Accession ID: MIRT045194 [miRNA, hsa-miR-186-5p :: EIF3G, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-186LinkOut: [miRBase ]
Synonyms MIRN186, miR-186, MIR186
Description Homo sapiens miR-186 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse. Expression of this miRNA was also verified in a human osteoblast sarcoma cell line .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-186-5p
Mature Sequence 15| CAAAGAAUUCUCCUUUUGGGCU |36
Evidence Experimental
Experiments Cloned
Putative hsa-miR-186-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol EIF3G LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms EIF3-P42, EIF3S4, eIF3-delta, eIF3-p44
Description eukaryotic translation initiation factor 3, subunit G
Transcript NM_003755    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on EIF3G LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of EIF3G
(miRNA target sites are highlighted)
>EIF3G|NM_003755|3'UTR
   1 GCCAGCTGCCACTGTGTACTCGGTCCGGGACCCTTGGCGACAGAAGACAGCCTCCGAGAGCGCGGGCTCCAAGGGCAATA
  81 AAGCAGCTCCACTCTCTCTA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucggguuuuccUCUUAAGAAac 5'
                     :|:|  |||  
Target 5' gtactcggtccGGGACCCTTgg 3'
16 - 37 63.00 -7.97
2
miRNA  3' ucGGGUUUUC-CUCUUAAGaaac 5'
            :||:|:|| | |:: ||    
Target 5' ccTCCGAGAGCGCGGGCTCcaag 3'
51 - 73 60.00 -11.46
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-186-5p :: EIF3G    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' tcgGGTTTTCCTCT-----TAAGaaac 5'
             || |  |||||     ||||    
Target 5' atgCCTACTGGAGACTTTGATTCgaag 3'
1 - 27
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
730 hsa-miR-186-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003297 FOXO1 forkhead box O1 3 1
MIRT004356 P2RX7 purinergic receptor P2X, ligand-gated ion channel, 7 3 1
MIRT005871 AKAP12 A kinase (PRKA) anchor protein 12 5 2
MIRT007210 CSNK2A1 casein kinase 2, alpha 1 polypeptide 3 1
MIRT021083 TRAPPC10 trafficking protein particle complex 10 1 1
MIRT021084 RAN RAN, member RAS oncogene family 1 2
MIRT021085 ZIC5 Zic family member 5 1 2
MIRT021086 PON2 paraoxonase 2 1 1
MIRT021087 KCTD15 potassium channel tetramerisation domain containing 15 1 4
MIRT021088 ELK1 ELK1, member of ETS oncogene family 1 1
MIRT021089 TNPO2 transportin 2 1 1
MIRT021090 ORC5 origin recognition complex, subunit 5 1 1
MIRT021091 SLC39A10 solute carrier family 39 (zinc transporter), member 10 1 1
MIRT021092 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble) 1 1
MIRT021093 SRSF3 serine/arginine-rich splicing factor 3 1 1
MIRT021094 VAV3 vav 3 guanine nucleotide exchange factor 1 1
MIRT021095 DNAJC27 DnaJ (Hsp40) homolog, subfamily C, member 27 1 1
MIRT021096 YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 1 2
MIRT021097 LUZP1 leucine zipper protein 1 1 1
MIRT021098 FAM134A family with sequence similarity 134, member A 1 1
MIRT021099 TEX15 testis expressed 15 1 1
MIRT021100 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT021101 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT021102 RNF6 ring finger protein (C3H2C3 type) 6 1 1
MIRT021103 BCL11B B-cell CLL/lymphoma 11B (zinc finger protein) 1 1
MIRT021104 AKAP11 A kinase (PRKA) anchor protein 11 1 1
MIRT021105 ZNF652 zinc finger protein 652 1 1
MIRT021106 RBM12B RNA binding motif protein 12B 1 1
MIRT021107 AP1G1 adaptor-related protein complex 1, gamma 1 subunit 1 2
MIRT021108 GNAI1 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 1 1
MIRT021109 TULP4 tubby like protein 4 1 1
MIRT021110 FBXL3 F-box and leucine-rich repeat protein 3 1 1
MIRT021111 SPIRE1 spire homolog 1 (Drosophila) 1 1
MIRT021112 ZC3H15 zinc finger CCCH-type containing 15 1 1
MIRT021113 TRIP10 thyroid hormone receptor interactor 10 1 1
