Accession ID: MIRT044304 [miRNA, hsa-miR-106b-5p :: MSH6, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-106bLinkOut: [miRBase ]
Description Homo sapiens miR-106b stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-106b-5p
Mature Sequence 12| UAAAGUGCUGACAGUGCAGAU |32
Evidence Experimental
Experiments Cloned
Putative hsa-miR-106b-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MSH6 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms GTBP, HNPCC5, HSAP
Description mutS homolog 6 (E. coli)
Transcript NM_000179    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MSH6 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MSH6
(miRNA target sites are highlighted)
>MSH6|NM_000179|3'UTR
   1 ACTGACTACATTGGAAGCTTTGAGTTGACTTCTGACAAAGGTGGTAAATTCAGACAACATTATGATCTAATAAACTTTAT
  81 TTTTTAAAAATGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uagacgugacagucgUGAAAu 5'
                         ||||| 
Target 5' attatgatctaataaACTTTa 3'
59 - 79 100.00 -5.80
2
miRNA  3' uaGACGUGA--CAGUCGU-GAAAu 5'
            ||| |||   |::| | |||| 
Target 5' -aCTG-ACTACATTGGAAGCTTTg 3'
1 - 22 92.00 -9.70
3
miRNA  3' uaGAC-GUGACAGUCGUGAAAu 5'
            ||| ||  | ::|:|  || 
Target 5' ttCTGACAAAGGTGGTAAATTc 3'
30 - 51 75.00 -5.70
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-106b-5p :: MSH6    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
1063 hsa-miR-106b-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000372 ITCH itchy E3 ubiquitin protein ligase 5 6
MIRT000373 APP amyloid beta (A4) precursor protein 3 4
MIRT000603 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 6 13
MIRT003045 E2F1 E2F transcription factor 1 6 8
MIRT004333 KAT2B K(lysine) acetyltransferase 2B 4 3
MIRT004466 VEGFA vascular endothelial growth factor A 2 2
MIRT004571 BCL2L11 BCL2-like 11 (apoptosis facilitator) 4 6
MIRT004664 RB1 retinoblastoma 1 5 5
MIRT005847 TCEAL1 transcription elongation factor A (SII)-like 1 4 4
MIRT005861 CCND1 cyclin D1 2 7
MIRT005862 CCND2 cyclin D2 1 1
MIRT005863 E2F3 E2F transcription factor 3 2 2
MIRT005864 MAPK9 mitogen-activated protein kinase 9 1 1
MIRT005865 PTEN phosphatase and tensin homolog 6 4
MIRT005866 RBL1 retinoblastoma-like 1 (p107) 1 2
MIRT005867 RBL2 retinoblastoma-like 2 (p130) 2 4
MIRT005868 WEE1 WEE1 homolog (S. pombe) 2 3
MIRT006568 EOMES eomesodermin 1 1
MIRT007004 PURA purine-rich element binding protein A 1 1
MIRT007071 APC adenomatous polyposis coli 3 1
MIRT020417 CDK5R2 cyclin-dependent kinase 5, regulatory subunit 2 (p39) 1 1
MIRT020418 IRF9 interferon regulatory factor 9 1 1
MIRT020419 LINC00483 long intergenic non-protein coding RNA 483 1 1
MIRT020420 OPRK1 opioid receptor, kappa 1 1 1
MIRT020421 SYT4 synaptotagmin IV 1 1
MIRT020422 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT020423 CABP2 calcium binding protein 2 1 1
MIRT020424 DNAJB6 DnaJ (Hsp40) homolog, subfamily B, member 6 2 2
MIRT020425 SSX7 synovial sarcoma, X breakpoint 7 1 1
MIRT020426 KIF23 kinesin family member 23 2 4
MIRT020427 AFP alpha-fetoprotein 1 1
MIRT020428 CD34 CD34 molecule 1 1
MIRT020429 OTP orthopedia homeobox 1 1
MIRT020430 HSP90B3P heat shock protein 90kDa beta (Grp94), member 3, pseudogene 1 1
MIRT020431 B3GAT1 beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P) 1 1
MIRT020432 PRB2 proline-rich protein BstNI subfamily 2 1 1
MIRT020433 SBSN suprabasin 1 1
MIRT020434 GPM6A glycoprotein M6A 1 1
MIRT020435 OR52K1 olfactory receptor, family 52, subfamily K, member 1 1 1
MIRT020436 NAGK N-acetylglucosamine kinase 2 4
MIRT020437 KDR kinase insert domain receptor (a type III receptor tyrosine kinase) 1 1
MIRT020438 TAF6L TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa 1 1
MIRT020439 C1orf111 chromosome 1 open reading frame 111 1 1
MIRT020440 TNNI1 troponin I type 1 (skeletal, slow) 1 1
MIRT020441 SPAG1 sperm associated antigen 1 1 1
MIRT020442 SUMF1 sulfatase modifying factor 1 1 1
MIRT020443 RUNX1T1 runt-related transcription factor 1; translocated to, 1 (cyclin D-related) 1 1
MIRT020444 CASP7 caspase 7, apoptosis-related cysteine peptidase 4 2
MIRT020445 TLR2 toll-like receptor 2 1 1
MIRT020446 SMAD9 SMAD family member 9 1 1
MIRT020447 BTN3A3 butyrophilin, subfamily 3, member A3 2 2
MIRT020448 IFNAR2 interferon (alpha, beta and omega) receptor 2 2 2
MIRT020449 HMGB3 high mobility group box 3 2 4
MIRT020450 MAT2B methionine adenosyltransferase II, beta 1 1
MIRT020451 ARL13B ADP-ribosylation factor-like 13B 1 1
MIRT020452 DPP9 dipeptidyl-peptidase 9 1 1
MIRT020453 MXI1 MAX interactor 1 2 3
MIRT020454 NUBP1 nucleotide binding protein 1 1 1
MIRT020455 NEFH neurofilament, heavy polypeptide 1 1
MIRT020456 COMMD6 COMM domain containing 6 1 1
MIRT020457 KIAA1598 KIAA1598 1 1
MIRT020458 LIN7B lin-7 homolog B (C. elegans) 1 1
MIRT020459 AGO1 eukaryotic translation initiation factor 2C, 1 2 3
MIRT020460 JAK1 Janus kinase 1 5 3
MIRT020461 LIMK1 LIM domain kinase 1 1 1
MIRT020462 KATNAL1 katanin p60 subunit A-like 1 2 3
MIRT020463 ELK3 ELK3, ETS-domain protein (SRF accessory protein 2) 1 1
MIRT020464 THAP6 THAP domain containing 6 1 1
MIRT020465 C9orf40 chromosome 9 open reading frame 40 2 6
MIRT020466 PLS1 plastin 1 2 2
MIRT020467 OSTM1 osteopetrosis associated transmembrane protein 1 2 2
MIRT020468 TBC1D9 TBC1 domain family, member 9 (with GRAM domain) 1 1
MIRT020469 AKAP11 A kinase (PRKA) anchor protein 11 2 7
MIRT020470 IFIT5 interferon-induced protein with tetratricopeptide repeats 5 1 1
MIRT020471 CLOCK clock homolog (mouse) 2 2
MIRT020472 ATAD2 ATPase family, AAA domain containing 2 2 2
MIRT020473 TMEM245 transmembrane protein 245 2 2
MIRT020474 EIF5A2 eukaryotic translation initiation factor 5A2 2 2
MIRT020475 RORA RAR-related orphan receptor A 2 3
MIRT020476 CROT carnitine O-octanoyltransferase 2 2
MIRT020477 BTG3 BTG family, member 3 2 5
MIRT020478 CDC37L1 cell division cycle 37 homolog (S. cerevisiae)-like 1 1 1
MIRT020479 PON2 paraoxonase 2 1 1
MIRT020480 BRMS1L breast cancer metastasis-suppressor 1-like 2 2
MIRT020481 EFCAB14 KIAA0494 2 3
MIRT020482 HN1 hematological and neurological expressed 1 1 1
MIRT020483 PRRG1 proline rich Gla (G-carboxyglutamic acid) 1 1 1
MIRT020484 USP46 ubiquitin specific peptidase 46 1 1
MIRT020485 PKD2 polycystic kidney disease 2 (autosomal dominant) 1 1
MIRT044246 KANK2 KN motif and ankyrin repeat domains 2 1 1
MIRT044247 TRPC4AP transient receptor potential cation channel, subfamily C, member 4 associated protein 1 1
MIRT044248 GON4L gon-4-like (C. elegans) 1 1
MIRT044249 RPL7 ribosomal protein L7 1 1
MIRT044250 PPM1B protein phosphatase, Mg2+/Mn2+ dependent, 1B 1 1
MIRT044251 DGKD diacylglycerol kinase, delta 130kDa 1 1
MIRT044252 APLP2 amyloid beta (A4) precursor-like protein 2 1 1
MIRT044253 ABTB2 ankyrin repeat and BTB (POZ) domain containing 2 1 1
MIRT044254 PATE2 prostate and testis expressed 2 1 1
MIRT044255 CENPM centromere protein M 1 1
MIRT044256 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT044257 YTHDF2 YTH domain family, member 2 1 1
MIRT044258 PFDN6 prefoldin subunit 6 1 1
MIRT044259 DDX17 DEAD (Asp-Glu-Ala-Asp) box helicase 17 1 1
MIRT044260 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 1 1
MIRT044261 AP1G1 adaptor-related protein complex 1, gamma 1 subunit 1 2
MIRT044262 CLTC clathrin, heavy chain (Hc) 1 1
MIRT044263 SMEK2 SMEK homolog 2, suppressor of mek1 (Dictyostelium) 1 1
MIRT044264 LARS leucyl-tRNA synthetase 1 1
MIRT044265 TSC1 tuberous sclerosis 1 1 1
MIRT044266 UNC45A unc-45 homolog A (C. elegans) 1 1
MIRT044267 YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 1 1
MIRT044268 SLC10A7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 1
MIRT044269 THADA thyroid adenoma associated 1 1
MIRT044270 RNPS1 RNA binding protein S1, serine-rich domain 1 1
MIRT044271 SLC52A3 solute carrier family 52, riboflavin transporter, member 3 1 1
MIRT044272 YBX1 Y box binding protein 1 1 1
