Accession ID: MIRT044670 [miRNA, hsa-miR-320a :: MIF, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-320aLinkOut: [miRBase ]
Description Homo sapiens miR-320a stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-320a
Mature Sequence 48| AAAAGCUGGGUUGAGAGGGCGA |69
Evidence Experimental
Experiments Cloned
Putative hsa-miR-320a Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MIF LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms GIF, GLIF, MMIF
Description macrophage migration inhibitory factor (glycosylation-inhibiting factor)
Transcript NM_0024    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MIF LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MIF
(miRNA target sites are highlighted)
>MIF|NM_0024|3'UTR
   1 TAAGAGCCGCAGGGACCCACGCTGTCTGCGCTGGCTCCACCCGGGAACCCGCCGCACGCTGTGTTCTAGGCCCGCCCACC
  81 CCAACCTTCTGGTGGGGAGAAATAAACGGTTTAGAGACT
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' agCGGGAGAGUUGGGUCGAAAa 5'
            |||| | || |||| | || 
Target 5' agGCCCGCCCACCCCAACCTTc 3'
68 - 89 112.00 -15.39
2
miRNA  3' agcgggagagUUGGGU-CGAAAa 5'
                    :||||| ||| | 
Target 5' gagccgcaggGACCCACGCTGTc 3'
4 - 26 92.00 -12.22
3
miRNA  3' agcgggagAGUUGGGUCGAAaa 5'
                  | ||  |:|:||  
Target 5' gggagaaaTAAA--CGGTTTag 3'
95 - 114 90.00 -6.50
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-320a :: MIF    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
482 hsa-miR-320a Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001963 Polr3d polymerase (RNA) III (DNA directed) polypeptide D 1 1
MIRT001964 POLR3D polymerase (RNA) III (DNA directed) polypeptide D, 44kDa 2 1
MIRT003003 TAC1 tachykinin, precursor 1 2 1
MIRT003744 TFRC transferrin receptor (p90, CD71) 2 4
MIRT004440 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 2 2
MIRT004508 HSPB6 heat shock protein, alpha-crystallin-related, B6 2 1
MIRT006497 AQP1 aquaporin 1 (Colton blood group) 1 1
MIRT006498 AQP4 aquaporin 4 1 1
MIRT006575 NPR1 natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A) 2 1
MIRT007093 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT044386 SYF2 SYF2 homolog, RNA splicing factor (S. cerevisiae) 1 1
MIRT044387 DIRC2 disrupted in renal carcinoma 2 1 1
MIRT044388 ZFP37 zinc finger protein 37 homolog (mouse) 1 1
MIRT044389 PRDX6 peroxiredoxin 6 1 1
MIRT044390 MED23 mediator complex subunit 23 1 1
MIRT044391 PPP4C protein phosphatase 4, catalytic subunit 1 1
MIRT044392 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT044393 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 1 1
MIRT044394 CDS2 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 1 1
MIRT044395 ARF3 ADP-ribosylation factor 3 1 1
MIRT044396 TMEM101 transmembrane protein 101 1 1
MIRT044397 RPL30 ribosomal protein L30 1 1
MIRT044398 C20orf27 chromosome 20 open reading frame 27 1 1
MIRT044399 HIST1H2BL histone cluster 1, H2bl 1 1
MIRT044400 ATPAF2 ATP synthase mitochondrial F1 complex assembly factor 2 1 1
MIRT044401 CTNNAL1 catenin (cadherin-associated protein), alpha-like 1 1 1
MIRT044402 PANK3 pantothenate kinase 3 1 1
MIRT044403 PPIA peptidylprolyl isomerase A (cyclophilin A) 1 1
MIRT044404 IGF2BP3 insulin-like growth factor 2 mRNA binding protein 3 1 1
MIRT044405 NUDT21 nudix (nucleoside diphosphate linked moiety X)-type motif 21 1 1
MIRT044406 EPHA4 EPH receptor A4 1 1
MIRT044407 VKORC1 vitamin K epoxide reductase complex, subunit 1 1 1
MIRT044408 GTF3C4 general transcription factor IIIC, polypeptide 4, 90kDa 1 1
MIRT044409 TSC22D2 TSC22 domain family, member 2 1 1
MIRT044410 ZNF600 zinc finger protein 600 1 1
