP1 La ribonucleoprotein domain family, member 1 1 3
MIRT474326 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT475699 HHIPL1 HHIP-like 1 1 1
MIRT476171 GOLGA8B golgin A8 family, member B 1 2
MIRT481135 AZIN1 antizyme inhibitor 1 1 3
MIRT481463 ARPP19 cAMP-regulated phosphoprotein, 19kDa 1 2
MIRT482064 ALG9 asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT482129 AKIRIN1 akirin 1 1 2
MIRT485203 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 3
MIRT488722 ADPRHL1 ADP-ribosylhydrolase like 1 1 1
MIRT492210 SOCS1 suppressor of cytokine signaling 1 1 3
MIRT492612 POLR3E polymerase (RNA) III (DNA directed) polypeptide E (80kD) 1 1
MIRT497124 IFNE interferon, epsilon 1 1
MIRT498609 MTRNR2L10 MT-RNR2-like 10 1 3
MIRT502702 CSNK1G1 casein kinase 1, gamma 1 1 3
MIRT503027 CAND1 cullin-associated and neddylation-dissociated 1 1 1
MIRT504037 TOMM5 translocase of outer mitochondrial membrane 5 homolog (yeast) 1 1
MIRT507127 GIGYF1 GRB10 interacting GYF protein 1 1 3
MIRT514177 PGPEP1 pyroglutamyl-peptidase I 1 2
MIRT530618 CXCL11 chemokine (C-X-C motif) ligand 11 1 1
MIRT531354 FAM81B family with sequence similarity 81, member B 1 1
MIRT534304 SKIDA1 SKI/DACH domain containing 1 1 1
MIRT536976 HABP4 hyaluronan binding protein 4 1 2
MIRT538153 DDAH1 dimethylarginine dimethylaminohydrolase 1 1 2
MIRT544264 SIKE1 suppressor of IKBKE 1 1 1
MIRT544511 GTF2E2 general transcription factor IIE, polypeptide 2, beta 34kDa 1 1
MIRT547151 PGM3 phosphoglucomutase 3 1 1
MIRT547190 PBRM1 polybromo 1 1 1
MIRT547747 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 2
MIRT548195 FOXA1 forkhead box A1 1 1
MIRT548433 ELOVL5 ELOVL fatty acid elongase 5 1 1
MIRT552930 VPS33A vacuolar protein sorting 33 homolog A (S. cerevisiae) 1 1
MIRT553988 SRPR signal recognition particle receptor (docking protein) 1 1
MIRT554284 SIX4 SIX homeobox 4 1 1
MIRT555304 PPP3CB protein phosphatase 3, catalytic subunit, beta isozyme 1 1
MIRT555614 PICALM phosphatidylinositol binding clathrin assembly protein 1 2
MIRT555756 PDCD10 programmed cell death 10 1 1
MIRT556576 LIFR leukemia inhibitory factor receptor alpha 1 1
MIRT557729 FYCO1 FYVE and coiled-coil domain containing 1 1 1
MIRT557781 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT558467 DCUN1D1 DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) 1 1
MIRT562488 CELSR3 cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) 1 1
MIRT562793 NDUFA12 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 1 1
MIRT563231 QRFPR pyroglutamylated RFamide peptide receptor 1 1
MIRT563265 ST3GAL5 ST3 beta-galactoside alpha-2,3-sialyltransferase 5 1 1
MIRT565075 UHRF1BP1 UHRF1 binding protein 1 1 2
MIRT565828 SCML2 sex comb on midleg-like 2 (Drosophila) 1 1
MIRT566678 MYLIP myosin regulatory light chain interacting protein 1 1
MIRT566743 MSANTD4 Myb/SANT-like DNA-binding domain containing 4 with coiled-coils 1 2
MIRT567611 FANCF Fanconi anemia, complementation group F 1 1
MIRT568348 B4GALT5 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 1 2
MIRT572867 OPHN1 oligophrenin 1 1 1
MIRT612399 STRN striatin, calmodulin binding protein 1 1