MIRT044273 TUBB4B tubulin, beta 4B class IVb 1 1
MIRT044274 KIF5C kinesin family member 5C 1 1
MIRT044275 TRIB2 tribbles homolog 2 (Drosophila) 1 1
MIRT044276 WDR33 WD repeat domain 33 1 1
MIRT044277 CBFA2T2 core-binding factor, runt domain, alpha subunit 2; translocated to, 2 1 1
MIRT044278 RPS14 ribosomal protein S14 1 1
MIRT044279 ACIN1 apoptotic chromatin condensation inducer 1 1 1
MIRT044280 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT044281 RAD23B RAD23 homolog B (S. cerevisiae) 1 1
MIRT044282 GOLT1B golgi transport 1B 1 1
MIRT044283 CNOT6 CCR4-NOT transcription complex, subunit 6 1 1
MIRT044284 ABHD17C family with sequence similarity 108, member C1 1 1
MIRT044285 ZBTB7B zinc finger and BTB domain containing 7B 1 1
MIRT044286 RHOBTB2 Rho-related BTB domain containing 2 1 1
MIRT044287 MTMR1 myotubularin related protein 1 1 1
MIRT044288 IPO7 importin 7 1 1
MIRT044289 PIK3AP1 phosphoinositide-3-kinase adaptor protein 1 1 1
MIRT044290 C1orf43 chromosome 1 open reading frame 43 1 1
MIRT044291 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT044292 ELOVL6 ELOVL fatty acid elongase 6 1 1
MIRT044293 DNAJC13 DnaJ (Hsp40) homolog, subfamily C, member 13 1 1
MIRT044294 RPL21 ribosomal protein L21 1 1
MIRT044295 PSMA3 proteasome (prosome, macropain) subunit, alpha type, 3 1 1
MIRT044296 SLC25A5 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5 1 1
MIRT044297 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT044298 FNBP1 formin binding protein 1 1 1
MIRT044299 HTT huntingtin 1 1
MIRT044300 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT044301 ASAP1 ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 1 1
MIRT044302 MMADHC methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria 1 1
MIRT044303 ZFYVE16 zinc finger, FYVE domain containing 16 1 1
MIRT044304 MSH6 mutS homolog 6 (E. coli) 1 1
MIRT044305 MAT2A methionine adenosyltransferase II, alpha 1 1
MIRT044306 ZNF598 zinc finger protein 598 1 1
MIRT044307 PANK3 pantothenate kinase 3 1 2
MIRT044308 FBXW2 F-box and WD repeat domain containing 2 1 1
MIRT044309 UQCRFS1 ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 1 1
MIRT044310 ZNF777 zinc finger protein 777 1 1
MIRT044311 PPP4C protein phosphatase 4, catalytic subunit 1 1
MIRT044312 RPL18 ribosomal protein L18 1 1
MIRT044313 NID1 nidogen 1 1 1
MIRT044314 SHISA2 shisa homolog 2 (Xenopus laevis) 1 1
MIRT044315 ZNF562 zinc finger protein 562 1 1
MIRT044316 ZNF587 zinc finger protein 587 1 1
MIRT044317 BAMBI BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) 1 1
MIRT044318 MYL6 myosin, light chain 6, alkali, smooth muscle and non-muscle 1 1
MIRT044319 RREB1 ras responsive element binding protein 1 1 1
MIRT044320 DAP3 death associated protein 3 1 1
MIRT044321 PPIA peptidylprolyl isomerase A (cyclophilin A) 1 1
MIRT044322 CTDSP2 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 1 1
MIRT044323 UGP2 UDP-glucose pyrophosphorylase 2 1 1
MIRT044324 TXNRD2 thioredoxin reductase 2 1 1
MIRT044325 PTP4A2 protein tyrosine phosphatase type IVA, member 2 1 1
MIRT044326 SLC9A1 solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1 1 1
MIRT044327 CWF19L1 CWF19-like 1, cell cycle control (S. pombe) 1 1
MIRT044328 DCUN1D1 DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) 1 1
MIRT044329 INSIG1 insulin induced gene 1 1 1
MIRT044330 ANAPC7 anaphase promoting complex subunit 7 1 1
MIRT044331 FAM199X family with sequence similarity 199, X-linked 1 1
MIRT044332 TRIP12 thyroid hormone receptor interactor 12 1 1
MIRT044333 RCCD1 RCC1 domain containing 1 1 2
MIRT044334 LRRC59 leucine rich repeat containing 59 1 1
MIRT044335 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 2
MIRT044336 TMPO thymopoietin 1 1
MIRT044337 SETD2 SET domain containing 2 1 1
MIRT044338 TRRAP transformation/transcription domain-associated protein 1 1
MIRT044339 IGDCC3 immunoglobulin superfamily, DCC subclass, member 3 1 1
MIRT044340 CNOT6L CCR4-NOT transcription complex, subunit 6-like 1 5
MIRT044341 UQCRQ ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa 1 1
MIRT044342 CES2 carboxylesterase 2 1 1
MIRT044343 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT044344 FAM91A1 family with sequence similarity 91, member A1 1 1
MIRT044345 MIER2 mesoderm induction early response 1, family member 2 1 1
MIRT044346 FAM222B family with sequence similarity 222, member B 1 1
MIRT044347 SMG7 smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans) 1 1
MIRT044348 DDX23 DEAD (Asp-Glu-Ala-Asp) box polypeptide 23 1 1
MIRT044349 RPP30 ribonuclease P/MRP 30kDa subunit 1 1
MIRT044350 STK40 serine/threonine kinase 40 1 1
MIRT044351 NNT nicotinamide nucleotide transhydrogenase 1 1
MIRT044352 HMGCL 3-hydroxymethyl-3-methylglutaryl-CoA lyase 1 1
MIRT044353 ZNF706 zinc finger protein 706 1 1
MIRT044354 FAM171A2 family with sequence similarity 171, member A2 1 1
MIRT044355 EIF3F eukaryotic translation initiation factor 3, subunit F 1 1
MIRT044356 KAT7 K(lysine) acetyltransferase 7 1 1
MIRT044357 MTR 5-methyltetrahydrofolate-homocysteine methyltransferase 1 1
MIRT044358 CNOT7 CCR4-NOT transcription complex, subunit 7 1 2
MIRT044359 DCTPP1 dCTP pyrophosphatase 1 1 1
MIRT044360 AP2B1 adaptor-related protein complex 2, beta 1 subunit 1 1
MIRT044361 C6orf120 chromosome 6 open reading frame 120 1 2
MIRT044362 CCDC47 coiled-coil domain containing 47 1 1
MIRT044363 PRMT3 protein arginine methyltransferase 3 1 1
MIRT044364 SPEN spen homolog, transcriptional regulator (Drosophila) 1 1
MIRT044365 ERO1L ERO1-like (S. cerevisiae) 1 1
MIRT044366 HNRNPL heterogeneous nuclear ribonucleoprotein L 1 1
MIRT044367 PDSS1 prenyl (decaprenyl) diphosphate synthase, subunit 1 1 1
MIRT044368 KANSL1 KAT8 regulatory NSL complex subunit 1 1 1
MIRT044369 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 1 1
MIRT044370 HMMR hyaluronan-mediated motility receptor (RHAMM) 1 1
MIRT044371 NPLOC4 nuclear protein localization 4 homolog (S. cerevisiae) 1 1
MIRT044372 FBXO22 F-box protein 22 1 1
MIRT044373 STX12 syntaxin 12 1 1
MIRT044374 MTHFD1 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase 1 1
MIRT044375 RBM12B RNA binding motif protein 12B 1 3
MIRT044376 RPL18A ribosomal protein L18a 1 1
MIRT044377 TTPAL tocopherol (alpha) transfer protein-like 1 2
MIRT044378 ZBTB39 zinc finger and BTB domain containing 39 1 1
MIRT044379 PLEKHM1 pleckstrin homology domain containing, family M (with RUN domain) member 1 1 1
MIRT053530 E2F5 E2F transcription factor 5, p130-binding 3 2
MIRT053623 ATG16L1 autophagy related 16-like 1 (S. cerevisiae) 3 2
MIRT053873 SMAD7 SMAD family member 7 4 2
MIRT054144 STAT3 signal transducer and activator of transcription 3 (acute-phase response factor) 4 2
MIRT054256 ZBTB4 zinc finger and BTB domain containing 4 4 5
MIRT054405 TWIST1 twist homolog 1 (Drosophila) 3 1
MIRT055024 TPRG1L tumor protein p63 regulated 1-like 1 2
MIRT055387 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 3
MIRT055652 WDR37 WD repeat domain 37 1 1
MIRT056304 WAC WW domain containing adaptor with coiled-coil 1 3
MIRT056480 PFKP phosphofructokinase, platelet 1 5
MIRT056817 REEP3 receptor accessory protein 3 1 2
MIRT057387 TNKS2 tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2 1 2
MIRT057826 SLC30A7 solute carrier family 30 (zinc transporter), member 7 1 1
MIRT058915 FAM46C family with sequence similarity 46, member C 1 1
MIRT059191 CRY2 cryptochrome 2 (photolyase-like) 1 1
MIRT060079 TMEM138 transmembrane protein 138 1 1
MIRT060501 PPP6R3 protein phosphatase 6, regulatory subunit 3 1 1
MIRT060685 KLHL20 kelch-like 20 (Drosophila) 1 1
MIRT061185 MED17 mediator complex subunit 17 1 2
MIRT061793 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 5
MIRT063058 ULK1 unc-51-like kinase 1 (C. elegans) 1 1
MIRT063438 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT064438 GPR137B G protein-coupled receptor 137B 1 2