MIRT021114 TLE4 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) 1 1
MIRT021115 FOXP4 forkhead box P4 1 1
MIRT021116 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide 1 2
MIRT021117 PLIN3 perilipin 3 1 1
MIRT021118 PIP4K2B phosphatidylinositol-5-phosphate 4-kinase, type II, beta 1 1
MIRT021119 SF1 splicing factor 1 1 1
MIRT021120 BBS10 Bardet-Biedl syndrome 10 1 1
MIRT021121 TXNRD1 thioredoxin reductase 1 1 1
MIRT021122 PSMD9 proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 1 1
MIRT021123 ZNF385A zinc finger protein 385A 1 1
MIRT021124 SPRTN SprT-like N-terminal domain 1 1
MIRT021125 WDR33 WD repeat domain 33 1 1
MIRT021126 KIF11 kinesin family member 11 1 2
MIRT021127 PRPSAP1 phosphoribosyl pyrophosphate synthetase-associated protein 1 1 1
MIRT021128 MED4 mediator complex subunit 4 1 1
MIRT021129 NUP62 nucleoporin 62kDa 1 1
MIRT021130 TEF thyrotrophic embryonic factor 1 1
MIRT021131 FIZ1 FLT3-interacting zinc finger 1 1 1
MIRT021132 PNP purine nucleoside phosphorylase 1 1
MIRT021133 RAB11A RAB11A, member RAS oncogene family 1 1
MIRT021134 ACVR2A activin A receptor, type IIA 1 1
MIRT021135 DUSP8 dual specificity phosphatase 8 1 1
MIRT021136 NUAK1 NUAK family, SNF1-like kinase, 1 1 1
MIRT021137 RSRC2 arginine/serine-rich coiled-coil 2 1 1
MIRT021138 PIGG phosphatidylinositol glycan anchor biosynthesis, class G 1 1
MIRT021139 TSR1 TSR1, 20S rRNA accumulation, homolog (S. cerevisiae) 1 1
MIRT021140 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT021141 GLUL glutamate-ammonia ligase 1 1
MIRT021142 RAB12 RAB12, member RAS oncogene family 1 1
MIRT021143 SRSF6 serine/arginine-rich splicing factor 6 1 1
MIRT021144 GINS1 GINS complex subunit 1 (Psf1 homolog) 1 1
MIRT021145 TSPYL4 TSPY-like 4 1 1
MIRT021146 RIMS4 regulating synaptic membrane exocytosis 4 1 1
MIRT021147 AMD1 adenosylmethionine decarboxylase 1 1 1
MIRT021148 FBXL5 F-box and leucine-rich repeat protein 5 1 1
MIRT021149 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 2
MIRT021150 CBX1 chromobox homolog 1 1 1
MIRT021151 CACNB1 calcium channel, voltage-dependent, beta 1 subunit 1 1
MIRT021152 ATL2 atlastin GTPase 2 1 1
MIRT021153 PRR3 proline rich 3 1 1
MIRT021154 WNT5A wingless-type MMTV integration site family, member 5A 1 1
MIRT021155 BRD1 bromodomain containing 1 1 1
MIRT021156 SLTM SAFB-like, transcription modulator 1 1
MIRT021157 CHST11 carbohydrate (chondroitin 4) sulfotransferase 11 1 1
MIRT021158 KIAA1804 mixed lineage kinase 4 1 1
MIRT021159 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT021160 SMAD4 SMAD family member 4 1 1
MIRT021161 FGF2 fibroblast growth factor 2 (basic) 1 1
MIRT021162 SEPT11 septin 11 1 1
MIRT021163 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1
MIRT021164 MESDC2 mesoderm development candidate 2 1 1
MIRT021165 KIT v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog 1 1
MIRT021166 C18orf32 chromosome 18 open reading frame 32 1 1
MIRT021167 SPRED2 sprouty-related, EVH1 domain containing 2 1 1
MIRT021168 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT021169 RFK riboflavin kinase 1 1
MIRT021170 SMARCA2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 1 1
MIRT021171 CMTM4 CKLF-like MARVEL transmembrane domain containing 4 1 1
MIRT021172 ERI2 ERI1 exoribonuclease family member 2 1 1
MIRT021173 CGN cingulin 1 1
MIRT021174 PTPN9 protein tyrosine phosphatase, non-receptor type 9 1 1
MIRT021175 HMGXB4 HMG box domain containing 4 1 1
MIRT021176 NKAP NFKB activating protein 1 1
MIRT021177 AEN apoptosis enhancing nuclease 1 1
MIRT021178 CSNK1A1 casein kinase 1, alpha 1 1 1
MIRT021179 KDM6B lysine (K)-specific demethylase 6B 1 1
MIRT021180 RNF2 ring finger protein 2 1 1
MIRT021181 STK35 serine/threonine kinase 35 1 1