MIRT044411 TMEM64 transmembrane protein 64 1 1
MIRT044412 NANOG Nanog homeobox 1 1
MIRT044413 ZNF155 zinc finger protein 155 1 1
MIRT044414 ANKHD1 ankyrin repeat and KH domain containing 1 1 1
MIRT044415 TOP3A topoisomerase (DNA) III alpha 1 1
MIRT044416 DTX3 deltex homolog 3 (Drosophila) 1 1
MIRT044417 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT044418 HIST1H2BH histone cluster 1, H2bh 1 1
MIRT044419 HIST1H1A histone cluster 1, H1a 1 1
MIRT044420 ECH1 enoyl CoA hydratase 1, peroxisomal 1 1
MIRT044421 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT044422 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT044423 GGA1 golgi-associated, gamma adaptin ear containing, ARF binding protein 1 1 1
MIRT044424 DVL3 dishevelled, dsh homolog 3 (Drosophila) 1 1
MIRT044425 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT044426 CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) 1 1
MIRT044427 PTTG1 pituitary tumor-transforming 1 1 1
MIRT044428 ZEB2 zinc finger E-box binding homeobox 2 1 1
MIRT044429 CBX5 chromobox homolog 5 (HP1 alpha homolog, Drosophila) 1 1
MIRT044430 PRR12 proline rich 12 1 1
MIRT044431 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT044432 ORC1 origin recognition complex, subunit 1-like (yeast) 1 1
MIRT044433 HES6 hairy and enhancer of split 6 (Drosophila) 1 1
MIRT044434 RPS4X ribosomal protein S4, X-linked 1 1
MIRT044435 RANBP6 RAN binding protein 6 1 1
MIRT044436 FMO1 flavin containing monooxygenase 1 1 1
MIRT044437 TEAD1 TEA domain family member 1 (SV40 transcriptional enhancer factor) 1 1
MIRT044438 TCP1 t-complex 1 1 1
MIRT044439 CDK4 cyclin-dependent kinase 4 1 1
MIRT044440 ARHGEF2 Rho/Rac guanine nucleotide exchange factor (GEF) 2 1 1
MIRT044441 PIGP phosphatidylinositol glycan anchor biosynthesis, class P 1 1
MIRT044442 RPL7A ribosomal protein L7a 1 1
MIRT044443 UBAP2 ubiquitin associated protein 2 1 1
MIRT044444 MARCH4 membrane-associated ring finger (C3HC4) 4 1 1
MIRT044445 YRDC yrdC domain containing (E. coli) 1 1
MIRT044446 RPL13A ribosomal protein L13a 1 1
MIRT044447 MYO5C myosin VC 1 1
MIRT044448 LONP2 lon peptidase 2, peroxisomal 1 1
MIRT044449 GPN1 GPN-loop GTPase 1 1 1
MIRT044450 SMC1A structural maintenance of chromosomes 1A 1 1
MIRT044451 DCLRE1B DNA cross-link repair 1B (PSO2 homolog, S. cerevisiae) 1 1
MIRT044452 ND4 NADH dehydrogenase, subunit 4 (complex I) 1 1
MIRT044453 DUSP8 dual specificity phosphatase 8 1 1
MIRT044454 PRDX3 peroxiredoxin 3 1 1
MIRT044455 IMP4 IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) 1 1
MIRT044456 ARL9 ADP-ribosylation factor-like 9 1 1
MIRT044457 CCNI cyclin I 1 1
MIRT044458 RNF103 ring finger protein 103 1 1
MIRT044459 GHSR growth hormone secretagogue receptor 1 1
MIRT044460 HSPA9 heat shock 70kDa protein 9 (mortalin) 1 1
MIRT044461 ANKRD52 ankyrin repeat domain 52 1 1
MIRT044462 CYLD cylindromatosis (turban tumor syndrome) 1 1
MIRT044463 SAMD4B sterile alpha motif domain containing 4B 1 1
MIRT044464 DCP2 DCP2 decapping enzyme homolog (S. cerevisiae) 1 1
MIRT044465 H2AFX H2A histone family, member X 1 1
MIRT044466 EIF3F eukaryotic translation initiation factor 3, subunit F 1 1
MIRT044467 SEC14L1 SEC14-like 1 (S. cerevisiae) 1 1
MIRT044468 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT044469 DHRSX dehydrogenase/reductase (SDR family) X-linked 1 1
MIRT044470 PAPOLA poly(A) polymerase alpha 1 1
MIRT044471 BRD4 bromodomain containing 4 1 1
MIRT044472 TCF3 transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47) 1 1
MIRT044473 ZNF282 zinc finger protein 282 1 1
MIRT044474 ZNF496 zinc finger protein 496 1 1