MIRT064801 ZBTB18 zinc finger protein 238 1 2
MIRT065368 TMBIM6 transmembrane BAX inhibitor motif containing 6 1 1
MIRT065674 ACVR1B activin A receptor, type IB 1 3
MIRT065863 GDF11 growth differentiation factor 11 1 1
MIRT065889 RAB5B RAB5B, member RAS oncogene family 1 5
MIRT067233 FOXJ2 forkhead box J2 1 1
MIRT068494 NHLRC3 NHL repeat containing 3 1 1
MIRT069700 FOXJ3 forkhead box J3 1 2
MIRT070745 HIF1A hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) 1 1
MIRT070842 EIF2S1 eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa 1 2
MIRT071000 SMOC1 SPARC related modular calcium binding 1 1 1
MIRT071330 CMPK1 cytidine monophosphate (UMP-CMP) kinase 1, cytosolic 1 1
MIRT071908 ZFYVE9 zinc finger, FYVE domain containing 9 1 1
MIRT072250 B2M beta-2-microglobulin 1 5
MIRT072572 USP3 ubiquitin specific peptidase 3 1 1
MIRT073120 UBE2Q2 ubiquitin-conjugating enzyme E2Q family member 2 1 1
MIRT073380 ABHD2 abhydrolase domain containing 2 1 1
MIRT073414 SEMA4B sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B 1 1
MIRT074792 CYLD cylindromatosis (turban tumor syndrome) 1 1
MIRT074897 CHD9 chromodomain helicase DNA binding protein 9 1 1
MIRT075778 KIAA0513 KIAA0513 1 3
MIRT076180 GID4 GID complex subunit 4, VID24 homolog (S. cerevisiae) 1 3
MIRT077068 KRT10 keratin 10 1 4
MIRT077835 MINK1 misshapen-like kinase 1 1 2
MIRT078815 UNK unkempt homolog (Drosophila) 1 1
MIRT079348 CCDC137 coiled-coil domain containing 137 1 2
MIRT079415 FOXK2 forkhead box K2 1 3
MIRT079775 CABLES1 Cdk5 and Abl enzyme substrate 1 1 1
MIRT080181 PRKACB protein kinase, cAMP-dependent, catalytic, beta 1 1
MIRT080225 SMAD4 SMAD family member 4 1 3
MIRT080851 RAB12 RAB12, member RAS oncogene family 1 1
MIRT081119 LDLR low density lipoprotein receptor 1 5
MIRT081202 MIDN midnolin 1 6
MIRT081985 GRAMD1A GRAM domain containing 1A 1 1
MIRT082294 FNBP1L formin binding protein 1-like 1 3
MIRT083743 PARD6B par-6 partitioning defective 6 homolog beta (C. elegans) 1 1
MIRT083964 RAB22A RAB22A, member RAS oncogene family 1 3
MIRT084347 RRM2 ribonucleotide reductase M2 1 2
MIRT085175 SLC5A3 solute carrier family 5 (sodium/myo-inositol cotransporter), member 3 1 2
MIRT085379 SPOPL speckle-type POZ protein-like 1 1
MIRT085871 TANC1 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 1 1
MIRT086431 NABP1 nucleic acid binding protein 1 1 4
MIRT086761 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 1 1
MIRT088035 UBXN2A UBX domain protein 2A 1 2
MIRT088130 SEPT2 septin 2 1 3
MIRT088340 MAPRE3 microtubule-associated protein, RP/EB family, member 3 1 4
MIRT090640 U2SURP U2 snRNP-associated SURP domain containing 1 4
MIRT091689 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 1 4
MIRT092687 C3ORF38 chromosome 3 open reading frame 38 1 4
MIRT093805 KLF3 Kruppel-like factor 3 (basic) 1 1
MIRT093944 SLAIN2 SLAIN motif family, member 2 1 1
MIRT095203 SMAD5 SMAD family member 5 1 1
MIRT095725 ANKH ankylosis, progressive homolog (mouse) 1 4
MIRT096001 ATP6V0E1 ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 1 1
MIRT096312 SQSTM1 sequestosome 1 1 1
MIRT097131 FCHO2 FCH domain only 2 1 2
MIRT097606 POLR3G polymerase (RNA) III (DNA directed) polypeptide G (32kD) 1 1
MIRT097653 LYSMD3 LysM, putative peptidoglycan-binding, domain containing 3 1 1
MIRT099315 QKI QKI, KH domain containing, RNA binding 1 2
MIRT099829 SOX4 SRY (sex determining region Y)-box 4 1 5
MIRT100281 MICB MHC class I polypeptide-related sequence B 1 1
MIRT100457 ZBTB9 zinc finger and BTB domain containing 9 1 1
MIRT100950 CENPQ centromere protein Q 1 2
MIRT102225 HBP1 HMG-box transcription factor 1 1 2
MIRT102297 DNAJB9 DnaJ (Hsp40) homolog, subfamily B, member 9 1 5
MIRT103199 SP4 Sp4 transcription factor 1 3
MIRT104166 PHTF2 putative homeodomain transcription factor 2 1 3
MIRT104400 ANKIB1 ankyrin repeat and IBR domain containing 1 1 1
MIRT108654 ZBTB33 zinc finger and BTB domain containing 33 1 3
MIRT108722 XIAP X-linked inhibitor of apoptosis 1 1
MIRT110273 GBF1 golgi brefeldin A resistant guanine nucleotide exchange factor 1 1 1
MIRT112092 TIMM17A translocase of inner mitochondrial membrane 17 homolog A (yeast) 1 3
MIRT115784 CAPN15 small optic lobes homolog (Drosophila) 1 1
MIRT121805 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 1
MIRT122367 RGMB RGM domain family, member B 1 2
MIRT124131 GINS4 GINS complex subunit 4 (Sld5 homolog) 1 2
MIRT125727 TRIM8 tripartite motif containing 8 1 1
MIRT126317 ACADSB acyl-CoA dehydrogenase, short/branched chain 1 1
MIRT126347 ZRANB1 zinc finger, RAN-binding domain containing 1 1 1
MIRT126558 MASTL microtubule associated serine/threonine kinase-like 1 2
MIRT127164 VPS26A vacuolar protein sorting 26 homolog A (S. pombe) 1 1
MIRT129139 ARCN1 archain 1 1 1
MIRT130091 TXNIP thioredoxin interacting protein 1 3
MIRT132403 PPP1R12B protein phosphatase 1, regulatory subunit 12B 1 1
MIRT133316 ORAI1 ORAI calcium release-activated calcium modulator 1 1 1
MIRT134280 DNM1L dynamin 1-like 1 1
MIRT135718 PIP4K2C phosphatidylinositol-5-phosphate 4-kinase, type II, gamma 1 1
MIRT135797 GNS glucosamine (N-acetyl)-6-sulfatase 1 4
MIRT136570 TXLNA taxilin alpha 1 1
MIRT138358 FRMD6 FERM domain containing 6 1 1
MIRT138798 SUSD6 KIAA0247 1 1
MIRT140642 PLEKHO2 pleckstrin homology domain containing, family O member 2 1 1
MIRT140800 SMAD6 SMAD family member 6 1 1
MIRT141137 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT142099 CCP110 centriolar coiled coil protein 110kDa 1 1
MIRT142401 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT144213 SNTB2 syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) 1 1
MIRT144304 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 1 5
MIRT144984 PAFAH1B1 platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa) 1 1
MIRT145029 TNFAIP1 tumor necrosis factor, alpha-induced protein 1 (endothelial) 1 1
MIRT145601 LASP1 LIM and SH3 protein 1 1 2
MIRT146080 RUNDC1 RUN domain containing 1 1 1
MIRT147124 MAP3K3 mitogen-activated protein kinase kinase kinase 3 1 1
MIRT147283 KPNA2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1 6
MIRT147927 CAMTA1 calmodulin binding transcription activator 1 1 1
MIRT148874 ANKRD12 ankyrin repeat domain 12 1 1
MIRT151700 CHAF1A chromatin assembly factor 1, subunit A (p150) 1 1
MIRT151807 BLOC1S3 biogenesis of lysosomal organelles complex-1, subunit 3 1 1
MIRT151857 ARHGAP35 Rho GTPase activating protein 35 1 1
MIRT151941 TBC1D17 TBC1 domain family, member 17 1 1
MIRT152371 ARHGEF18 Rho/Rac guanine nucleotide exchange factor (GEF) 18 1 1
MIRT152682 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT153335 MAVS mitochondrial antiviral signaling protein 1 2
MIRT153621 NCOA3 nuclear receptor coactivator 3 1 1
MIRT153976 PRNP prion protein 1 2
MIRT155338 IFNAR1 interferon (alpha, beta and omega) receptor 1 1 1
MIRT155897 SIK1 salt-inducible kinase 1 1 1
MIRT156411 RAPGEF4 Rap guanine nucleotide exchange factor (GEF) 4 1 1
MIRT156647 C2ORF69 chromosome 2 open reading frame 69 1 1
MIRT157148 FAM117B family with sequence similarity 117, member B 1 1
MIRT157590 MTMR3 myotubularin related protein 3 1 1
MIRT158291 ASB1 ankyrin repeat and SOCS box containing 1 1 1
MIRT158579 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT159120 NRBP1 nuclear receptor binding protein 1 1 2
MIRT159405 FEZ2 fasciculation and elongation protein zeta 2 (zygin II) 1 1
MIRT160009 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT160853 PLXNA1 plexin A1 1 1
MIRT164203 GAB1 GRB2-associated binding protein 1 1 1
MIRT164529 MSMO1 methylsterol monooxygenase 1 1 2
MIRT164664 WHSC1 Wolf-Hirschhorn syndrome candidate 1 1 1
MIRT164727 ADD1 adducin 1 (alpha) 1 1
MIRT166066 FAF2 Fas associated factor family member 2 1 1
MIRT167844 HECA headcase homolog (Drosophila) 1 1
MIRT168223 BTN3A2 butyrophilin, subfamily 3, member A2 1 1
MIRT168281 BTN3A1 butyrophilin, subfamily 3, member A1 1 1
