Accession ID: MIRT044214 [miRNA, hsa-miR-301a-3p :: GAK, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-301aLinkOut: [miRBase ]
Description Homo sapiens miR-301a stem-loop
Comment This sequence is the predicted human homologue of mouse miR-301, cloned from mouse embryonic stem cells .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-301a-3p
Mature Sequence 51| CAGUGCAAUAGUAUUGUCAAAGC |73
Evidence Experimental
Experiments Cloned
Putative hsa-miR-301a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-301a-3p :: GAK    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
364 hsa-miR-301a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003611 MEOX2 mesenchyme homeobox 2 4 2
MIRT004113 NKRF NFKB repressing factor 5 1
MIRT005972 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 1 1
MIRT007250 SMAD4 SMAD family member 4 2 4
MIRT007295 RUNX3 runt-related transcription factor 3 3 1
MIRT044211 CEP192 centrosomal protein 192kDa 1 1
MIRT044212 CCT8 chaperonin containing TCP1, subunit 8 (theta) 1 1
MIRT044213 YTHDF1 YTH domain family, member 1 1 1
MIRT044214 GAK cyclin G associated kinase 1 1
MIRT044215 PPIB peptidylprolyl isomerase B (cyclophilin B) 1 1
MIRT044216 C1QBP complement component 1, q subcomponent binding protein 1 1
MIRT044217 RERE arginine-glutamic acid dipeptide (RE) repeats 1 1
MIRT044218 CAD carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase 1 1
MIRT044219 RPL18A ribosomal protein L18a 1 1
MIRT044220 FAM126A family with sequence similarity 126, member A 1 1
MIRT044221 KIAA1279 KIAA1279 1 1
MIRT044222 CCND2 cyclin D2 1 2
MIRT044223 WHSC1L1 Wolf-Hirschhorn syndrome candidate 1-like 1 1 1
MIRT044224 KDELR2 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 1 1
MIRT044225 TUBB4B tubulin, beta 4B class IVb 1 1
MIRT044226 PHAX phosphorylated adaptor for RNA export 1 1
MIRT044227 POMP proteasome maturation protein 1 1
MIRT044228 LONRF1 LON peptidase N-terminal domain and ring finger 1 1 1
MIRT044229 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT044230 CYBRD1 cytochrome b reductase 1 1 1
MIRT044231 TMED5 transmembrane emp24 protein transport domain containing 5 1 1
MIRT054105 BCL2L11 BCL2-like 11 (apoptosis facilitator) 2 1
MIRT054711 PTEN phosphatase and tensin homolog 3 1
MIRT057496 CEP55 centrosomal protein 55kDa 1 2
MIRT060502 PPP6R3 protein phosphatase 6, regulatory subunit 3 1 1
MIRT061517 OTUD3 OTU domain containing 3 1 1
MIRT061794 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 5
MIRT062711 MLEC malectin 1 2
MIRT063598 FBXO28 F-box protein 28 1 1
MIRT064802 ZBTB18 zinc finger protein 238 1 1
MIRT065621 CLIC4 chloride intracellular channel 4 1 2
MIRT065890 RAB5B RAB5B, member RAS oncogene family 1 4
MIRT071001 SMOC1 SPARC related modular calcium binding 1 1 1
MIRT071909 ZFYVE9 zinc finger, FYVE domain containing 9 1 1
MIRT075115 C16ORF70 chromosome 16 open reading frame 70 1 2
MIRT076026 COX10 cytochrome c oxidase assembly homolog 10 (yeast) 1 3
MIRT079265 NPTX1 neuronal pentraxin I 1 1
MIRT079349 CCDC137 coiled-coil domain containing 137 1 1
MIRT081120 LDLR low density lipoprotein receptor 1 3