MIRT044475 UBE2G1 ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, yeast) 1 1
MIRT044476 FAM60A family with sequence similarity 60, member A 1 1
MIRT044477 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT044478 GNAS GNAS complex locus 1 1
MIRT044479 NT5C3A 5'-nucleotidase, cytosolic III 1 1
MIRT044480 ANP32A acidic (leucine-rich) nuclear phosphoprotein 32 family, member A 1 1
MIRT044481 MEOX2 mesenchyme homeobox 2 1 1
MIRT044482 TFAP2A transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) 1 1
MIRT044483 WARS tryptophanyl-tRNA synthetase 1 1
MIRT044484 SF1 splicing factor 1 1 1
MIRT044485 SEPT1 septin 1 1 1
MIRT044486 HAUS6 HAUS augmin-like complex, subunit 6 1 1
MIRT044487 TMEM98 transmembrane protein 98 1 1
MIRT044488 CD44 CD44 molecule (Indian blood group) 1 1
MIRT044489 MCM4 minichromosome maintenance complex component 4 1 1
MIRT044490 SLC6A8 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 1 1
MIRT044491 RPL9 ribosomal protein L9 1 1
MIRT044492 USP16 ubiquitin specific peptidase 16 1 1
MIRT044493 EWSR1 Ewing sarcoma breakpoint region 1 1 1
MIRT044494 NT5C 5', 3'-nucleotidase, cytosolic 1 1
MIRT044495 PPIF peptidylprolyl isomerase F 1 1
MIRT044496 KDM5C lysine (K)-specific demethylase 5C 1 1
MIRT044497 PRR14L chromosome 22 open reading frame 30 1 1
MIRT044498 LRCH3 leucine-rich repeats and calponin homology (CH) domain containing 3 1 1
MIRT044499 PRMT5 protein arginine methyltransferase 5 1 1
MIRT044500 PVRL2 poliovirus receptor-related 2 (herpesvirus entry mediator B) 1 1
MIRT044501 ITM2B integral membrane protein 2B 1 1
MIRT044502 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT044503 AXIN1 axin 1 1 1
MIRT044504 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT044505 PTPN9 protein tyrosine phosphatase, non-receptor type 9 1 1
MIRT044506 KMT2C myeloid/lymphoid or mixed-lineage leukemia 3 1 1
MIRT044507 DOK3 docking protein 3 1 1
MIRT044508 MED24 mediator complex subunit 24 1 1
MIRT044509 ZNF710 zinc finger protein 710 1 1
MIRT044510 BYSL bystin-like 1 1
MIRT044511 POM121 POM121 membrane glycoprotein (rat) 1 1
MIRT044512 ZNF462 zinc finger protein 462 1 1
MIRT044513 PTP4A2 protein tyrosine phosphatase type IVA, member 2 1 1
MIRT044514 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 1 1
MIRT044515 HIST1H2BC histone cluster 1, H2bc 1 1
MIRT044516 DNAJB9 DnaJ (Hsp40) homolog, subfamily B, member 9 1 1
MIRT044517 TAF15 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa 1 1
MIRT044518 SPRY3 sprouty homolog 3 (Drosophila) 1 1
MIRT044519 CLUH KIAA0664 1 1
MIRT044520 HUWE1 HECT, UBA and WWE domain containing 1 1 1
MIRT044521 FBXO31 F-box protein 31 1 1
MIRT044522 PPIL1 peptidylprolyl isomerase (cyclophilin)-like 1 1 1
MIRT044523 TJAP1 tight junction associated protein 1 (peripheral) 1 1
MIRT044524 EPM2AIP1 EPM2A (laforin) interacting protein 1 1 1
MIRT044525 NOS1AP nitric oxide synthase 1 (neuronal) adaptor protein 1 1
MIRT044526 HIST1H3B histone cluster 1, H3b 1 1
MIRT044527 COTL1 coactosin-like 1 (Dictyostelium) 1 1
MIRT044528 TOE1 target of EGR1, member 1 (nuclear) 1 1
MIRT044529 MET met proto-oncogene (hepatocyte growth factor receptor) 1 1
MIRT044530 YPEL2 yippee-like 2 (Drosophila) 1 1
MIRT044531 ATP1A1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 1 1
MIRT044532 RNF10 ring finger protein 10 1 1
MIRT044533 UBQLN4 ubiquilin 4 1 1
MIRT044534 VCL vinculin 1 1
MIRT044535 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT044536 SDHC succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa 1 1
MIRT044537 CALR calreticulin 1 1
MIRT044538 HIST1H1E histone cluster 1, H1e 1 1
MIRT044539 LITAF lipopolysaccharide-induced TNF factor 1 1
