Accession ID: MIRT044155 [miRNA, hsa-miR-30e-5p :: HSP90AA1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-30eLinkOut: [miRBase ]
Description Homo sapiens miR-30e stem-loop
Comment This sequence is the predicted human homologue of mouse miR-30e .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-30e-5p
Mature Sequence 17| UGUAAACAUCCUUGACUGGAAG |38
Evidence Experimental
Experiments Cloned
Expression Profile
Putative hsa-miR-30e-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol HSP90AA1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms FLJ31884, HSP86, HSP89A, HSP90A, HSP90N, HSPC1, HSPCA, HSPCAL1, HSPCAL4, HSPN, Hsp89, Hsp90, LAP2
Description heat shock protein 90kDa alpha (cytosolic), class A member 1
Transcript NM_0010179    LinkOut: [ RefSeq ]
Other Transcripts NM_0053   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on HSP90AA1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of HSP90AA1
(miRNA target sites are highlighted)
>HSP90AA1|NM_0010179|3'UTR
   1 TAATCTCTGGCTGAGGGATGACTTACCTGTTCAGTACTCTACAATTCCTCTGATAATATATTTTCAAGGATGTTTTTCTT
  81 TATTTTTGTTAATATTAAAAAGTCTGTATGGCATGACAACTACTTTAAGGGGAAGATAAGATTTCTGTCTACTAAGTGAT
 161 GCTGTGATACCTTAGGCACTAAAGCAGAGCTAGTAATGCTTTTTGAGTTTCATGTTGGTTTATTTTCACAGATTGGGGTA
 241 ACGTGCACTGTAAGACGTATGTAACATGATGTTAACTTTGTGGTCTAAAGTGTTTAGCTGTCAAGCCGGATGCCTAAGTA
 321 GACCAAATCTTGTTATTGAAGTGTTCTGAGCTGTATCTTGATGTTTAGAAAAGTATTCGTTACATCTTGTAGGATCTACT
 401 TTTTGAACTTTTCATTCCCTGTAGTTGACAATTCTGCATGTACTAGTCCTCTAGAAATAGGTTAAACTGAAGCAACTTGA
 481 TGGAAGGATCTCTCCACAGGGCTTGTTTTCCAAAGAAAAGTATTGTTTGGAGGAGCAAAGTTAAAAGCCTACCTAAGCAT
 561 ATCGTAAAGCTGTTCAAAAATAACTCAGACCCAGTCTTGTGGATGGAAATGTAGTGCTCGAGTCACATTCTGCTTAAAGT
 641 TGTAACAAATACAGATGAGTTAAAAGATATTGTGTGACAGTGTCTTATTTAGGGGGAAAGGGGAGTATCTGGATGACAGT
 721 TAGTGCCAAAATGTAAAACATGAGGCGCTAGCAGGAGATGGTTAAACACTAGCTGCTCCAAGGGTTGACATGGTCTTCCC
 801 AGCATGTACTCAGCAGGTGTGGGGTGGAGCACACGTAGGCACAGAAAACAGGAATGCAGACAACATGCATCCCCTGCGTC
 881 CATGAGTTACATGTGTTCTCTTAGTGTCCACGTTGTTTTGATGTTATTCATGGAATACCTTCTGTGTTAAATACAGTCAC
 961 TTAATTCCTTGGCCTTAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gaAGGUCAGUUCCUACAAAUgu 5'
            | ::||| |  :||||||  
Target 5' ttTGTGGTCTAAAGTGTTTAgc 3'
277 - 298 136.00 -7.50
2
miRNA  3' gaaggucAGUUCCUACAAAugu 5'
                 ||||||||||||   
Target 5' tatatttTCAAGGATGTTTttc 3'
57 - 78 135.00 -14.90
3
miRNA  3' gaaggucaguucCUACAAAUgu 5'
                      ||||||||  
Target 5' gagctgtatcttGATGTTTAga 3'
348 - 369 130.00 -7.80
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-30e-5p :: HSP90AA1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
42 hsa-miR-30e-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003339 UBE2I ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) 4 2
MIRT004715 MUC17 mucin 17, cell surface associated 3 1
MIRT006045 MYBL2 v-myb myeloblastosis viral oncogene homolog (avian)-like 2 3 1
MIRT006609 Snai1 snail homolog 1 (Drosophila) 1 1
MIRT006764 SNAI1 snail homolog 1 (Drosophila) 3 1
MIRT044127 ZNF207 zinc finger protein 207 1 1
MIRT044128 MIER1 mesoderm induction early response 1 homolog (Xenopus laevis) 1 1
MIRT044129 GPBP1L1 GC-rich promoter binding protein 1-like 1 1 1
MIRT044130 PSMA6 proteasome (prosome, macropain) subunit, alpha type, 6 1 1
MIRT044131 TRAPPC9 trafficking protein particle complex 9 1 1
MIRT044132 LYRM7 Lyrm7 homolog (mouse) 1 1
MIRT044133 BTBD9 BTB (POZ) domain containing 9 1 1
MIRT044134 RPIA ribose 5-phosphate isomerase A 1 1
MIRT044135 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 1
MIRT044136 EHMT1 euchromatic histone-lysine N-methyltransferase 1 1 1
MIRT044137 ZBTB21 zinc finger protein 295 1 1
MIRT044138 MSANTD2 chromosome 11 open reading frame 61 1 1
MIRT044139 TNKS2 tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2 1 1
MIRT044140 LIMCH1 LIM and calponin homology domains 1 1 1
MIRT044141 RPS8 ribosomal protein S8 1 1
MIRT044142 NOL12 nucleolar protein 12 1 1
MIRT044143 CANX calnexin 1 1
MIRT044144 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 1 1
MIRT044145 WDR26 WD repeat domain 26 1 1
MIRT044146 POLRMT polymerase (RNA) mitochondrial (DNA directed) 1 1
MIRT044147 TBC1D8B TBC1 domain family, member 8B (with GRAM domain) 1 1
MIRT044148 PCNT pericentrin 1 1
MIRT044149 PSMB5 proteasome (prosome, macropain) subunit, beta type, 5 1 1
MIRT044150 POLDIP3 polymerase (DNA-directed), delta interacting protein 3 1 1
MIRT044151 ATP5O ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit 1 1
MIRT044152 RPLP0 ribosomal protein, large, P0 1 1
MIRT044153 ZYG11A zyg-11 homolog A (C. elegans) 1 1
MIRT044154 RPS7 ribosomal protein S7 1 1
MIRT044155 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT044156 RELA v-rel reticuloendotheliosis viral oncogene homolog A (avian) 1 1
MIRT044157 STAU1 staufen, RNA binding protein, homolog 1 (Drosophila) 1 1
MIRT044158 CCT6A chaperonin containing TCP1, subunit 6A (zeta 1) 1 1
MIRT044159 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT044160 VPS13B vacuolar protein sorting 13 homolog B (yeast) 1 1
MIRT044161 EXO1 exonuclease 1 1 1
MIRT044162 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 1 1
MIRT044163 C1orf123 chromosome 1 open reading frame 123 1 1