MIRT083129 BTBD3 BTB (POZ) domain containing 3 1 6
MIRT083153 SEC23B Sec23 homolog B (S. cerevisiae) 1 2
MIRT086432 NABP1 nucleic acid binding protein 1 1 3
MIRT087865 CBY1 chibby homolog 1 (Drosophila) 1 2
MIRT088341 MAPRE3 microtubule-associated protein, RP/EB family, member 3 1 4
MIRT090803 MBNL1 muscleblind-like splicing regulator 1 1 2
MIRT090900 ARHGEF26 Rho guanine nucleotide exchange factor (GEF) 26 1 1
MIRT091214 USP13 ubiquitin specific peptidase 13 (isopeptidase T-3) 1 1
MIRT091690 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 1 3
MIRT092492 PTPRG protein tyrosine phosphatase, receptor type, G 1 1
MIRT095379 UBE2D2 ubiquitin-conjugating enzyme E2D 2 1 1
MIRT096896 ERBB2IP erbb2 interacting protein 1 1
MIRT097419 JMY junction mediating and regulatory protein, p53 cofactor 1 1
MIRT097462 PAPD4 PAP associated domain containing 4 1 1
MIRT099316 QKI QKI, KH domain containing, RNA binding 1 2
MIRT099832 SOX4 SRY (sex determining region Y)-box 4 1 5
MIRT100769 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) 1 1
MIRT101819 PNRC1 proline-rich nuclear receptor coactivator 1 1 1
MIRT102152 POP7 processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae) 1 2
MIRT102226 HBP1 HMG-box transcription factor 1 1 1
MIRT102619 UBN2 ubinuclein 2 1 4
MIRT105307 VPS37A vacuolar protein sorting 37 homolog A (S. cerevisiae) 1 1
MIRT105432 ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 1 5
MIRT105800 RAB11FIP1 RAB11 family interacting protein 1 (class I) 1 1
MIRT107277 FAM73B family with sequence similarity 73, member B 1 1
MIRT108263 HABP4 hyaluronan binding protein 4 1 2
MIRT108879 HPRT1 hypoxanthine phosphoribosyltransferase 1 1 1
MIRT109828 MID1IP1 MID1 interacting protein 1 1 4
MIRT123862 FZD6 frizzled family receptor 6 1 4
MIRT126559 MASTL microtubule associated serine/threonine kinase-like 1 1
MIRT130095 TXNIP thioredoxin interacting protein 1 3
MIRT132492 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT139877 BTF3L4 basic transcription factor 3-like 4 1 3
MIRT142403 TNRC6A trinucleotide repeat containing 6A 1 3
MIRT153977 PRNP prion protein 1 1
MIRT162269 LMLN leishmanolysin-like (metallopeptidase M8 family) 1 2
MIRT164530 MSMO1 methylsterol monooxygenase 1 1 1
MIRT178066 SAMD8 sterile alpha motif domain containing 8 1 1
MIRT178927 C11ORF57 chromosome 11 open reading frame 57 1 1
MIRT179068 PAFAH1B2 platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) 1 3
MIRT180844 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 2
MIRT182971 TROVE2 TROVE domain family, member 2 1 1
MIRT193024 TMOD3 tropomodulin 3 (ubiquitous) 1 4
MIRT195754 ATMIN ATM interactor 1 3
MIRT196621 TAOK1 TAO kinase 1 1 3
MIRT212151 CLCN3 chloride channel, voltage-sensitive 3 1 2
MIRT217604 NUS1 nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) 1 1
MIRT220698 MTPN myotrophin 1 2
MIRT222273 CCT6A chaperonin containing TCP1, subunit 6A (zeta 1) 1 1
MIRT223636 ATP6V1C1 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 1 2
MIRT224754 DPYSL2 dihydropyrimidinase-like 2 1 1
MIRT227994 NFIB nuclear factor I/B 1 2