MIRT021182 DEPDC1 DEP domain containing 1 1 1
MIRT021183 NRP1 neuropilin 1 1 1
MIRT021184 C7orf60 chromosome 7 open reading frame 60 1 4
MIRT021185 TMEM245 transmembrane protein 245 1 1
MIRT021186 DLC1 deleted in liver cancer 1 1 1
MIRT021187 BTF3 basic transcription factor 3 1 1
MIRT021188 TMEM64 transmembrane protein 64 1 1
MIRT021189 TES testis derived transcript (3 LIM domains) 1 1
MIRT021190 LBR lamin B receptor 1 1
MIRT021191 ZNF700 zinc finger protein 700 1 1
MIRT021192 ACVR1 activin A receptor, type I 1 2
MIRT021193 RAB6A RAB6A, member RAS oncogene family 1 1
MIRT021194 TMEM183A transmembrane protein 183A 1 1
MIRT021195 ZBTB21 zinc finger protein 295 1 1
MIRT021196 RNF111 ring finger protein 111 1 1
MIRT021197 CD46 CD46 molecule, complement regulatory protein 1 1
MIRT021198 SMAD5 SMAD family member 5 1 2
MIRT021199 FNIP1 folliculin interacting protein 1 1 1
MIRT021200 ATXN1 ataxin 1 1 1
MIRT021201 FOXK1 forkhead box K1 1 1
MIRT021202 C1orf21 chromosome 1 open reading frame 21 1 1
MIRT021203 CNOT4 CCR4-NOT transcription complex, subunit 4 1 2
MIRT021204 TARDBP TAR DNA binding protein 1 1
MIRT021205 ZNF148 zinc finger protein 148 1 1
MIRT021206 FOXN2 forkhead box N2 1 1
MIRT021207 ZNF805 zinc finger protein 805 1 1
MIRT044903 TXN2 thioredoxin 2 1 1
MIRT044904 DEK DEK oncogene 1 1
MIRT044905 GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 1 1
MIRT044906 BRCA1 breast cancer 1, early onset 1 1
MIRT044907 WDR11 WD repeat domain 11 1 1
MIRT044908 ITM2B integral membrane protein 2B 1 1
MIRT044909 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT044910 ABT1 activator of basal transcription 1 1 1
MIRT044911 GOLGA7 golgin A7 1 1
MIRT044912 WBSCR16 Williams-Beuren syndrome chromosome region 16 1 1
MIRT044913 FUNDC2 FUN14 domain containing 2 1 1
MIRT044914 PDCD5 programmed cell death 5 1 1
MIRT044915 UBE2Q1 ubiquitin-conjugating enzyme E2Q family member 1 1 1
MIRT044916 UBE2K ubiquitin-conjugating enzyme E2K 1 1
MIRT044917 FGFR2 fibroblast growth factor receptor 2 1 1
MIRT044918 AGBL3 ATP/GTP binding protein-like 3 1 1
MIRT044919 MAT2A methionine adenosyltransferase II, alpha 1 3
MIRT044920 FASN fatty acid synthase 1 1
MIRT044921 SLC15A4 solute carrier family 15, member 4 1 1
MIRT044922 KRT3 keratin 3 1 1
MIRT044923 PTTG1 pituitary tumor-transforming 1 2 2
MIRT044924 LIMA1 LIM domain and actin binding 1 1 1
MIRT044925 SEC24B SEC24 family, member B (S. cerevisiae) 1 1
MIRT044926 HSP90AB1 heat shock protein 90kDa alpha (cytosolic), class B member 1 1 1
MIRT044927 NVL nuclear VCP-like 1 1
MIRT044928 STK25 serine/threonine kinase 25 1 1
MIRT044929 TOP1 topoisomerase (DNA) I 1 1
MIRT044930 UNK unkempt homolog (Drosophila) 1 1
MIRT044931 PPARGC1B peroxisome proliferator-activated receptor gamma, coactivator 1 beta 1 1
MIRT044932 MATR3 matrin 3 1 1
MIRT044933 CNBP CCHC-type zinc finger, nucleic acid binding protein 1 1
MIRT044934 CKAP5 cytoskeleton associated protein 5 1 1
MIRT044935 WLS wntless homolog (Drosophila) 1 1
MIRT044936 MSANTD4 Myb/SANT-like DNA-binding domain containing 4 with coiled-coils 1 1
MIRT044937 EIF3C eukaryotic translation initiation factor 3, subunit C 1 1
MIRT044938 GAREM family with sequence similarity 59, member A 1 1
MIRT044939 BHLHE41 basic helix-loop-helix family, member e41 1 1
MIRT044940 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 1
MIRT044941 MRPS15 mitochondrial ribosomal protein S15 1 1
MIRT044942 SERP1 stress-associated endoplasmic reticulum protein 1 1 1
MIRT044943 RBM28 RNA binding motif protein 28 1 1
MIRT044944 PPP4R2 protein phosphatase 4, regulatory subunit 2 1 1
MIRT044945 EEF1D eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) 1 1
MIRT044946 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT044947 SCFD1 sec1 family domain containing 1 1 1