MIRT044540 INO80D INO80 complex subunit D 1 1
MIRT044541 GRK6 G protein-coupled receptor kinase 6 1 1
MIRT044542 SNRNP48 small nuclear ribonucleoprotein 48kDa (U11/U12) 1 1
MIRT044543 MAN2A1 mannosidase, alpha, class 2A, member 1 1 1
MIRT044544 ADCY1 adenylate cyclase 1 (brain) 1 1
MIRT044545 PSMD10 proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 1 1
MIRT044546 INTS3 integrator complex subunit 3 1 1
MIRT044547 OTUD1 OTU domain containing 1 1 1
MIRT044548 PTPN11 protein tyrosine phosphatase, non-receptor type 11 1 1
MIRT044549 MEF2D myocyte enhancer factor 2D 1 1
MIRT044550 ND1 NADH dehydrogenase, subunit 1 (complex I) 1 1
MIRT044551 NOC4L nucleolar complex associated 4 homolog (S. cerevisiae) 1 1
MIRT044552 COX1 cytochrome c oxidase subunit I 1 1
MIRT044553 CYBA cytochrome b-245, alpha polypeptide 1 1
MIRT044554 IFFO2 intermediate filament family orphan 2 1 1
MIRT044555 TUBA1B tubulin, alpha 1b 1 1
MIRT044556 HIST2H3A histone cluster 2, H3a 1 1
MIRT044557 TONSL nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2 1 1
MIRT044558 ZFP64 zinc finger protein 64 homolog (mouse) 1 1
MIRT044559 CALU calumenin 1 1
MIRT044560 CANX calnexin 1 1
MIRT044561 DNAJC14 DnaJ (Hsp40) homolog, subfamily C, member 14 1 1
MIRT044562 PFKM phosphofructokinase, muscle 1 1
MIRT044563 SRP68 signal recognition particle 68kDa 1 1
MIRT044564 UBAP2L ubiquitin associated protein 2-like 1 1
MIRT044565 GPT2 glutamic pyruvate transaminase (alanine aminotransferase) 2 1 1
MIRT044566 SOLH small optic lobes homolog (Drosophila) 1 1
MIRT044567 PPIAL4G peptidylprolyl isomerase A (cyclophilin A)-like 4G 1 1
MIRT044568 C20orf24 chromosome 20 open reading frame 24 1 1
MIRT044569 POLR2F polymerase (RNA) II (DNA directed) polypeptide F 1 1
MIRT044570 SYNJ2BP synaptojanin 2 binding protein 1 1
MIRT044571 PAF1 Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae) 1 1
MIRT044572 RAN RAN, member RAS oncogene family 1 1
MIRT044573 ZIC2 Zic family member 2 (odd-paired homolog, Drosophila) 1 1
MIRT044574 ANP32B acidic (leucine-rich) nuclear phosphoprotein 32 family, member B 1 1
MIRT044575 RALY RNA binding protein, autoantigenic (hnRNP-associated with lethal yellow homolog (mouse)) 1 1
MIRT044576 WBP1L chromosome 10 open reading frame 26 1 1
MIRT044577 TUB tubby homolog (mouse) 1 1
MIRT044578 SBF1 SET binding factor 1 1 1
MIRT044579 EIF2B3 eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa 1 1
MIRT044580 SPRYD4 SPRY domain containing 4 1 1
MIRT044581 IDH3G isocitrate dehydrogenase 3 (NAD+) gamma 1 1
MIRT044582 GOLM1 golgi membrane protein 1 1 1
MIRT044583 NEO1 neogenin homolog 1 (chicken) 1 1
MIRT044584 ALKBH6 alkB, alkylation repair homolog 6 (E. coli) 1 1
MIRT044585 PKM pyruvate kinase, muscle 1 1
MIRT044586 NPLOC4 nuclear protein localization 4 homolog (S. cerevisiae) 1 1
MIRT044587 DPYSL2 dihydropyrimidinase-like 2 1 1
MIRT044588 RPL8 ribosomal protein L8 1 1
MIRT044589 RPS16 ribosomal protein S16 1 1
MIRT044590 WDR77 WD repeat domain 77 1 1
MIRT044591 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT044592 PIP4K2B phosphatidylinositol-5-phosphate 4-kinase, type II, beta 1 1
MIRT044593 SNRPG small nuclear ribonucleoprotein polypeptide G 1 1
MIRT044594 UNC13D unc-13 homolog D (C. elegans) 1 1
MIRT044595 NCAPD3 non-SMC condensin II complex, subunit D3 1 1
MIRT044596 SCAF1 SR-related CTD-associated factor 1 1 1
MIRT044597 GORASP2 golgi reassembly stacking protein 2, 55kDa 1 1
MIRT044598 HIST2H4B histone cluster 2, H4b 1 1
MIRT044599 RPS6KA3 ribosomal protein S6 kinase, 90kDa, polypeptide 3 1 1
MIRT044600 NRF1 nuclear respiratory factor 1 1 1
