Accession ID: MIRT044214 [miRNA, hsa-miR-301a-3p :: GAK, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-301aLinkOut: [miRBase ]
Description Homo sapiens miR-301a stem-loop
Comment This sequence is the predicted human homologue of mouse miR-301, cloned from mouse embryonic stem cells .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-301a-3p
Mature Sequence 51| CAGUGCAAUAGUAUUGUCAAAGC |73
Evidence Experimental
Experiments Cloned
Putative hsa-miR-301a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol GAK LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms FLJ16629, FLJ40395, MGC99654
Description cyclin G associated kinase
Transcript NM_0052    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on GAK LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of GAK
(miRNA target sites are highlighted)
>GAK|NM_0052|3'UTR
   1 TGAGGCCGCAGTGGTGGTGGCTGCGCACACAGCTCCACAGGTTGGGAGCCGTCGTGGGACCTGGGTCCCCACCGTGAGGA
  81 CCCCGTGGGCGACAGCAGGTGTGGCCAGGGTGGGGCTCCGAGCCCCGGGTCACCGCCCGCCCAGCGTTCCAGGCACATGA
 161 AGAGAAAGCATTCCAAAGCCTCTGATTGTTGTTTCCTTTTTCTCCTCCCGAAGGAACAGCTGATTCATGCTCCTCCCGCA
 241 ATTGTCACGTCTGTGATTTATTTGGTGTTTCGGGCGTGGCCTCTGGAGCCCCGGCACGTGGTGGGCCACGCTGCTGGCGC
 321 TCATGGGCCCTGGTGTTTGCACCGCACTTTGTAATCAGTCCCGTGGTTGTCTGTACAGAATTAAACTATTTTCCGATGAA
 401 AAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cgaAACUGUUAUGAU-AACGUGac 5'
             | |:|  |: |: ||||||  
Target 5' tcaTGGGCCCTGGTGTTTGCACcg 3'
321 - 344 128.00 -10.60
2
miRNA  3' cgaAACUGUUAUGA------UAAC-GUGac 5'
             || |:: | ||      |||| |||  
Target 5' tgaTTCATGCTCCTCCCGCAATTGTCACgt 3'
221 - 250 98.00 -6.10
3
miRNA  3' cgaAACUGUUAUG--AUAACGUGAc 5'
             ||| | :|||   |||  ||| 
Target 5' tggTTGTCTGTACAGAATTAAACTa 3'
364 - 388 98.00 -8.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-301a-3p :: GAK    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
26 hsa-miR-301a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003611 MEOX2 mesenchyme homeobox 2 4 2
MIRT004113 NKRF NFKB repressing factor 5 1
MIRT005972 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 1 1
MIRT007250 SMAD4 SMAD family member 4 1 1
MIRT007295 RUNX3 runt-related transcription factor 3 3 1
MIRT044211 CEP192 centrosomal protein 192kDa 1 1
MIRT044212 CCT8 chaperonin containing TCP1, subunit 8 (theta) 1 1
MIRT044213 YTHDF1 YTH domain family, member 1 1 1
MIRT044214 GAK cyclin G associated kinase 1 1
MIRT044215 PPIB peptidylprolyl isomerase B (cyclophilin B) 1 1
MIRT044216 C1QBP complement component 1, q subcomponent binding protein 1 1
MIRT044217 RERE arginine-glutamic acid dipeptide (RE) repeats 1 1
MIRT044218 CAD carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase 1 1
MIRT044219 RPL18A ribosomal protein L18a 1 1
MIRT044220 FAM126A family with sequence similarity 126, member A 1 1
MIRT044221 KIAA1279 KIAA1279 1 1
MIRT044222 CCND2 cyclin D2 1 1
MIRT044223 WHSC1L1 Wolf-Hirschhorn syndrome candidate 1-like 1 1 1
MIRT044224 KDELR2 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 1 1
MIRT044225 TUBB4B tubulin, beta 2C 1 1
MIRT044226 PHAX phosphorylated adaptor for RNA export 1 1
MIRT044227 POMP proteasome maturation protein 1 1
MIRT044228 LONRF1 LON peptidase N-terminal domain and ring finger 1 1 1
MIRT044229 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT044230 CYBRD1 cytochrome b reductase 1 1 1
MIRT044231 TMED5 transmembrane emp24 protein transport domain containing 5 1 1