MIRT623311 MARCH4 membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase 1 1
MIRT626123 PLSCR1 phospholipid scramblase 1 1 2
MIRT653915 SERPINC1 serpin peptidase inhibitor, clade C (antithrombin), member 1 1 1
MIRT653986 SEMA6A sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A 1 1
MIRT656331 MED29 mediator complex subunit 29 1 1
MIRT669390 BAHD1 bromo adjacent homology domain containing 1 1 1
MIRT686766 STX16 syntaxin 16 1 1
MIRT687192 PRKAR1A protein kinase, cAMP-dependent, regulatory, type I, alpha 1 1
MIRT688635 CREM cAMP responsive element modulator 1 1
MIRT704911 CCDC71L coiled-coil domain containing 71-like 1 1
MIRT705333 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT705589 APLP2 amyloid beta (A4) precursor-like protein 2 1 1
MIRT705910 ADAM9 ADAM metallopeptidase domain 9 1 1
MIRT716456 MRO maestro 1 1
MIRT718293 MOGAT1 monoacylglycerol O-acyltransferase 1 1 1
MIRT718884 SLFN5 schlafen family member 5 1 1
MIRT719016 SHROOM3 shroom family member 3 1 1
MIRT725996 ZSCAN29 zinc finger and SCAN domain containing 29 1 1
MIRT726046 ZNF200 zinc finger protein 200 1 1
MIRT726058 ZMYND8 zinc finger, MYND-type containing 8 1 1
MIRT726068 ZFAND5 zinc finger, AN1-type domain 5 1 1
MIRT726074 ZCRB1 zinc finger CCHC-type and RNA binding motif 1 1 1
MIRT726120 VPS41 vacuolar protein sorting 41 homolog (S. cerevisiae) 1 1
MIRT726144 VAPA VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa 1 1
MIRT726159 USP37 ubiquitin specific peptidase 37 1 1
MIRT726180 UBXN4 UBX domain protein 4 1 1
MIRT726191 UBN1 ubinuclein 1 1 1
MIRT726203 TXNDC5 thioredoxin domain containing 5 (endoplasmic reticulum) 1 1
MIRT726208 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 1 1
MIRT726228 TRIM23 tripartite motif containing 23 1 1
MIRT726261 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 1 1
MIRT726377 TBC1D10B TBC1 domain family, member 10B 1 1
MIRT726386 TAOK1 TAO kinase 1 1 1
MIRT726390 TANK TRAF family member-associated NFKB activator 1 1
MIRT726396 TAF4B TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa 1 1
MIRT726466 SOX12 SRY (sex determining region Y)-box 12 1 1
MIRT726519 SLC4A7 solute carrier family 4, sodium bicarbonate cotransporter, member 7 1 1
MIRT726529 SLC38A7 solute carrier family 38, member 7 1 1
MIRT726586 SH3PXD2A SH3 and PX domains 2A 1 1
MIRT726593 SH3GL1 SH3-domain GRB2-like 1 1 1
MIRT726609 SRSF7 serine/arginine-rich splicing factor 7 1 1
MIRT726617 SETD3 SET domain containing 3 1 1
MIRT726652 SBF1 SET binding factor 1 1 1
MIRT726662 SACS spastic ataxia of Charlevoix-Saguenay (sacsin) 1 1
MIRT726691 RPA2 replication protein A2, 32kDa 1 1
MIRT726731 RNF122 ring finger protein 122 1 1
MIRT726765 REV3L REV3-like, polymerase (DNA directed), zeta, catalytic subunit 1 1
MIRT726841 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT726857 PREPL prolyl endopeptidase-like 1 1
MIRT726863 PPTC7 PTC7 protein phosphatase homolog (S. cerevisiae) 1 1
MIRT726885 PPP1R2 protein phosphatase 1, regulatory (inhibitor) subunit 2 1 1
MIRT726892 PPP1R12A protein phosphatase 1, regulatory subunit 12A 1 1
MIRT726915 PNMA1 paraneoplastic Ma antigen 1 1 1
MIRT726976 PER2 period homolog 2 (Drosophila) 1 1