MIRT169669 AGFG2 ArfGAP with FG repeats 2 1 1
MIRT170569 CASP2 caspase 2, apoptosis-related cysteine peptidase 1 1
MIRT170856 TAX1BP1 Tax1 (human T-cell leukemia virus type I) binding protein 1 1 3
MIRT172203 OXR1 oxidation resistance 1 1 1
MIRT173692 PRPF4 PRP4 pre-mRNA processing factor 4 homolog (yeast) 1 1
MIRT175384 ACSL4 acyl-CoA synthetase long-chain family member 4 1 1
MIRT175599 OCRL oculocerebrorenal syndrome of Lowe 1 1
MIRT175650 PHF6 PHD finger protein 6 1 1
MIRT176085 CHIC1 cysteine-rich hydrophobic domain 1 1 1
MIRT178065 SAMD8 sterile alpha motif domain containing 8 1 1
MIRT182521 ZBTB37 zinc finger and BTB domain containing 37 1 1
MIRT187476 PCBP2 poly(rC) binding protein 2 1 2
MIRT188187 DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 1 1
MIRT194853 UBFD1 ubiquitin family domain containing 1 1 1
MIRT199109 ZNF532 zinc finger protein 532 1 1
MIRT199285 SH3GLB1 SH3-domain GRB2-like endophilin B1 1 1
MIRT200926 ZNF264 zinc finger protein 264 1 3
MIRT201023 ZNF805 zinc finger protein 805 1 1
MIRT204830 CASP8 caspase 8, apoptosis-related cysteine peptidase 1 1
MIRT205050 CREB1 cAMP responsive element binding protein 1 1 1
MIRT205284 STK11IP serine/threonine kinase 11 interacting protein 1 1
MIRT206196 RAB10 RAB10, member RAS oncogene family 1 2
MIRT208978 SKIL SKI-like oncogene 1 5
MIRT213206 REST RE1-silencing transcription factor 1 1
MIRT213324 KIAA0232 KIAA0232 1 1
MIRT216427 SERF1A small EDRK-rich factor 1A (telomeric) 1 1
MIRT216452 SERF1B small EDRK-rich factor 1B (centromeric) 1 1
MIRT216664 F2R coagulation factor II (thrombin) receptor 1 1
MIRT220123 CAV1 caveolin 1, caveolae protein, 22kDa 1 1
MIRT222676 EIF4H eukaryotic translation initiation factor 4H 1 3
MIRT224753 DPYSL2 dihydropyrimidinase-like 2 1 1
MIRT224888 MAK16 MAK16 homolog (S. cerevisiae) 1 1
MIRT227329 TRIM32 tripartite motif containing 32 1 1
MIRT230969 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT238178 ANKRD33B ankyrin repeat domain 33B 1 5
MIRT241296 ZC3H12C zinc finger CCCH-type containing 12C 1 4
MIRT242200 TTC9 tetratricopeptide repeat domain 9 1 2
MIRT242661 SALL3 sal-like 3 (Drosophila) 1 2
MIRT243782 AFF1 AF4/FMR2 family, member 1 1 1
MIRT244592 HOOK3 hook homolog 3 (Drosophila) 1 1
MIRT246964 TSKU tsukushi small leucine rich proteoglycan homolog (Xenopus laevis) 1 1
MIRT247082 CEP57 centrosomal protein 57kDa 1 1
MIRT248853 SESN2 sestrin 2 1 1
MIRT250448 NFATC2IP nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein 1 1
MIRT254254 TRAPPC10 trafficking protein particle complex 10 1 1
MIRT257283 FOXC1 forkhead box C1 1 1
MIRT266053 FJX1 four jointed box 1 (Drosophila) 1 2
MIRT266856 SLC25A44 solute carrier family 25, member 44 1 1
MIRT280210 EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa 1 1
MIRT280993 SPRED1 sprouty-related, EVH1 domain containing 1 1 1
MIRT283178 C16ORF52 chromosome 16 open reading frame 52 1 1
MIRT286951 SOCS7 suppressor of cytokine signaling 7 1 1
MIRT289577 KDM6B lysine (K)-specific demethylase 6B 1 1
MIRT291934 TPM4 tropomyosin 4 1 1
MIRT293649 PVR poliovirus receptor 1 2
MIRT296871 REV1 REV1, polymerase (DNA directed) 1 1
MIRT299341 CYBRD1 cytochrome b reductase 1 1 1
MIRT302439 CLIP4 CAP-GLY domain containing linker protein family, member 4 1 1
MIRT322526 HMBOX1 homeobox containing 1 1 1
MIRT325514 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT363927 UBE2V2 ubiquitin-conjugating enzyme E2 variant 2 1 1
MIRT368885 BCL2L2 BCL2-like 2 1 1
MIRT397687 ATXN7L3B ataxin 7-like 3B 1 1
MIRT400049 ADRBK2 adrenergic, beta, receptor kinase 2 1 1
MIRT437468 RUNX3 runt-related transcription factor 3 4 2
MIRT438153 MMP2 matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase) 1 1
MIRT438678 MFN2 mitofusin 2 3 1
MIRT438787 FAS Fas (TNF receptor superfamily, member 6) 1 1
MIRT438793 TP53 tumor protein p53 1 1
MIRT438802 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 1 1
MIRT439176 ZNFX1 zinc finger, NFX1-type containing 1 1 3
MIRT439180 ZNF800 zinc finger protein 800 1 1
MIRT439186 ZNF770 zinc finger protein 770 1 1
MIRT439194 ZNF597 zinc finger protein 597 1 1
MIRT439212 ZNF280C zinc finger protein 280C 1 1
MIRT439213 ZNF280B zinc finger protein 280B 1 1
MIRT439224 ZNF12 zinc finger protein 12 1 4
MIRT439255 ZBTB7A zinc finger and BTB domain containing 7A 1 2
MIRT439258 ZBTB6 zinc finger and BTB domain containing 6 1 1
MIRT439271 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 2
MIRT439287 WDR89 WD repeat domain 89 1 1
MIRT439293 WDR1 WD repeat domain 1 1 1
MIRT439297 VTI1A vesicle transport through interaction with t-SNAREs homolog 1A (yeast) 1 1
MIRT439301 VPS13C vacuolar protein sorting 13 homolog C (S. cerevisiae) 1 1
MIRT439307 VDAC1 voltage-dependent anion channel 1 1 1
MIRT439318 UXS1 UDP-glucuronate decarboxylase 1 1 1
MIRT439329 USP32 ubiquitin specific peptidase 32 1 2
MIRT439334 USP28 ubiquitin specific peptidase 28 1 1
MIRT439338 USP16 ubiquitin specific peptidase 16 1 1
MIRT439350 UBR5 ubiquitin protein ligase E3 component n-recognin 5 1 1
MIRT439367 UBC ubiquitin C 1 1
MIRT439371 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 1 1
MIRT439387 TSG101 tumor susceptibility gene 101 1 3
MIRT439400 TOPORS topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase 1 1
MIRT439412 TNFRSF21 tumor necrosis factor receptor superfamily, member 21 1 2
MIRT439415 TMX3 thioredoxin-related transmembrane protein 3 1 1
MIRT439424 TMEM67 transmembrane protein 67 1 1
MIRT439426 TMEM64 transmembrane protein 64 1 2
MIRT439436 TMEM167A transmembrane protein 167A 1 1
MIRT439438 TMEM127 transmembrane protein 127 1 5
MIRT439443 TMEM123 transmembrane protein 123 1 1
MIRT439461 TGOLN2 trans-golgi network protein 2 1 1
MIRT439479 TCF4 transcription factor 4 1 1
MIRT439490 TADA2B transcriptional adaptor 2B 1 1
MIRT439513 STX6 syntaxin 6 1 1
MIRT439522 STK17B serine/threonine kinase 17b 1 1
MIRT439534 SSX2IP synovial sarcoma, X breakpoint 2 interacting protein 1 1
MIRT439539 SSH2 slingshot homolog 2 (Drosophila) 1 1
MIRT439567 SOD2 superoxide dismutase 2, mitochondrial 1 2
MIRT439592 SLK STE20-like kinase 1 1
MIRT439595 SLC4A7 solute carrier family 4, sodium bicarbonate cotransporter, member 7 1 1
MIRT439608 SLC35F5 solute carrier family 35, member F5 1 3
MIRT439621 SLC16A9 solute carrier family 16, member 9 (monocarboxylic acid transporter 9) 1 1
MIRT439634 SIKE1 suppressor of IKBKE 1 1 1
MIRT439645 SGTB small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta 1 2
MIRT439649 PEAK1 NKF3 kinase family member 1 1
MIRT439653 SRSF2 serine/arginine-rich splicing factor 2 1 3
MIRT439681 SENP1 SUMO1/sentrin specific peptidase 1 1 1
MIRT439689 SEC23A Sec23 homolog A (S. cerevisiae) 1 1
MIRT439693 SEC16A SEC16 homolog A (S. cerevisiae) 1 1
MIRT439704 SCAMP2 secretory carrier membrane protein 2 1 2
MIRT439713 SAMD9L sterile alpha motif domain containing 9-like 1 1
MIRT439717 SACS spastic ataxia of Charlevoix-Saguenay (sacsin) 1 1
MIRT439744 RPL17 ribosomal protein L17 1 1
MIRT439745 RPA2 replication protein A2, 32kDa 1 1
MIRT439759 RNF216 ring finger protein 216 1 1
MIRT439777 RFXANK regulatory factor X-associated ankyrin-containing protein 1 1
MIRT439787 REEP5 receptor accessory protein 5 1 1
MIRT439810 RBBP7 retinoblastoma binding protein 7 1 1
MIRT439822 RAN RAN, member RAS oncogene family 1 5
MIRT439831 RABEP1 rabaptin, RAB GTPase binding effector protein 1 1 1
MIRT439838 RAB30 RAB30, member RAS oncogene family 1 1
MIRT439847 RAB11FIP1 RAB11 family interacting protein 1 (class I) 1 3
MIRT439854 PURB purine-rich element binding protein B 1 2
MIRT439864 PTPN4 protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte) 1 5
MIRT439873 PTGES3 prostaglandin E synthase 3 (cytosolic) 1 1
MIRT439876 PTGER4 prostaglandin E receptor 4 (subtype EP4) 1 1
MIRT439906 PPP6C protein phosphatase 6, catalytic subunit 1 1