MIRT044601 UNC5A unc-5 homolog A (C. elegans) 1 1
MIRT044602 PRRC2C HLA-B associated transcript 2-like 2 1 1
MIRT044603 NIT2 nitrilase family, member 2 1 1
MIRT044604 TOB2 transducer of ERBB2, 2 1 1
MIRT044605 MRPS5 mitochondrial ribosomal protein S5 1 1
MIRT044606 MPI mannose phosphate isomerase 1 1
MIRT044607 RAD23A RAD23 homolog A (S. cerevisiae) 1 1
MIRT044608 EPB41 erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) 1 1
MIRT044609 ACTN4 actinin, alpha 4 1 1
MIRT044610 PLCD3 phospholipase C, delta 3 1 1
MIRT044611 MYO6 myosin VI 1 1
MIRT044612 RPS27 ribosomal protein S27 1 1
MIRT044613 HOXA10 homeobox A10 1 1
MIRT044614 ABHD16A HLA-B associated transcript 5 1 1
MIRT044615 HIST2H2AA3 histone cluster 2, H2aa3 1 1
MIRT044616 NXT2 nuclear transport factor 2-like export factor 2 1 1
MIRT044617 PPIL4 peptidylprolyl isomerase (cyclophilin)-like 4 1 1
MIRT044618 ZC3H4 zinc finger CCCH-type containing 4 1 1
MIRT044619 LAMA5 laminin, alpha 5 1 1
MIRT044620 PNN pinin, desmosome associated protein 1 1
MIRT044621 ENPEP glutamyl aminopeptidase (aminopeptidase A) 1 1
MIRT044622 VAV2 vav 2 guanine nucleotide exchange factor 1 1
MIRT044623 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT044624 HOXB8 homeobox B8 1 1
MIRT044625 ATXN1 ataxin 1 1 1
MIRT044626 MED12 mediator complex subunit 12 1 1
MIRT044627 DIAPH1 diaphanous homolog 1 (Drosophila) 1 1
MIRT044628 RBM38 RNA binding motif protein 38 1 1
MIRT044629 MED26 mediator complex subunit 26 1 1
MIRT044630 ZNF646 zinc finger protein 646 1 1
MIRT044631 SLC16A1 solute carrier family 16, member 1 (monocarboxylic acid transporter 1) 1 1
MIRT044632 EXT1 exostosin 1 1 1
MIRT044633 RNF41 ring finger protein 41 1 1
MIRT044634 CDC42SE1 CDC42 small effector 1 1 1
MIRT044635 SRM spermidine synthase 1 1
MIRT044636 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT044637 KCTD7 potassium channel tetramerisation domain containing 7 1 1
MIRT044638 SIX4 SIX homeobox 4 1 1
MIRT044639 CTNNBL1 catenin, beta like 1 1 1
MIRT044640 COG5 component of oligomeric golgi complex 5 1 1
MIRT044641 NRBP1 nuclear receptor binding protein 1 1 1
MIRT044642 CKB creatine kinase, brain 1 1
MIRT044643 PDLIM1 PDZ and LIM domain 1 1 1
MIRT044644 C12orf52 chromosome 12 open reading frame 52 1 1
MIRT044645 RNF130 ring finger protein 130 1 1
MIRT044646 SUPV3L1 suppressor of var1, 3-like 1 (S. cerevisiae) 1 1
MIRT044647 HSPA4 heat shock 70kDa protein 4 1 1
MIRT044648 EDC3 enhancer of mRNA decapping 3 homolog (S. cerevisiae) 1 1
MIRT044649 TSPYL2 TSPY-like 2 1 1
MIRT044650 USP22 ubiquitin specific peptidase 22 1 1
MIRT044651 TPI1 triosephosphate isomerase 1 1 1
MIRT044652 BTRC beta-transducin repeat containing 1 1
MIRT044653 PPP1R14A protein phosphatase 1, regulatory (inhibitor) subunit 14A 1 1
MIRT044654 PAICS phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase 1 1
MIRT044655 COMMD4 COMM domain containing 4 1 1
MIRT044656 PLS3 plastin 3 1 1
MIRT044657 GRWD1 glutamate-rich WD repeat containing 1 1 1
MIRT044658 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT044659 FAM102A family with sequence similarity 102, member A 1 1
MIRT044660 IKBIP IKBKB interacting protein 1 1
MIRT044661 RFX7 regulatory factor X, 7 1 1
MIRT044662 MRPL9 mitochondrial ribosomal protein L9 1 1
MIRT044663 PCBP2 poly(rC) binding protein 2 1 1
MIRT044664 OCRL oculocerebrorenal syndrome of Lowe 1 1
MIRT044665 ZNF318 zinc finger protein 318 1 1
MIRT044666 CTNS cystinosis, nephropathic 1 1
MIRT044667 FKBP1A FK506 binding protein 1A, 12kDa 1 1
MIRT044668 EP400 E1A binding protein p400 1 1
MIRT044669 CSE1L CSE1 chromosome segregation 1-like (yeast) 1 1