MIRT230970 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT242662 SALL3 sal-like 3 (Drosophila) 1 2
MIRT243093 LCLAT1 lysocardiolipin acyltransferase 1 1 2
MIRT244077 EDN1 endothelin 1 1 1
MIRT246460 ZBTB7B zinc finger and BTB domain containing 7B 1 1
MIRT248075 SLC38A2 solute carrier family 38, member 2 1 2
MIRT270939 GPRC5A G protein-coupled receptor, family C, group 5, member A 1 1
MIRT295176 ZNF317 zinc finger protein 317 1 2
MIRT296529 STX16 syntaxin 16 1 1
MIRT301575 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT316376 PPP1R14C protein phosphatase 1, regulatory (inhibitor) subunit 14C 1 1
MIRT323695 PLEKHF2 pleckstrin homology domain containing, family F (with FYVE domain) member 2 1 2
MIRT327912 CHIC1 cysteine-rich hydrophobic domain 1 1 1
MIRT367108 ZNF711 zinc finger protein 711 1 2
MIRT368753 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT407333 IGFBP5 insulin-like growth factor binding protein 5 1 1
MIRT448328 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT448960 CDK19 cyclin-dependent kinase 19 1 2
MIRT449149 UQCRB ubiquinol-cytochrome c reductase binding protein 1 1
MIRT454121 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT459837 TPP1 tripeptidyl peptidase I 1 1
MIRT460422 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 1 2
MIRT461662 G6PC glucose-6-phosphatase, catalytic subunit 1 1
MIRT462952 ZNF800 zinc finger protein 800 1 6
MIRT463644 YY1 YY1 transcription factor 1 4
MIRT464855 RPS27A ribosomal protein S27a 1 6
MIRT464870 UBB ubiquitin B 1 4
MIRT466325 THRA thyroid hormone receptor, alpha 1 1
MIRT466832 STX6 syntaxin 6 1 3
MIRT467419 SNTB1 syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1) 1 2
MIRT467460 SNAPIN SNAP-associated protein 1 1
MIRT468558 SERINC3 serine incorporator 3 1 5
MIRT469812 RAB14 RAB14, member RAS oncogene family 1 1
MIRT469870 PXK PX domain containing serine/threonine kinase 1 4
MIRT470332 PPP6R1 protein phosphatase 6, regulatory subunit 1 1 1
MIRT473774 MAP3K9 mitogen-activated protein kinase kinase kinase 9 1 1
MIRT474744 KIF13A kinesin family member 13A 1 3
MIRT474961 KCTD10 potassium channel tetramerisation domain containing 10 1 2
MIRT475484 HSPA8 heat shock 70kDa protein 8 1 3
MIRT476293 GMFB glia maturation factor, beta 1 5
MIRT477366 EOGT EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase 1 2
MIRT477495 ELL2 elongation factor, RNA polymerase II, 2 1 1
MIRT478109 DLG5 discs, large homolog 5 (Drosophila) 1 3
MIRT479820 CCNA2 cyclin A2 1 3
MIRT480016 CAPRIN2 caprin family member 2 1 2
MIRT480843 BLCAP bladder cancer associated protein 1 5
MIRT481610 ARHGAP1 Rho GTPase activating protein 1 1 3
MIRT481874 ANKRD50 ankyrin repeat domain 50 1 1
MIRT484945 ZFYVE26 zinc finger, FYVE domain containing 26 1 2
MIRT485126 SECISBP2L SECIS binding protein 2-like 1 2
MIRT485440 KLF6 Kruppel-like factor 6 1 1
MIRT485576 FOXQ1 forkhead box Q1 1 1
MIRT485650 DICER1 dicer 1, ribonuclease type III 1 4
MIRT486748 CNOT4 CCR4-NOT transcription complex, subunit 4 1 3
MIRT490889 OSBP oxysterol binding protein 1 1
MIRT491428 PDZD11 PDZ domain containing 11 1 2