MIRT439911 PPP3R1 protein phosphatase 3, regulatory subunit B, alpha 1 1
MIRT439917 PPP1R3B protein phosphatase 1, regulatory subunit 3B 1 1
MIRT439935 POLQ polymerase (DNA directed), theta 1 1
MIRT439941 PNPLA4 patatin-like phospholipase domain containing 4 1 1
MIRT439955 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT439958 PKMYT1 protein kinase, membrane associated tyrosine/threonine 1 1 1
MIRT439970 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase, type II, alpha 1 1
MIRT439976 PIGO phosphatidylinositol glycan anchor biosynthesis, class O 1 1
MIRT439982 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT439992 PGM2L1 phosphoglucomutase 2-like 1 1 1
MIRT440008 PDZD11 PDZ domain containing 11 1 1
MIRT440027 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 1 1
MIRT440063 ORMDL3 ORM1-like 3 (S. cerevisiae) 1 1
MIRT440069 NUP98 nucleoporin 98kDa 1 1
MIRT440071 NUP35 nucleoporin 35kDa 1 1
MIRT440095 NR2C2 nuclear receptor subfamily 2, group C, member 2 1 4
MIRT440101 NPAT nuclear protein, ataxia-telangiectasia locus 1 2
MIRT440113 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 1 3
MIRT440137 NCAPD2 non-SMC condensin I complex, subunit D2 1 1
MIRT440146 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT440159 N4BP1 NEDD4 binding protein 1 1 1
MIRT440209 MTF1 metal-regulatory transcription factor 1 1 1
MIRT440227 MLXIP MLX interacting protein 1 1
MIRT440234 MKRN1 makorin ring finger protein 1 1 1
MIRT440236 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 4
MIRT440262 MECP2 methyl CpG binding protein 2 (Rett syndrome) 1 2
MIRT440267 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1
MIRT440279 MAPK1 mitogen-activated protein kinase 1 1 3
MIRT440283 MAP3K2 mitogen-activated protein kinase kinase kinase 2 1 2
MIRT440287 MAP3K14 mitogen-activated protein kinase kinase kinase 14 1 1
MIRT440297 M6PR mannose-6-phosphate receptor (cation dependent) 1 5
MIRT440319 LPGAT1 lysophosphatidylglycerol acyltransferase 1 1 1
MIRT440326 LIMA1 LIM domain and actin binding 1 1 3
MIRT440342 LAPTM4A lysosomal protein transmembrane 4 alpha 1 7
MIRT440347 LAMC1 laminin, gamma 1 (formerly LAMB2) 1 1
MIRT440358 KLHL28 kelch-like 28 (Drosophila) 1 5
MIRT440360 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT440383 KIAA1191 KIAA1191 1 3
MIRT440387 CCSER2 family with sequence similarity 190, member B 1 1
MIRT440390 ATG14 autophagy related 14 1 1
MIRT440418 ITPKB inositol-trisphosphate 3-kinase B 1 1
MIRT440431 IQSEC1 IQ motif and Sec7 domain 1 1 1
MIRT440453 INPP5F inositol polyphosphate-5-phosphatase F 1 1
MIRT440468 IER3 immediate early response 3 1 1
MIRT440507 HIF1AN hypoxia inducible factor 1, alpha subunit inhibitor 1 1
MIRT440508 HAUS8 HAUS augmin-like complex, subunit 8 1 2
MIRT440522 HCP5 HLA complex P5 (non-protein coding) 1 1
MIRT440538 GPAM glycerol-3-phosphate acyltransferase, mitochondrial 1 1
MIRT440545 GOLGA1 golgin A1 1 1
MIRT440558 GNAS GNAS complex locus 1 1
MIRT440562 GLO1 glyoxalase I 1 2
MIRT440575 GIGYF1 GRB10 interacting GYF protein 1 1 5
MIRT440585 GBP3 guanylate binding protein 3 1 1
MIRT440592 GAK cyclin G associated kinase 1 1
MIRT440594 GABPB1 GA binding protein transcription factor, beta subunit 1 1 2
MIRT440596 GABBR1 gamma-aminobutyric acid (GABA) B receptor, 1 1 1
MIRT440603 FYCO1 FYVE and coiled-coil domain containing 1 1 1
MIRT440610 FTSJD1 FtsJ methyltransferase domain containing 1 1 1
MIRT440634 FMNL3 formin-like 3 1 1
MIRT440648 FEM1C fem-1 homolog c (C. elegans) 1 5
MIRT440652 FBXO48 F-box protein 48 1 1
MIRT440656 FBXO31 F-box protein 31 1 1
MIRT440658 FBXO21 F-box protein 21 1 1
MIRT440659 FBXO10 F-box protein 10 1 1
MIRT440663 FBXL5 F-box and leucine-rich repeat protein 5 1 7
MIRT440673 FAM83D family with sequence similarity 83, member D 1 1
MIRT440678 FAM57A family with sequence similarity 57, member A 1 1
MIRT440684 FAM129A family with sequence similarity 129, member A 1 4
MIRT440687 FAM126B family with sequence similarity 126, member B 1 2
MIRT440694 FAM102A family with sequence similarity 102, member A 1 1
MIRT440701 EZH1 enhancer of zeste homolog 1 (Drosophila) 1 1
MIRT440704 ETF1 eukaryotic translation termination factor 1 1 1
MIRT440714 ERAP1 endoplasmic reticulum aminopeptidase 1 1 1
MIRT440721 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT440734 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 1
MIRT440751 EEA1 early endosome antigen 1 1 1
MIRT440757 E2F2 E2F transcription factor 2 1 1
MIRT440760 DYNC1LI2 dynein, cytoplasmic 1, light intermediate chain 2 1 2
MIRT440768 DUSP18 dual specificity phosphatase 18 1 1
MIRT440798 DNAJC27 DnaJ (Hsp40) homolog, subfamily C, member 27 1 1
MIRT440828 DENND5B DENN/MADD domain containing 5B 1 1
MIRT440832 DDX5 DEAD (Asp-Glu-Ala-Asp) box helicase 5 1 1
MIRT440841 DDHD1 DDHD domain containing 1 1 1
MIRT440859 CTSS cathepsin S 1 1
MIRT440874 CRTC3 CREB regulated transcription coactivator 3 1 1
MIRT440877 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 1 2
MIRT440887 CPOX coproporphyrinogen oxidase 1 1
MIRT440942 CIT citron (rho-interacting, serine/threonine kinase 21) 1 1
MIRT440944 CHURC1 churchill domain containing 1 1 1
MIRT440955 CFL2 cofilin 2 (muscle) 1 2
MIRT440956 CEP97 centrosomal protein 97kDa 1 2
MIRT440977 CD47 CD47 molecule 1 1
MIRT440987 CCL1 chemokine (C-C motif) ligand 1 1 1
MIRT441012 CAPRIN2 caprin family member 2 1 3
MIRT441023 CAMK2N2 calcium/calmodulin-dependent protein kinase II inhibitor 2 1 1
MIRT441034 C7orf60 chromosome 7 open reading frame 60 1 1
MIRT441038 C7orf43 chromosome 7 open reading frame 43 1 1
MIRT441045 C5orf28 chromosome 5 open reading frame 28 1 1
MIRT441051 PRR14L proline rich 14-like 1 1
MIRT441056 SUCO SUN domain containing ossification factor 1 3
MIRT441058 C1orf63 chromosome 1 open reading frame 63 1 1
MIRT441075 FAM210A family with sequence similarity 210, member A 1 2
MIRT441081 ELMSAN1 ELM2 and Myb/SANT-like domain containing 1 1 1
MIRT441083 C14orf28 chromosome 14 open reading frame 28 1 1
MIRT441086 METTL21D methyltransferase like 21D 1 1
MIRT441089 C11orf30 chromosome 11 open reading frame 30 1 5
MIRT441098 BTBD7 BTB (POZ) domain containing 7 1 1
MIRT441108 BNIP2 BCL2/adenovirus E1B 19kDa interacting protein 2 1 4
MIRT441128 BAGE5 B melanoma antigen family, member 5 1 1
MIRT441140 ATXN1 ataxin 1 1 2
MIRT441151 ATP2B1 ATPase, Ca++ transporting, plasma membrane 1 1 1
MIRT441161 ATL3 atlastin GTPase 3 1 2
MIRT441165 ATG2B autophagy related 2B 1 1
MIRT441166 ATG2A autophagy related 2A 1 1
MIRT441188 ARL1 ADP-ribosylation factor-like 1 1 1
MIRT441190 ARID4B AT rich interactive domain 4B (RBP1-like) 1 3
MIRT441195 ARHGEF7 Rho guanine nucleotide exchange factor (GEF) 7 1 1
MIRT441203 ARHGAP1 Rho GTPase activating protein 1 1 4
MIRT441204 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT441212 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 1 1
MIRT441225 ANKRD52 ankyrin repeat domain 52 1 2
MIRT441228 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT441236 ALDH9A1 aldehyde dehydrogenase 9 family, member A1 1 1
MIRT441241 AKTIP AKT interacting protein 1 1
MIRT441294 ACBD5 acyl-CoA binding domain containing 5 1 1
MIRT441295 ACAP2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 1 1
MIRT441313 ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1 1 1
MIRT441317 AAK1 AP2 associated kinase 1 1 1
MIRT441882 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT442204 CCDC132 coiled-coil domain containing 132 1 1
MIRT442553 SLCO5A1 solute carrier organic anion transporter family, member 5A1 1 1
MIRT442766 NRIP3 nuclear receptor interacting protein 3 1 1
MIRT442806 CEP170 centrosomal protein 170kDa 1 2
MIRT443260 A1CF APOBEC1 complementation factor 1 1
MIRT443714 LLPH LLP homolog, long-term synaptic facilitation (Aplysia) 1 1
MIRT444313 SREK1IP1 SREK1-interacting protein 1 1 1
MIRT444439 EMC1 ER membrane protein complex subunit 1 1 1