MIRT044670 MIF macrophage migration inhibitory factor (glycosylation-inhibiting factor) 1 1
MIRT044671 METTL17 methyltransferase 11 domain containing 1 1 1
MIRT044672 CYTH3 cytohesin 3 1 1
MIRT044673 LSM12 LSM12 homolog (S. cerevisiae) 1 1
MIRT044674 ANKRD39 ankyrin repeat domain 39 1 1
MIRT044675 ATF7IP activating transcription factor 7 interacting protein 1 1
MIRT044676 ATP7A ATPase, Cu++ transporting, alpha polypeptide 1 1
MIRT044677 VOPP1 vesicular, overexpressed in cancer, prosurvival protein 1 1 1
MIRT044678 TUBB tubulin, beta 1 1
MIRT044679 RNF216 ring finger protein 216 1 1
MIRT044680 IVNS1ABP influenza virus NS1A binding protein 1 1
MIRT044681 KMT2A myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 1 1
MIRT044682 CABIN1 calcineurin binding protein 1 1 1
MIRT044683 SMARCC2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 1 1
MIRT044684 PSMF1 proteasome (prosome, macropain) inhibitor subunit 1 (PI31) 1 1
MIRT044685 CALM3 calmodulin 3 (phosphorylase kinase, delta) 1 1
MIRT044686 TSPAN9 tetraspanin 9 1 1
MIRT044687 XBP1 X-box binding protein 1 1 1
MIRT044688 DR1 down-regulator of transcription 1, TBP-binding (negative cofactor 2) 1 1
MIRT044689 CANT1 calcium activated nucleotidase 1 1 1
MIRT044690 CTPS1 CTP synthase 1 1
MIRT044691 PPP1R7 protein phosphatase 1, regulatory (inhibitor) subunit 7 1 1
MIRT044692 R3HDM1 R3H domain containing 1 1 1
MIRT044693 ISYNA1 inositol-3-phosphate synthase 1 1 1
MIRT044694 POLR2A polymerase (RNA) II (DNA directed) polypeptide A, 220kDa 1 1
MIRT044695 SMUG1 single-strand-selective monofunctional uracil-DNA glycosylase 1 1 1
MIRT044696 RPS17 ribosomal protein S17 1 1
MIRT044697 RERE arginine-glutamic acid dipeptide (RE) repeats 1 1
MIRT044698 SH3GL1 SH3-domain GRB2-like 1 1 1
MIRT044699 ABCF2 ATP-binding cassette, sub-family F (GCN20), member 2 1 1
MIRT044700 ZNF607 zinc finger protein 607 1 1
MIRT044701 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT044702 HIST1H3H histone cluster 1, H3h 1 1
MIRT044703 SNRPD2 small nuclear ribonucleoprotein D2 polypeptide 16.5kDa 1 1
MIRT044704 KPNB1 karyopherin (importin) beta 1 1 1
MIRT044705 FHL3 four and a half LIM domains 3 1 1
MIRT044706 PSMD11 proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 1 1
MIRT044707 RPL36 ribosomal protein L36 1 1
MIRT044708 EIF3L eukaryotic translation initiation factor 3, subunit L 1 1
MIRT044709 CLDN12 claudin 12 1 1
MIRT044710 PDSS1 prenyl (decaprenyl) diphosphate synthase, subunit 1 1 1
MIRT044711 NSFL1C NSFL1 (p97) cofactor (p47) 1 1
MIRT044712 WNK1 WNK lysine deficient protein kinase 1 1 1
MIRT044713 DNAJB5 DnaJ (Hsp40) homolog, subfamily B, member 5 1 1
MIRT044714 REPIN1 replication initiator 1 1 1
MIRT044715 WDR13 WD repeat domain 13 1 1
MIRT044716 RPS12 ribosomal protein S12 1 1
MIRT044717 MYO1D myosin ID 1 1
MIRT044718 IRF2BP2 interferon regulatory factor 2 binding protein 2 1 1
MIRT044719 TUBGCP2 tubulin, gamma complex associated protein 2 1 1
MIRT044720 SNRPB small nuclear ribonucleoprotein polypeptides B and B1 1 1
MIRT044721 OAZ1 ornithine decarboxylase antizyme 1 1 1
MIRT044722 POP1 processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae) 1 1
MIRT044723 RNF125 ring finger protein 125 1 1
MIRT044724 ASCC2 activating signal cointegrator 1 complex subunit 2 1 1
MIRT044725 ARPP19 cAMP-regulated phosphoprotein, 19kDa 1 1
MIRT044726 RPLP1 ribosomal protein, large, P1 1 1
MIRT044727 AMELX amelogenin, X-linked 1 1
MIRT044728 ANXA11 annexin A11 1 1
MIRT044729 NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) 1 1
MIRT044730 MCRS1 microspherule protein 1 1 1