MIRT491650 PDRG1 p53 and DNA-damage regulated 1 1 5
MIRT491796 ZNF24 zinc finger protein 24 1 1
MIRT492265 SIK1 salt-inducible kinase 1 1 3
MIRT493096 MMGT1 membrane magnesium transporter 1 1 6
MIRT498065 SNX5 sorting nexin 5 1 3
MIRT498879 ZNF12 zinc finger protein 12 1 5
MIRT499898 KIAA1191 KIAA1191 1 2
MIRT500402 ZMAT3 zinc finger, matrin-type 3 1 5
MIRT500503 ZBTB4 zinc finger and BTB domain containing 4 1 3
MIRT500733 TRIM37 tripartite motif containing 37 1 1
MIRT500920 STARD13 StAR-related lipid transfer (START) domain containing 13 1 2
MIRT501474 PTPN4 protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte) 1 4
MIRT501556 POC1B-GALNT4 POC1B-GALNT4 readthrough 1 1
MIRT501791 NRBF2 nuclear receptor binding factor 2 1 3
MIRT501988 MAPK1 mitogen-activated protein kinase 1 1 5
MIRT502016 MAP7 microtubule-associated protein 7 1 4
MIRT502420 GALNT4 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4) 1 1
MIRT502519 ESR1 estrogen receptor 1 1 1
MIRT502763 CLIP1 CAP-GLY domain containing linker protein 1 1 4
MIRT503050 CAMSAP2 calmodulin regulated spectrin-associated protein family, member 2 1 1
MIRT503477 ZNF154 zinc finger protein 154 1 3
MIRT503680 SLC46A1 solute carrier family 46 (folate transporter), member 1 1 1
MIRT504274 PARP1 poly (ADP-ribose) polymerase 1 1 3
MIRT504558 ZNF417 zinc finger protein 417 1 3
MIRT504687 ATP6V0D1 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 1 3
MIRT505247 UBE2D3 ubiquitin-conjugating enzyme E2D 3 1 1
MIRT505872 POLR1B polymerase (RNA) I polypeptide B, 128kDa 1 2
MIRT506224 PHF12 PHD finger protein 12 1 1
MIRT506467 NACC2 NACC family member 2, BEN and BTB (POZ) domain containing 1 2
MIRT506510 MSANTD4 Myb/SANT-like DNA-binding domain containing 4 with coiled-coils 1 2
MIRT506694 LZIC leucine zipper and CTNNBIP1 domain containing 1 2
MIRT507908 CALM2 calmodulin 2 (phosphorylase kinase, delta) 1 3
MIRT509663 ZNF354B zinc finger protein 354B 1 5
MIRT510720 SPG20 spastic paraplegia 20 (Troyer syndrome) 1 3
MIRT510867 RAN RAN, member RAS oncogene family 1 4
MIRT511098 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 1 2
MIRT511251 KLHL36 kelch-like 36 (Drosophila) 1 3
MIRT513216 RFT1 RFT1 homolog (S. cerevisiae) 1 1
MIRT513622 VPS37B vacuolar protein sorting 37 homolog B (S. cerevisiae) 1 1
MIRT513718 RBM20 RNA binding motif protein 20 1 2
MIRT513907 GRB10 growth factor receptor-bound protein 10 1 3
MIRT514370 UBBP4 ubiquitin B pseudogene 4 1 3
MIRT517869 NCAPD2 non-SMC condensin I complex, subunit D2 1 2
MIRT521316 RRAGD Ras-related GTP binding D 1 2
MIRT521700 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 4
MIRT521775 PPIG peptidylprolyl isomerase G (cyclophilin G) 1 4
MIRT524505 CEP170 centrosomal protein 170kDa 1 2
MIRT527463 CLEC12B C-type lectin domain family 12, member B 1 1
MIRT530129 HADHB hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit 1 1
MIRT530848 RAG1 recombination activating gene 1 1 2
MIRT531103 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT533494 TRIM71 tripartite motif containing 71, E3 ubiquitin protein ligase 1 1