MIRT448316 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT448366 TSR1 TSR1, 20S rRNA accumulation, homolog (S. cerevisiae) 1 3
MIRT448392 TP53INP1 tumor protein p53 inducible nuclear protein 1 1 1
MIRT448647 NPNT nephronectin 1 1
MIRT448676 MARCH4 membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase 1 1
MIRT448730 ITGA2 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) 1 1
MIRT449175 SORCS2 sortilin-related VPS10 domain containing receptor 2 1 1
MIRT450191 TMEM9B TMEM9 domain family, member B 1 1
MIRT450921 CADM2 cell adhesion molecule 2 1 1
MIRT458295 FUT10 fucosyltransferase 10 (alpha (1,3) fucosyltransferase) 1 1
MIRT462128 AKR7A2 aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) 1 1
MIRT463555 ZBTB5 zinc finger and BTB domain containing 5 1 2
MIRT464852 RPS27A ribosomal protein S27a 1 6
MIRT465235 TRIP10 thyroid hormone receptor interactor 10 1 1
MIRT465541 PRICKLE4 prickle homolog 4 (Drosophila) 1 1
MIRT466457 TFAM transcription factor A, mitochondrial 1 4
MIRT467497 SMIM13 chromosome 6 open reading frame 228 1 3
MIRT467900 SLC22A23 solute carrier family 22, member 23 1 1
MIRT468163 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT468187 SGMS1 sphingomyelin synthase 1 1 1
MIRT469858 PXK PX domain containing serine/threonine kinase 1 4
MIRT470056 PTGFRN prostaglandin F2 receptor negative regulator 1 1
MIRT471005 PITPNA phosphatidylinositol transfer protein, alpha 1 1
MIRT472170 NIN ninein (GSK3B interacting protein) 1 2
MIRT472286 NFIB nuclear factor I/B 1 2
MIRT472340 NETO2 neuropilin (NRP) and tolloid (TLL)-like 2 1 2
MIRT473172 MLLT1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 1 1
MIRT474599 KLF6 Kruppel-like factor 6 1 1
MIRT475408 ICMT isoprenylcysteine carboxyl methyltransferase 1 2
MIRT475479 HSPA8 heat shock 70kDa protein 8 1 3
MIRT476124 GPR157 G protein-coupled receptor 157 1 3
MIRT477119 FAM160B1 family with sequence similarity 160, member B1 1 3
MIRT477194 F3 coagulation factor III (thromboplastin, tissue factor) 1 4
MIRT477288 ERGIC2 ERGIC and golgi 2 1 1
MIRT478719 CSNK1A1 casein kinase 1, alpha 1 1 2
MIRT479042 COIL coilin 1 5
MIRT479270 CHSY1 chondroitin sulfate synthase 1 1 1
MIRT480563 BZW1 basic leucine zipper and W2 domains 1 1 1
MIRT480678 BSCL2 Berardinelli-Seip congenital lipodystrophy 2 (seipin) 1 1
MIRT480787 BMP2 bone morphogenetic protein 2 1 1
MIRT480955 BBX bobby sox homolog (Drosophila) 1 4
MIRT481889 ANKRD50 ankyrin repeat domain 50 1 1
MIRT482480 ADAR adenosine deaminase, RNA-specific 1 2
MIRT484872 ZNF70 zinc finger protein 70 1 2
MIRT484886 ZNF652 zinc finger protein 652 1 1
MIRT484923 ZFYVE26 zinc finger, FYVE domain containing 26 1 2
MIRT485102 SLC30A1 solute carrier family 30 (zinc transporter), member 1 1 2
MIRT485195 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 2
MIRT485336 MYO1D myosin ID 1 1
MIRT485370 MYLIP myosin regulatory light chain interacting protein 1 6
MIRT485583 FOXQ1 forkhead box Q1 1 1
MIRT486031 LPAR2 lysophosphatidic acid receptor 2 1 1
MIRT486759 CNOT4 CCR4-NOT transcription complex, subunit 4 1 3
MIRT489609 ZDHHC20 zinc finger, DHHC-type containing 20 1 5
MIRT491662 PDRG1 p53 and DNA-damage regulated 1 1 5
MIRT491809 ZFYVE21 zinc finger, FYVE domain containing 21 1 4
MIRT492013 UGCG UDP-glucose ceramide glucosyltransferase 1 1
MIRT492376 SEMA7A semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group) 1 1
MIRT492783 PDGFB platelet-derived growth factor beta polypeptide 1 1
MIRT494079 DUSP2 dual specificity phosphatase 2 1 2
MIRT494431 BTG2 BTG family, member 2 1 2
MIRT496066 MORC1 MORC family CW-type zinc finger 1 1 1
MIRT500719 TRIM37 tripartite motif containing 37 1 1
MIRT502007 MAP7 microtubule-associated protein 7 1 4
MIRT502058 LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 1 3
MIRT502406 GATA6 GATA binding protein 6 1 4
MIRT503212 ACER2 alkaline ceramidase 2 1 1
MIRT503563 MDM2 Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse) 1 2
MIRT503612 ZNF780A zinc finger protein 780A 1 1
MIRT503831 TMEM242 transmembrane protein 242 1 2
MIRT503969 ZNF180 zinc finger protein 180 1 3
MIRT504568 ZNF417 zinc finger protein 417 1 3
MIRT504643 MFSD8 major facilitator superfamily domain containing 8 1 3
MIRT505062 ZNF202 zinc finger protein 202 1 3
MIRT505865 POLR1B polymerase (RNA) I polypeptide B, 128kDa 1 2
MIRT506283 PDPK1 3-phosphoinositide dependent protein kinase-1 1 1
MIRT506380 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 3
MIRT506460 NACC2 NACC family member 2, BEN and BTB (POZ) domain containing 1 2
MIRT506545 MORF4L1 mortality factor 4 like 1 1 4
MIRT506624 MARCH6 membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase 1 4
MIRT506689 LZIC leucine zipper and CTNNBIP1 domain containing 1 2
MIRT506872 KIAA1147 KIAA1147 1 1
MIRT506889 KIAA0101 KIAA0101 1 2
MIRT506993 HNRNPR heterogeneous nuclear ribonucleoprotein R 1 1
MIRT507198 FZD9 frizzled family receptor 9 1 3
MIRT507442 ELK4 ELK4, ETS-domain protein (SRF accessory protein 1) 1 2
MIRT507949 BTF3L4 basic transcription factor 3-like 4 1 3
MIRT508578 CEP72 centrosomal protein 72kDa 1 2
MIRT508747 ZNF682 zinc finger protein 682 1 2
MIRT508839 GPR155 G protein-coupled receptor 155 1 1
MIRT509132 BMP8B bone morphogenetic protein 8b 1 3
MIRT509747 EFCAB11 EF-hand calcium binding domain 11 1 2
MIRT510031 CRISPLD2 cysteine-rich secretory protein LCCL domain containing 2 1 2
MIRT511265 KLHL36 kelch-like 36 (Drosophila) 1 3
MIRT511322 KIAA1551 KIAA1551 1 1
MIRT511558 HMGB1 high mobility group box 1 1 3
MIRT512324 ACTR2 ARP2 actin-related protein 2 homolog (yeast) 1 3
MIRT513469 NARS asparaginyl-tRNA synthetase 1 3
MIRT513706 RBM20 RNA binding motif protein 20 1 2
MIRT513754 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT514103 EPS15L1 epidermal growth factor receptor pathway substrate 15-like 1 1 3
MIRT514139 SERF2 small EDRK-rich factor 2 1 1
MIRT514321 FXYD5 FXYD domain containing ion transport regulator 5 1 3
MIRT515000 DNTTIP2 deoxynucleotidyltransferase, terminal, interacting protein 2 1 1
MIRT515207 CRCP CGRP receptor component 1 1
MIRT515577 TMEM134 transmembrane protein 134 1 1
MIRT516062 MED18 mediator complex subunit 18 1 1
MIRT516561 MIXL1 Mix paired-like homeobox 1 1
MIRT516801 PTRF polymerase I and transcript release factor 1 2
MIRT517023 COX19 cytochrome c oxidase assembly homolog 19 (S. cerevisiae) 1 1
MIRT517189 SLC28A1 solute carrier family 28 (sodium-coupled nucleoside transporter), member 1 1 1
MIRT517262 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 2
MIRT518319 ZNF514 zinc finger protein 514 1 2
MIRT518470 KIF6 kinesin family member 6 1 1
MIRT518701 KCNMB1 potassium large conductance calcium-activated channel, subfamily M, beta member 1 1 1
MIRT518806 MED16 mediator complex subunit 16 1 2
MIRT518865 NEK8 NIMA (never in mitosis gene a)- related kinase 8 1 1
MIRT518974 GRK7 G protein-coupled receptor kinase 7 1 1
MIRT519434 KCNA7 potassium voltage-gated channel, shaker-related subfamily, member 7 1 2
MIRT519550 TMEM38A transmembrane protein 38A 1 1
MIRT520084 YIPF4 Yip1 domain family, member 4 1 1
MIRT520158 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT521012 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT521307 RRAGD Ras-related GTP binding D 1 2
MIRT521551 QSOX1 quiescin Q6 sulfhydryl oxidase 1 1 2
MIRT522174 NR2F6 nuclear receptor subfamily 2, group F, member 6 1 2
MIRT522508 MFN1 mitofusin 1 1 1
MIRT523085 HYPK huntingtin interacting protein K 1 1
MIRT523656 FOXK1 forkhead box K1 1 2
MIRT524085 DNAJC10 DnaJ (Hsp40) homolog, subfamily C, member 10 1 1
MIRT524253 DCTN6 dynactin 6 1 1
MIRT524297 CYCS cytochrome c, somatic 1 1
MIRT524459 CNKSR3 CNKSR family member 3 1 1
MIRT524986 AGO3 eukaryotic translation initiation factor 2C, 3 1 1
MIRT525206 ZNF93 zinc finger protein 93 1 1
MIRT525490 TPK1 thiamin pyrophosphokinase 1 1 1