MIRT044731 RPL27 ribosomal protein L27 1 1
MIRT044732 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 1 1
MIRT044733 EARS2 glutamyl-tRNA synthetase 2, mitochondrial (putative) 1 1
MIRT044734 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 1
MIRT044735 BET1L blocked early in transport 1 homolog (S. cerevisiae)-like 1 1
MIRT044736 VDAC2 voltage-dependent anion channel 2 1 1
MIRT044737 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT044738 RAB2A RAB2A, member RAS oncogene family 1 1
MIRT044739 FLAD1 FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae) 1 1
MIRT044740 PSRC1 proline/serine-rich coiled-coil 1 1 1
MIRT044741 USPL1 ubiquitin specific peptidase like 1 1 1
MIRT044742 ABLIM1 actin binding LIM protein 1 1 1
MIRT044743 HSD17B10 hydroxysteroid (17-beta) dehydrogenase 10 1 1
MIRT044744 NCOR1 nuclear receptor corepressor 1 1 1
MIRT044745 SATB2 SATB homeobox 2 1 1
MIRT044746 SEC24A SEC24 family, member A (S. cerevisiae) 1 1
MIRT044747 VDAC1 voltage-dependent anion channel 1 1 1
MIRT044748 MNF1 chromosome 6 open reading frame 125 1 1
MIRT044749 PITX1 paired-like homeodomain 1 1 1
MIRT044750 PAK1 p21 protein (Cdc42/Rac)-activated kinase 1 1 1
MIRT044751 RTN4 reticulon 4 1 1
MIRT044752 CDCA3 cell division cycle associated 3 1 1
MIRT044753 ULK1 unc-51-like kinase 1 (C. elegans) 1 1
MIRT044754 AK2 adenylate kinase 2 1 1
MIRT044755 ACTB actin, beta 1 1
MIRT044756 TSC1 tuberous sclerosis 1 1 1
MIRT044757 HSP90AB1 heat shock protein 90kDa alpha (cytosolic), class B member 1 1 1
MIRT044758 FRAT2 frequently rearranged in advanced T-cell lymphomas 2 1 1
MIRT044759 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 1 1
MIRT044760 KDELR1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 1 1
MIRT044761 ZNF275 zinc finger protein 275 1 1
MIRT044762 ZFAND5 zinc finger, AN1-type domain 5 1 1
MIRT044763 RPAP1 RNA polymerase II associated protein 1 1 1
MIRT044764 PLS1 plastin 1 1 1
MIRT044765 GART phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase 1 1
MIRT044766 NDUFA3 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa 1 1
MIRT044767 KIAA0368 KIAA0368 1 1
MIRT044768 TMCO6 transmembrane and coiled-coil domains 6 1 1
MIRT044769 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT044770 SYNGR2 synaptogyrin 2 1 1
MIRT044771 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT044772 EIF3J eukaryotic translation initiation factor 3, subunit J 1 1
MIRT044773 CDK2AP2 cyclin-dependent kinase 2 associated protein 2 1 1
MIRT044774 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT044775 CCT3 chaperonin containing TCP1, subunit 3 (gamma) 1 1
MIRT044776 ACTG1 actin, gamma 1 1 1
MIRT044777 FOXP1 forkhead box P1 1 1
MIRT044778 NET1 neuroepithelial cell transforming 1 1 1
MIRT044779 EIF3C eukaryotic translation initiation factor 3, subunit C 1 1
MIRT044780 DYRK1B dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B 1 1
MIRT044781 TMPO thymopoietin 1 1
MIRT044782 DPP3 dipeptidyl-peptidase 3 1 1
MIRT044783 CMAS cytidine monophosphate N-acetylneuraminic acid synthetase 1 1
MIRT044784 ARHGAP26 Rho GTPase activating protein 26 1 1
MIRT044785 SALL1 sal-like 1 (Drosophila) 1 1
MIRT044786 CLN6 ceroid-lipofuscinosis, neuronal 6, late infantile, variant 1 1
MIRT044787 POLR3E polymerase (RNA) III (DNA directed) polypeptide E (80kD) 1 1
MIRT044788 HIST1H2BO histone cluster 1, H2bo 1 1
MIRT044789 SPEN spen homolog, transcriptional regulator (Drosophila) 1 1
MIRT044790 CCND2 cyclin D2 1 1
MIRT044791 PDHX pyruvate dehydrogenase complex, component X 1 1
MIRT044792 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 1