MIRT726994 PCDH10 protocadherin 10 1 1
MIRT727008 PAWR PRKC, apoptosis, WT1, regulator 1 1
MIRT727031 OTUD4 OTU domain containing 4 1 1
MIRT727090 NDEL1 nudE nuclear distribution E homolog (A. nidulans)-like 1 1 1
MIRT727165 MLXIP MLX interacting protein 1 1
MIRT727192 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727202 MIA3 melanoma inhibitory activity family, member 3 1 1
MIRT727245 MARCH6 membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase 1 1
MIRT727276 LPCAT1 lysophosphatidylcholine acyltransferase 1 1 1
MIRT727302 LIN7C lin-7 homolog C (C. elegans) 1 1
MIRT727306 LIN28B lin-28 homolog B (C. elegans) 1 1
MIRT727312 LHFPL2 lipoma HMGIC fusion partner-like 2 1 1
MIRT727316 LCP1 lymphocyte cytosolic protein 1 (L-plastin) 1 1
MIRT727342 KLF10 Kruppel-like factor 10 1 1
MIRT727352 EPG5 ectopic P-granules autophagy protein 5 homolog (C. elegans) 1 1
MIRT727390 JOSD1 Josephin domain containing 1 1 1
MIRT727395 KDM3A lysine (K)-specific demethylase 3A 1 1
MIRT727405 JAK1 Janus kinase 1 1 1
MIRT727431 IQCB1 IQ motif containing B1 1 1
MIRT727437 IP6K3 inositol hexakisphosphate kinase 3 1 1
MIRT727452 IL1A interleukin 1, alpha 1 1
MIRT727463 IKZF2 IKAROS family zinc finger 2 (Helios) 1 1
MIRT727544 GOLGA1 golgin A1 1 1
MIRT727566 GXYLT1 glucoside xylosyltransferase 1 1 1
MIRT727587 GCLC glutamate-cysteine ligase, catalytic subunit 1 1
MIRT727591 GCSAM germinal center-associated, signaling and motility 1 1
MIRT727633 FUCA1 fucosidase, alpha-L- 1, tissue 1 1
MIRT727687 FANCL Fanconi anemia, complementation group L 1 1
MIRT727722 FAM104A family with sequence similarity 104, member A 1 1
MIRT727745 ERLIN1 ER lipid raft associated 1 1 1
MIRT727764 EPB41 erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) 1 1
MIRT727772 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT727795 EED embryonic ectoderm development 1 1
MIRT727807 EDC3 enhancer of mRNA decapping 3 homolog (S. cerevisiae) 1 1
MIRT727829 DYNLT3 dynein, light chain, Tctex-type 3 1 1
MIRT727897 DCTN4 dynactin 4 (p62) 1 1
MIRT727929 CREG1 cellular repressor of E1A-stimulated genes 1 1 1
MIRT727954 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT727976 CLCC1 chloride channel CLIC-like 1 1 1
MIRT728001 CHD1 chromodomain helicase DNA binding protein 1 1 1
MIRT728011 CDC37L1 cell division cycle 37 homolog (S. cerevisiae)-like 1 1 1
MIRT728048 CASP3 caspase 3, apoptosis-related cysteine peptidase 1 1
MIRT728060 C8orf76 chromosome 8 open reading frame 76 1 1
MIRT728065 C7orf60 chromosome 7 open reading frame 60 1 1
MIRT728076 C7orf43 chromosome 7 open reading frame 43 1 1
MIRT728159 KIAA0226L KIAA0226-like 1 1
MIRT728177 BTBD7 BTB (POZ) domain containing 7 1 1
MIRT728187 BTBD1 BTB (POZ) domain containing 1 1 1
MIRT728206 BECN1 beclin 1, autophagy related 1 1
MIRT728209 CFDP1 craniofacial development protein 1 1 1
MIRT728230 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 1 1
MIRT728240 AVL9 AVL9 homolog (S. cerevisiase) 1 1
MIRT728266 ATM ataxia telangiectasia mutated 1 1
MIRT728343 ANKRA2 ankyrin repeat, family A (RFXANK-like), 2 1 1
MIRT728371 AFF4 AF4/FMR2 family, member 4 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*