MIRT526641 NME6 NME/NM23 nucleoside diphosphate kinase 6 1 1
MIRT527208 XIRP2 xin actin-binding repeat containing 2 1 1
MIRT527261 TMEM196 transmembrane protein 196 1 1
MIRT527476 CLEC12B C-type lectin domain family 12, member B 1 2
MIRT528376 ZMYM1 zinc finger, MYM-type 1 1 2
MIRT530005 TNFAIP8L1 tumor necrosis factor, alpha-induced protein 8-like 1 1 2
MIRT530593 ABHD15 abhydrolase domain containing 15 1 1
MIRT530991 EXO5 exonuclease 5 1 2
MIRT531481 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 1 2
MIRT531781 TXK TXK tyrosine kinase 1 2
MIRT531841 MTPAP mitochondrial poly(A) polymerase 1 2
MIRT532055 FHDC1 FH2 domain containing 1 1 1
MIRT532620 SPTLC2 serine palmitoyltransferase, long chain base subunit 2 1 1
MIRT532926 ZNF385A zinc finger protein 385A 1 1
MIRT533883 TBL1XR1 transducin (beta)-like 1 X-linked receptor 1 1 1
MIRT534009 SUV420H1 suppressor of variegation 4-20 homolog 1 (Drosophila) 1 1
MIRT534571 RPS6KA5 ribosomal protein S6 kinase, 90kDa, polypeptide 5 1 2
MIRT534633 RNASEH1 ribonuclease H1 1 2
MIRT535035 PRKAR1A protein kinase, cAMP-dependent, regulatory, type I, alpha 1 1
MIRT536448 KMT2B myeloid/lymphoid or mixed-lineage leukemia 4 1 3
MIRT536501 KIAA0922 KIAA0922 1 1
MIRT536544 KCNJ8 potassium inwardly-rectifying channel, subfamily J, member 8 1 1
MIRT537452 FBXL7 F-box and leucine-rich repeat protein 7 1 1
MIRT537743 ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 1 1
MIRT539429 ADAT2 adenosine deaminase, tRNA-specific 2 1 1
MIRT540280 FAM89A family with sequence similarity 89, member A 1 1
MIRT541091 RLIM ring finger protein, LIM domain interacting 1 1
MIRT542065 SLC25A46 solute carrier family 25, member 46 1 1
MIRT542147 DIS3L DIS3 mitotic control homolog (S. cerevisiae)-like 1 1
MIRT542273 HSPA4L heat shock 70kDa protein 4-like 1 1
MIRT543190 FICD FIC domain containing 1 1
MIRT543585 RPF2 ribosome production factor 2 homolog (S. cerevisiae) 1 2
MIRT544634 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT545208 HIST1H2BD histone cluster 1, H2bd 1 1
MIRT546296 TMEM200C transmembrane protein 200C 1 2
MIRT546828 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT547087 PLRG1 pleiotropic regulator 1 1 1
MIRT548322 EPHA4 EPH receptor A4 1 1
MIRT548399 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 1 2
MIRT548471 EGLN3 egl nine homolog 3 (C. elegans) 1 1
MIRT548824 CLIC4 chloride intracellular channel 4 1 2
MIRT548870 CERCAM cerebral endothelial cell adhesion molecule 1 1
MIRT549116 C16orf70 chromosome 16 open reading frame 70 1 2
MIRT549828 LUZP2 leucine zipper protein 2 1 1
MIRT550099 TRAPPC2 trafficking protein particle complex 2 1 1
MIRT550310 ZNF681 zinc finger protein 681 1 1
MIRT551129 ZNF107 zinc finger protein 107 1 1
MIRT551750 FMNL2 formin-like 2 1 1
MIRT552210 F2RL3 coagulation factor II (thrombin) receptor-like 3 1 1
MIRT552691 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 2
MIRT552863 WIPF2 WAS/WASL interacting protein family, member 2 1 1
MIRT552900 WASL Wiskott-Aldrich syndrome-like 1 2
MIRT553041 USP48 ubiquitin specific peptidase 48 1 1
MIRT553574 TMEM100 transmembrane protein 100 1 1
MIRT553704 TCF7L2 transcription factor 7-like 2 (T-cell specific, HMG-box) 1 1
MIRT554418 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT554482 SAMD12 sterile alpha motif domain containing 12 1 1
MIRT554537 RUFY2 RUN and FYVE domain containing 2 1 1
MIRT554560 RRN3 RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae) 1 1
MIRT554756 RHOC ras homolog family member C 1 1
MIRT555470 POLR3A polymerase (RNA) III (DNA directed) polypeptide A, 155kDa 1 1
MIRT556190 MCC mutated in colorectal cancers 1 1
MIRT556598 LEPROT leptin receptor overlapping transcript 1 1
MIRT556910 ISOC1 isochorismatase domain containing 1 1 1
MIRT557032 HOXD11 homeobox D11 1 1
MIRT557598 GNPTAB N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits 1 1
MIRT557763 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT557889 FEM1B fem-1 homolog b (C. elegans) 1 2
MIRT558338 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 2
MIRT558941 CBX1 chromobox homolog 1 1 1
MIRT559446 ARSJ arylsulfatase family, member J 1 1
MIRT561249 ZNF354B zinc finger protein 354B 1 1
MIRT562221 HMGB2 high mobility group box 2 1 1
MIRT562568 CCDC71L coiled-coil domain containing 71-like 1 2
MIRT562971 LRPAP1 low density lipoprotein receptor-related protein associated protein 1 1 1
MIRT563385 DSPP dentin sialophosphoprotein 1 1
MIRT564689 ZNF35 zinc finger protein 35 1 1
MIRT565700 SESN3 sestrin 3 1 1
MIRT566151 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT566576 OTUD4 OTU domain containing 4 1 1
MIRT566884 LRP12 low density lipoprotein receptor-related protein 12 1 1
MIRT567058 KCNB1 potassium voltage-gated channel, Shab-related subfamily, member 1 1 1
MIRT567119 ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) 1 1
MIRT567549 FGFR1OP FGFR1 oncogene partner 1 1
MIRT567691 EIF4A2 eukaryotic translation initiation factor 4A2 1 1
MIRT567855 DCAF8 DDB1 and CUL4 associated factor 8 1 1
MIRT567998 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT568186 CCDC6 coiled-coil domain containing 6 1 1
MIRT568276 BICD2 bicaudal D homolog 2 (Drosophila) 1 1
MIRT571021 CKAP2 cytoskeleton associated protein 2 1 1
MIRT571684 RRAS2 related RAS viral (r-ras) oncogene homolog 2 1 1
MIRT571700 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT571730 RPL17-C18orf32 RPL17-C18orf32 readthrough 1 1
MIRT571864 NKIRAS1 NFKB inhibitor interacting Ras-like 1 1 1
MIRT572215 C18orf32 chromosome 18 open reading frame 32 1 1
MIRT572682 AGMAT agmatine ureohydrolase (agmatinase) 1 2
MIRT573922 SNAP47 synaptosomal-associated protein, 47kDa 1 1
MIRT575220 Piwil2 piwi-like homolog 2 (Drosophila) 1 1
MIRT575995 Fem1a feminization 1 homolog a (C. elegans) 1 1
MIRT608374 PIWIL2 piwi-like 2 (Drosophila) 1 3
MIRT608754 MYH9 myosin, heavy chain 9, non-muscle 1 1
MIRT608980 PRKCB protein kinase C, beta 1 1
MIRT611005 BRI3BP BRI3 binding protein 1 2
MIRT611842 FEM1A fem-1 homolog a (C. elegans) 1 2
MIRT612617 RANGAP1 Ran GTPase activating protein 1 1 1
MIRT614269 WDR53 WD repeat domain 53 1 2
MIRT615182 SPIB Spi-B transcription factor (Spi-1/PU.1 related) 1 1
MIRT615453 FAXC failed axon connections homolog (Drosophila) 1 1
MIRT616178 TCEB1 transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) 1 1
MIRT619847 POLM polymerase (DNA directed), mu 1 2
MIRT620983 TM4SF5 transmembrane 4 L six family member 5 1 1
MIRT624427 CBX8 chromobox homolog 8 1 1
MIRT625085 C15orf41 chromosome 15 open reading frame 41 1 1
MIRT626044 ATAT1 alpha tubulin acetyltransferase 1 1 2
MIRT626227 PNRC1 proline-rich nuclear receptor coactivator 1 1 2
MIRT626936 HIST1H2BG histone cluster 1, H2bg 1 1
MIRT628571 MELK maternal embryonic leucine zipper kinase 1 1
MIRT633128 CBX5 chromobox homolog 5 1 1
MIRT634104 APOH apolipoprotein H (beta-2-glycoprotein I) 1 1
MIRT634461 PAK6 p21 protein (Cdc42/Rac)-activated kinase 6 1 1
MIRT634652 HIP1 huntingtin interacting protein 1 1 1
MIRT634961 GTF2H2C general transcription factor IIH, polypeptide 2C 1 2
MIRT641712 SPCS1 signal peptidase complex subunit 1 homolog (S. cerevisiae) 1 1
MIRT645221 POLR3F polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa 1 1
MIRT662413 ICA1L islet cell autoantigen 1,69kDa-like 1 2
MIRT664234 LSM3 LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) 1 1
MIRT664400 CYB5A cytochrome b5 type A (microsomal) 1 1
MIRT664800 LIAS lipoic acid synthetase 1 2
MIRT673140 MFSD2A major facilitator superfamily domain containing 2A 1 1
MIRT675845 DHODH dihydroorotate dehydrogenase (quinone) 1 2
MIRT677161 DEGS1 delta(4)-desaturase, sphingolipid 1 1 1
MIRT677267 C15orf40 chromosome 15 open reading frame 40 1 1
MIRT678754 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT680380 GATAD1 GATA zinc finger domain containing 1 1 2