MIRT044793 TRAF4 TNF receptor-associated factor 4 1 1
MIRT044794 METTL7A methyltransferase like 7A 1 1
MIRT044795 PACS1 phosphofurin acidic cluster sorting protein 1 1 1
MIRT044796 USF2 upstream transcription factor 2, c-fos interacting 1 1
MIRT044797 SETD1A SET domain containing 1A 1 1
MIRT044798 HSPA8 heat shock 70kDa protein 8 1 1
MIRT044799 RELA v-rel reticuloendotheliosis viral oncogene homolog A (avian) 1 1
MIRT044800 ILF3 interleukin enhancer binding factor 3, 90kDa 1 1
MIRT044801 AUP1 ancient ubiquitous protein 1 1 1
MIRT044802 CHD1L chromodomain helicase DNA binding protein 1-like 1 1
MIRT044803 ARHGAP17 Rho GTPase activating protein 17 1 1
MIRT044804 SORBS1 sorbin and SH3 domain containing 1 1 1
MIRT044805 LMNB1 lamin B1 1 1
MIRT044806 HIST1H2BJ histone cluster 1, H2bj 1 1
MIRT044807 COX2 cytochrome c oxidase subunit II 1 1
MIRT044808 ZNF436 zinc finger protein 436 1 1
MIRT044809 CPD carboxypeptidase D 1 1
MIRT044810 PYGO2 pygopus homolog 2 (Drosophila) 1 1
MIRT044811 SENP3 SUMO1/sentrin/SMT3 specific peptidase 3 1 1
MIRT044812 SSSCA1 Sjogren syndrome/scleroderma autoantigen 1 1 1
MIRT044813 MARK2 MAP/microtubule affinity-regulating kinase 2 1 1
MIRT044814 NXT1 NTF2-like export factor 1 1 1
MIRT044815 USP42 ubiquitin specific peptidase 42 1 1
MIRT044816 BCOR BCL6 corepressor 1 1
MIRT044817 TDP1 tyrosyl-DNA phosphodiesterase 1 1 1
MIRT044818 PPT1 palmitoyl-protein thioesterase 1 1 1
MIRT044819 UBA52 ubiquitin A-52 residue ribosomal protein fusion product 1 1 1
MIRT044820 TMTC1 transmembrane and tetratricopeptide repeat containing 1 1 1
MIRT044821 MAPK8IP3 mitogen-activated protein kinase 8 interacting protein 3 1 1
MIRT044822 FLOT1 flotillin 1 1 1
MIRT044823 ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 1 1
MIRT044824 MDH2 malate dehydrogenase 2, NAD (mitochondrial) 1 1
MIRT044825 MMS22L chromosome 6 open reading frame 167 1 1
MIRT044826 PFDN6 prefoldin subunit 6 1 1
MIRT044827 CAPNS1 calpain, small subunit 1 1 1
MIRT044828 MOCS1 molybdenum cofactor synthesis 1 1 1
MIRT044829 NQO2 NAD(P)H dehydrogenase, quinone 2 1 1
MIRT044830 CPSF3L cleavage and polyadenylation specific factor 3-like 1 1
MIRT044831 ITFG3 integrin alpha FG-GAP repeat containing 3 1 1
MIRT044832 SRF serum response factor (c-fos serum response element-binding transcription factor) 1 1
MIRT044833 EAF1 ELL associated factor 1 1 1
MIRT044834 EZH2 enhancer of zeste homolog 2 (Drosophila) 1 1
MIRT044835 OPA1 optic atrophy 1 (autosomal dominant) 1 1
MIRT044836 STOML2 stomatin (EPB72)-like 2 1 1
MIRT044837 TMEM51 transmembrane protein 51 1 1
MIRT044838 HNF1A HNF1 homeobox A 1 1
MIRT044839 DENND4B DENN/MADD domain containing 4B 1 1
MIRT044840 ATXN7L3B ataxin 7-like 3B 1 1
MIRT044841 DCAF11 DDB1 and CUL4 associated factor 11 1 1
MIRT044842 PROSER1 chromosome 13 open reading frame 23 1 1
MIRT044843 ZNF432 zinc finger protein 432 1 1
MIRT044844 TBC1D14 TBC1 domain family, member 14 1 1
MIRT044845 P4HA1 prolyl 4-hydroxylase, alpha polypeptide I 1 1
MIRT044846 PLD3 phospholipase D family, member 3 1 1
MIRT044847 MLX MAX-like protein X 1 1
MIRT044848 COX3 cytochrome c oxidase III 1 1
MIRT044849 XPO6 exportin 6 1 1
MIRT044850 FAM83G family with sequence similarity 83, member G 1 1
MIRT044851 FAM127B family with sequence similarity 127, member B 1 1
MIRT044852 TRIM14 tripartite motif-containing 14 1 1
MIRT044853 KIAA0100 KIAA0100 1 1
MIRT044854 EIF4G1 eukaryotic translation initiation factor 4 gamma, 1 1 1
MIRT044855 SLC2A1 solute carrier family 2 (facilitated glucose transporter), member 1 1 1
MIRT044856 GLUL glutamate-ammonia ligase 1 1
MIRT044857 SETD3 SET domain containing 3 1 1