MIRT534266 SLC12A7 solute carrier family 12 (potassium/chloride transporters), member 7 1 1
MIRT534719 RFX7 regulatory factor X, 7 1 1
MIRT535271 PIGA phosphatidylinositol glycan anchor biosynthesis, class A 1 2
MIRT536341 LEFTY1 left-right determination factor 1 1 1
MIRT536409 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT538275 CUL3 cullin 3 1 2
MIRT538415 COX20 COX20 Cox2 chaperone homolog (S. cerevisiae) 1 1
MIRT539462 ADARB2 adenosine deaminase, RNA-specific, B2 1 1
MIRT540449 RBM43 RNA binding motif protein 43 1 1
MIRT541132 RAB34 RAB34, member RAS oncogene family 1 1
MIRT543572 RPF2 ribosome production factor 2 homolog (S. cerevisiae) 1 2
MIRT544109 IPMK inositol polyphosphate multikinase 1 1
MIRT544490 TRIM4 tripartite motif containing 4 1 1
MIRT544694 ZNF224 zinc finger protein 224 1 2
MIRT544989 MFF mitochondrial fission factor 1 2
MIRT546277 TMEM30A transmembrane protein 30A 1 2
MIRT546567 SATB2 SATB homeobox 2 1 1
MIRT546655 RPS6KA5 ribosomal protein S6 kinase, 90kDa, polypeptide 5 1 1
MIRT546775 RLIM ring finger protein, LIM domain interacting 1 1
MIRT546957 SFTPA1 surfactant protein A1 1 1
MIRT547044 POGZ pogo transposable element with ZNF domain 1 1
MIRT547490 MBNL3 muscleblind-like splicing regulator 3 1 2
MIRT547910 HOXA5 homeobox A5 1 1
MIRT548405 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 1 2
MIRT548478 EGLN3 egl nine homolog 3 (C. elegans) 1 1
MIRT548649 DAPK1 death-associated protein kinase 1 1 1
MIRT548855 CERCAM cerebral endothelial cell adhesion molecule 1 1
MIRT548893 CHEK2 checkpoint kinase 2 1 2
MIRT549137 BRWD1 bromodomain and WD repeat domain containing 1 1 2
MIRT549178 BMP3 bone morphogenetic protein 3 1 1
MIRT549330 ARHGAP12 Rho GTPase activating protein 12 1 2
MIRT549435 ACVR1 activin A receptor, type I 1 1
MIRT549462 ACSL4 acyl-CoA synthetase long-chain family member 4 1 1
MIRT549487 ACBD5 acyl-CoA binding domain containing 5 1 1
MIRT550216 MAVS mitochondrial antiviral signaling protein 1 2
MIRT551706 ASB16 ankyrin repeat and SOCS box containing 16 1 1
MIRT552156 DAD1 defender against cell death 1 1 1
MIRT552362 ZNF620 zinc finger protein 620 1 1
MIRT552519 ZIC5 Zic family member 5 1 1
MIRT552852 WIPF2 WAS/WASL interacting protein family, member 2 1 1
MIRT552889 WASL Wiskott-Aldrich syndrome-like 1 2
MIRT553311 TSPAN3 tetraspanin 3 1 1
MIRT553350 TRPC3 transient receptor potential cation channel, subfamily C, member 3 1 2
MIRT553712 TCF7L2 transcription factor 7-like 2 (T-cell specific, HMG-box) 1 1
MIRT553899 SUN2 Sad1 and UNC84 domain containing 2 1 2
MIRT554855 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 1 1
MIRT555084 PURG purine-rich element binding protein G 1 1
MIRT555195 PRUNE2 prune homolog 2 (Drosophila) 1 1
MIRT556197 MCC mutated in colorectal cancers 1 1
MIRT556225 MB21D2 Mab-21 domain containing 2 1 1
MIRT556486 LIPA lipase A, lysosomal acid, cholesterol esterase 1 1
MIRT556969 IER3IP1 immediate early response 3 interacting protein 1 1 1
MIRT557026 HOXD11 homeobox D11 1 1
MIRT557075 HOXB3 homeobox B3 1 1
MIRT557584 GNPTAB N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits 1 1