MIRT680707 ZNF785 zinc finger protein 785 1 1
MIRT680785 WDR73 WD repeat domain 73 1 1
MIRT681417 RMND1 required for meiotic nuclear division 1 homolog (S. cerevisiae) 1 1
MIRT681710 ABI2 abl-interactor 2 1 1
MIRT681847 N4BP2L2 NEDD4 binding protein 2-like 2 1 1
MIRT682338 RAB42 RAB42, member RAS oncogene family 1 1
MIRT683336 C19orf40 chromosome 19 open reading frame 40 1 1
MIRT683406 ESR2 estrogen receptor 2 (ER beta) 1 1
MIRT683510 ZNF7 zinc finger protein 7 1 1
MIRT683542 C11orf54 chromosome 11 open reading frame 54 1 1
MIRT683893 OCIAD1 OCIA domain containing 1 1 1
MIRT683966 MYLK3 myosin light chain kinase 3 1 1
MIRT683995 QRFPR pyroglutamylated RFamide peptide receptor 1 1
MIRT684098 TLR7 toll-like receptor 7 1 1
MIRT684151 CEP104 centrosomal protein 104kDa 1 1
MIRT684376 BCAS4 breast carcinoma amplified sequence 4 1 1
MIRT684592 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT684635 GTF2IRD2B GTF2I repeat domain containing 2B 1 1
MIRT684666 PDE4C phosphodiesterase 4C, cAMP-specific 1 1
MIRT684731 LRRD1 leucine-rich repeats and death domain containing 1 1 1
MIRT684760 DNAJB13 DnaJ (Hsp40) homolog, subfamily B, member 13 1 1
MIRT684805 MYO1F myosin IF 1 1
MIRT684937 CD28 CD28 molecule 1 1
MIRT685213 DCTN5 dynactin 5 (p25) 1 1
MIRT685266 F2RL1 coagulation factor II (thrombin) receptor-like 1 1 1
MIRT685334 ASB16 ankyrin repeat and SOCS box containing 16 1 1
MIRT685369 CCL5 chemokine (C-C motif) ligand 5 1 1
MIRT685537 MSH3 mutS homolog 3 (E. coli) 1 1
MIRT685596 KCNK6 potassium channel, subfamily K, member 6 1 1
MIRT685727 BHMT2 betaine--homocysteine S-methyltransferase 2 1 1
MIRT685760 C12orf65 chromosome 12 open reading frame 65 1 1
MIRT685801 ZNF426 zinc finger protein 426 1 1
MIRT685900 RTN2 reticulon 2 1 1
MIRT685973 PTGIS prostaglandin I2 (prostacyclin) synthase 1 1
MIRT686124 TNIP3 TNFAIP3 interacting protein 3 1 1
MIRT686174 HS3ST1 heparan sulfate (glucosamine) 3-O-sulfotransferase 1 1 1
MIRT686301 WWC1 WW and C2 domain containing 1 1 1
MIRT686339 VPS53 vacuolar protein sorting 53 homolog (S. cerevisiae) 1 1
MIRT686462 LINC00598 long intergenic non-protein coding RNA 598 1 1
MIRT686507 TRIOBP TRIO and F-actin binding protein 1 1
MIRT686545 TRAF3IP2 TRAF3 interacting protein 2 1 1
MIRT686600 TMOD3 tropomodulin 3 (ubiquitous) 1 1
MIRT686845 SLC7A11 solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11 1 1
MIRT686898 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT686998 SERINC1 serine incorporator 1 1 1
MIRT687062 RNF115 ring finger protein 115 1 1
MIRT687097 RABGAP1L RAB GTPase activating protein 1-like 1 1
MIRT687272 PDHB pyruvate dehydrogenase (lipoamide) beta 1 1
MIRT687613 MANEAL mannosidase, endo-alpha-like 1 1
MIRT687668 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT687876 ISCA2 iron-sulfur cluster assembly 2 homolog (S. cerevisiae) 1 1
MIRT688001 GTF2IRD2 GTF2I repeat domain containing 2 1 1
MIRT688141 GEMIN8 gem (nuclear organelle) associated protein 8 1 1
MIRT688235 FKBP14 FK506 binding protein 14, 22 kDa 1 1
MIRT688293 FAM213A family with sequence similarity 213, member A 1 1
MIRT688475 DNAJB4 DnaJ (Hsp40) homolog, subfamily B, member 4 1 1
MIRT688524 DDI2 DNA-damage inducible 1 homolog 2 (S. cerevisiae) 1 1
MIRT688684 CPT1A carnitine palmitoyltransferase 1A (liver) 1 1
MIRT688717 CPS1 carbamoyl-phosphate synthase 1, mitochondrial 1 1
MIRT688848 CAPZA2 capping protein (actin filament) muscle Z-line, alpha 2 1 1
MIRT689130 ZBTB25 zinc finger and BTB domain containing 25 1 1
MIRT689192 ZNF665 zinc finger protein 665 1 1
MIRT689817 GTF2H3 general transcription factor IIH, polypeptide 3, 34kDa 1 1
MIRT689862 HIST1H2BJ histone cluster 1, H2bj 1 1
MIRT690757 IRAK4 interleukin-1 receptor-associated kinase 4 1 1
MIRT691002 ZNF578 zinc finger protein 578 1 1
MIRT691094 NUGGC nuclear GTPase, germinal center associated 1 1
MIRT691351 KIAA1841 KIAA1841 1 1
MIRT691514 FOXRED2 FAD-dependent oxidoreductase domain containing 2 1 1
MIRT691596 CCDC125 coiled-coil domain containing 125 1 1
MIRT691632 IPP intracisternal A particle-promoted polypeptide 1 1
MIRT692092 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT692129 CXorf38 chromosome X open reading frame 38 1 2
MIRT692338 RFK riboflavin kinase 1 1
MIRT692400 LY6G5B lymphocyte antigen 6 complex, locus G5B 1 1
MIRT692461 METTL8 methyltransferase like 8 1 1
MIRT692564 PARD3 par-3 partitioning defective 3 homolog (C. elegans) 1 1
MIRT692625 GDF5OS growth differentiation factor 5 opposite strand 1 1
MIRT692806 SYNPO2L synaptopodin 2-like 1 1
MIRT692837 C1orf50 chromosome 1 open reading frame 50 1 1
MIRT692899 RBM41 RNA binding motif protein 41 1 1
MIRT693009 LGSN lengsin, lens protein with glutamine synthetase domain 1 1
MIRT693159 THEM4 thioesterase superfamily member 4 1 1
MIRT693370 RNF34 ring finger protein 34, E3 ubiquitin protein ligase 1 1
MIRT694131 ZNF446 zinc finger protein 446 1 1
MIRT694215 ZNF347 zinc finger protein 347 1 1
MIRT694681 C14orf119 chromosome 14 open reading frame 119 1 1
MIRT694835 STX4 syntaxin 4 1 1
MIRT694957 ANKS4B ankyrin repeat and sterile alpha motif domain containing 4B 1 1
MIRT695201 SLC25A33 solute carrier family 25 (pyrimidine nucleotide carrier), member 33 1 1
MIRT695683 MAN2B2 mannosidase, alpha, class 2B, member 2 1 1
MIRT695854 ABCG8 ATP-binding cassette, sub-family G (WHITE), member 8 1 1
MIRT695946 ZNF174 zinc finger protein 174 1 1
MIRT696204 GNB5 guanine nucleotide binding protein (G protein), beta 5 1 1
MIRT696465 SUGP1 SURP and G patch domain containing 1 1 1
MIRT696881 UBOX5 U-box domain containing 5 1 1
MIRT696928 C14orf105 chromosome 14 open reading frame 105 1 1
MIRT697267 ZYG11A zyg-11 homolog A (C. elegans) 1 1
MIRT697412 ZMAT3 zinc finger, matrin-type 3 1 1
MIRT698006 TSPAN6 tetraspanin 6 1 1
MIRT699292 SLC6A4 solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 1 1
MIRT699652 SH3BP5 SH3-domain binding protein 5 (BTK-associated) 1 1
MIRT699717 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT700066 RPL14 ribosomal protein L14 1 1
MIRT700124 RNF19B ring finger protein 19B 1 1
MIRT701132 PAPD5 PAP associated domain containing 5 1 1
MIRT701316 NUDT3 nudix (nucleoside diphosphate linked moiety X)-type motif 3 1 1
MIRT701598 MYPN myopalladin 1 1
MIRT702395 KLF10 Kruppel-like factor 10 1 1
MIRT702547 KCND3 potassium voltage-gated channel, Shal-related subfamily, member 3 1 1
MIRT703113 GPRIN3 GPRIN family member 3 1 1
MIRT704132 DRAXIN dorsal inhibitory axon guidance protein 1 1
MIRT704163 DNAL1 dynein, axonemal, light chain 1 1 1
MIRT704219 LDHD lactate dehydrogenase D 1 1
MIRT704785 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT705106 C4orf29 chromosome 4 open reading frame 29 1 1
MIRT705371 ATP1B3 ATPase, Na+/K+ transporting, beta 3 polypeptide 1 1
MIRT706126 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT706297 SLC35F6 chromosome 2 open reading frame 18 1 1
MIRT706333 CCDC30 coiled-coil domain containing 30 1 1
MIRT706373 STAC2 SH3 and cysteine rich domain 2 1 1
MIRT706425 HAS2 hyaluronan synthase 2 1 1
MIRT706536 MTMR9 myotubularin related protein 9 1 1
MIRT707610 PCNXL2 pecanex-like 2 (Drosophila) 1 1
MIRT707839 TMEM133 transmembrane protein 133 1 1
MIRT708392 CDIPT CDP-diacylglycerol--inositol 3-phosphatidyltransferase 1 1
MIRT708471 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 1 1
MIRT709094 FAHD1 fumarylacetoacetate hydrolase domain containing 1 1 1
MIRT709559 ZBED1 zinc finger, BED-type containing 1 1 1
MIRT710427 YTHDC1 YTH domain containing 1 1 1
MIRT711791 RFXAP regulatory factor X-associated protein 1 1
MIRT713356 KLRD1 killer cell lectin-like receptor subfamily D, member 1 1 1
MIRT714328 ZNF454 zinc finger protein 454 1 1
MIRT716562 GOLGA2 golgin A2 1 1
MIRT719093 ACOX1 acyl-CoA oxidase 1, palmitoyl 1 1
MIRT725229 PEA15 phosphoprotein enriched in astrocytes 15 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*