MIRT558279 DYNC1LI2 dynein, cytoplasmic 1, light intermediate chain 2 1 1
MIRT558414 DEPDC1 DEP domain containing 1 1 1
MIRT558773 CFL2 cofilin 2 (muscle) 1 1
MIRT559627 AKIRIN2 akirin 2 1 1
MIRT560234 KLHL21 kelch-like 21 (Drosophila) 1 2
MIRT560653 ZNF107 zinc finger protein 107 1 1
MIRT560935 CDK2AP2 cyclin-dependent kinase 2 associated protein 2 1 1
MIRT563758 ZNF678 zinc finger protein 678 1 1
MIRT566009 RNF11 ring finger protein 11 1 1
MIRT566154 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT566696 MYLIP myosin regulatory light chain interacting protein 1 1
MIRT567068 KCNB1 potassium voltage-gated channel, Shab-related subfamily, member 1 1 1
MIRT567536 FGFR1OP FGFR1 oncogene partner 1 1
MIRT567766 DLC1 deleted in liver cancer 1 1 1
MIRT567832 DCUN1D3 DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae) 1 1
MIRT571618 SRSF2 serine/arginine-rich splicing factor 2 1 1
MIRT573079 ABCD2 ATP-binding cassette, sub-family D (ALD), member 2 1 1
MIRT610912 NF2 neurofibromin 2 (merlin) 1 1
MIRT620060 ODF4 outer dense fiber of sperm tails 4 1 1
MIRT623181 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT627020 FIG4 FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae) 1 1
MIRT627086 SF3A1 splicing factor 3a, subunit 1, 120kDa 1 1
MIRT628284 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629103 F2RL1 coagulation factor II (thrombin) receptor-like 1 1 1
MIRT629243 CINP cyclin-dependent kinase 2 interacting protein 1 1
MIRT629419 ADM2 adrenomedullin 2 1 1
MIRT629594 RFC2 replication factor C (activator 1) 2, 40kDa 1 1
MIRT629647 WDR31 WD repeat domain 31 1 1
MIRT629808 GPR82 G protein-coupled receptor 82 1 1
MIRT629882 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629926 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 1 1
MIRT629991 NARS asparaginyl-tRNA synthetase 1 1
MIRT630052 TERF2 telomeric repeat binding factor 2 1 1
MIRT630070 NIP7 nuclear import 7 homolog (S. cerevisiae) 1 1
MIRT630165 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630260 SMTNL2 smoothelin-like 2 1 1
MIRT630290 PSMB5 proteasome (prosome, macropain) subunit, beta type, 5 1 1
MIRT630354 NKAP NFKB activating protein 1 1
MIRT630504 CYP20A1 cytochrome P450, family 20, subfamily A, polypeptide 1 1 1
MIRT632055 ATF7IP activating transcription factor 7 interacting protein 1 1
MIRT632480 RPS15A ribosomal protein S15a 1 1
MIRT632607 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT633003 DUSP18 dual specificity phosphatase 18 1 1
MIRT633090 CXorf21 chromosome X open reading frame 21 1 1
MIRT635060 MYH11 myosin, heavy chain 11, smooth muscle 1 1
MIRT635953 PLA2G12A phospholipase A2, group XIIA 1 1
MIRT636664 CDK4 cyclin-dependent kinase 4 1 1
MIRT637195 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637934 LILRA2 leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2 1 1
MIRT641814 USP32 ubiquitin specific peptidase 32 1 1
MIRT642652 PTGR2 prostaglandin reductase 2 1 1
MIRT644244 SLC35E3 solute carrier family 35, member E3 1 1
MIRT644673 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645101 SLC35E2B solute carrier family 35, member E2B 1 1
MIRT646001 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646516 FAM217B family with sequence similarity 217, member B 1 1
MIRT646782 IL23R interleukin 23 receptor 1 1
MIRT648523 PIGG phosphatidylinositol glycan anchor biosynthesis, class G 1 1
MIRT651473 XIAP X-linked inhibitor of apoptosis 1 1
MIRT654357 RBM27 RNA binding motif protein 27 1 1
MIRT660835 AGO3 eukaryotic translation initiation factor 2C, 3 1 1
MIRT661187 S1PR2 sphingosine-1-phosphate receptor 2 1 1
MIRT661248 ARL17B ADP-ribosylation factor-like 17B 1 1
MIRT662851 OMD osteomodulin 1 1
MIRT662926 MED18 mediator complex subunit 18 1 1
MIRT663552 CCR6 chemokine (C-C motif) receptor 6 1 1
MIRT664364 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT666089 SSTR2 somatostatin receptor 2 1 1
MIRT666265 SLC31A1 solute carrier family 31 (copper transporters), member 1 1 1
MIRT666685 RBM23 RNA binding motif protein 23 1 1
MIRT667237 NFE2L1 nuclear factor (erythroid-derived 2)-like 1 1 1
MIRT667764 KDELR1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 1 1
MIRT669258 C4orf36 chromosome 4 open reading frame 36 1 1
MIRT671484 FLYWCH2 FLYWCH family member 2 1 1
MIRT671506 SLC38A9 solute carrier family 38, member 9 1 1
MIRT671934 PLEKHS1 pleckstrin homology domain containing, family S member 1 1 2
MIRT672301 GP2 glycoprotein 2 (zymogen granule membrane) 1 1
MIRT672612 IRF1 interferon regulatory factor 1 1 1
MIRT674037 ANKRD9 ankyrin repeat domain 9 1 1
MIRT674229 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674539 PRR23A proline rich 23A 1 1
MIRT675111 SNTB2 syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) 1 1
MIRT675277 ZNF431 zinc finger protein 431 1 1
MIRT684274 PRPF4 PRP4 pre-mRNA processing factor 4 homolog (yeast) 1 1
MIRT694284 ZNF529 zinc finger protein 529 1 2
MIRT698257 TMEM2 transmembrane protein 2 1 1
MIRT699916 RUNDC1 RUN domain containing 1 1 1
MIRT702593 JARID2 jumonji, AT rich interactive domain 2 1 1
MIRT705204 BTG1 B-cell translocation gene 1, anti-proliferative 1 1
MIRT706931 THAP6 THAP domain containing 6 1 1
MIRT708882 MOCS2 molybdenum cofactor synthesis 2 1 1
MIRT709119 C3orf18 chromosome 3 open reading frame 18 1 1
MIRT709619 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 1
MIRT710593 CDCA4 cell division cycle associated 4 1 1
MIRT710797 IFNLR1 interleukin 28 receptor, alpha (interferon, lambda receptor) 1 1
MIRT711779 RFXAP regulatory factor X-associated protein 1 1
MIRT713340 KLRD1 killer cell lectin-like receptor subfamily D, member 1 1 1
MIRT713637 MED8 mediator complex subunit 8 1 1
MIRT713911 IGF2R insulin-like growth factor 2 receptor 1 1
MIRT715065 TMTC1 transmembrane and tetratricopeptide repeat containing 1 1 1
MIRT715182 DTX4 deltex homolog 4 (Drosophila) 1 1
MIRT715200 FKTN fukutin 1 1
MIRT715276 RNF125 ring finger protein 125, E3 ubiquitin protein ligase 1 1
MIRT717804 FAM114A1 family with sequence similarity 114, member A1 1 1
MIRT720540 CHERP calcium homeostasis endoplasmic reticulum protein 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*