MIRT044948 FEM1B fem-1 homolog b (C. elegans) 1 1
MIRT044949 DIEXF digestive organ expansion factor homolog (zebrafish) 1 1
MIRT044950 TTC30A tetratricopeptide repeat domain 30A 1 1
MIRT044951 MRPL45 mitochondrial ribosomal protein L45 1 1
MIRT044952 FBXO42 F-box protein 42 1 1
MIRT044953 RALGDS ral guanine nucleotide dissociation stimulator 1 1
MIRT044954 ZC3H8 zinc finger CCCH-type containing 8 1 1
MIRT044955 NUDT13 nudix (nucleoside diphosphate linked moiety X)-type motif 13 1 1
MIRT044956 KIF5B kinesin family member 5B 1 1
MIRT044957 PKP2 plakophilin 2 1 1
MIRT044958 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT044959 GMFB glia maturation factor, beta 1 1
MIRT044960 IRF2BP2 interferon regulatory factor 2 binding protein 2 1 1
MIRT044961 PCGF1 polycomb group ring finger 1 1 1
MIRT044962 NUPL2 nucleoporin like 2 1 1
MIRT044963 PSMD4 proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 1 1
MIRT044964 ATL3 atlastin GTPase 3 1 1
MIRT044965 MTA2 metastasis associated 1 family, member 2 1 1
MIRT044966 CLPTM1 cleft lip and palate associated transmembrane protein 1 1 1
MIRT044967 ANTXR2 anthrax toxin receptor 2 1 1
MIRT044968 APEH N-acylaminoacyl-peptide hydrolase 1 1
MIRT044969 COX1 cytochrome c oxidase subunit I 1 1
MIRT044970 ANO3 anoctamin 3 1 1
MIRT044971 ZNF770 zinc finger protein 770 1 1
MIRT044972 NDUFA7 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa 1 1
MIRT044973 ATP6 ATP synthase F0 subunit 6 1 1
MIRT044974 RIF1 RAP1 interacting factor homolog (yeast) 1 1
MIRT044975 PABPC4 poly(A) binding protein, cytoplasmic 4 (inducible form) 1 1
MIRT044976 SHC2 SHC (Src homology 2 domain containing) transforming protein 2 1 1
MIRT044977 RAF1 v-raf-1 murine leukemia viral oncogene homolog 1 1 1
MIRT044978 ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) 1 1
MIRT044979 EIF1 eukaryotic translation initiation factor 1 1 1
MIRT044980 CAMSAP3 calmodulin regulated spectrin-associated protein family, member 3 1 1
MIRT044981 RPL18A ribosomal protein L18a 1 1
MIRT044982 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 1 1
MIRT044983 PLXNB2 plexin B2 1 1
MIRT044984 ARL5B ADP-ribosylation factor-like 5B 1 6
MIRT044985 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 1
MIRT044986 NDUFB6 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa 1 1
MIRT044987 CTPS1 CTP synthase 1 1 1
MIRT044988 THOC5 THO complex 5 1 1
MIRT044989 TUBB4B tubulin, beta 4B class IVb 1 1
MIRT044990 RLIM ring finger protein, LIM domain interacting 1 1
MIRT044991 EIF2A eukaryotic translation initiation factor 2A, 65kDa 1 1
MIRT044992 RPL36 ribosomal protein L36 1 1
MIRT044993 SCRIB scribbled homolog (Drosophila) 1 1
MIRT044994 RPLP1 ribosomal protein, large, P1 1 1
MIRT044995 ITSN2 intersectin 2 1 1
MIRT044996 RPS21 ribosomal protein S21 1 1
MIRT044997 TSEN15 tRNA splicing endonuclease 15 homolog (S. cerevisiae) 1 1
MIRT044998 PPCS phosphopantothenoylcysteine synthetase 1 1
MIRT044999 FIBP fibroblast growth factor (acidic) intracellular binding protein 1 1
MIRT045000 CBX3 chromobox homolog 3 1 1
MIRT045001 EZR ezrin 1 1
MIRT045002 PRKAB2 protein kinase, AMP-activated, beta 2 non-catalytic subunit 1 1
MIRT045003 BEND3 BEN domain containing 3 1 1
MIRT045004 ITPKB inositol-trisphosphate 3-kinase B 1 1
MIRT045005 WNK1 WNK lysine deficient protein kinase 1 1 1
MIRT045006 HIST1H1E histone cluster 1, H1e 1 1
MIRT045007 HELZ helicase with zinc finger 1 1
MIRT045008 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT045009 RPL5 ribosomal protein L5 1 1
MIRT045010 PUM1 pumilio homolog 1 (Drosophila) 1 1
MIRT045011 CLDN9 claudin 9 1 1
MIRT045012 CBX2 chromobox homolog 2 1 1
MIRT045013 UBL3 ubiquitin-like 3 1 1
MIRT045014 KIAA1462 KIAA1462 1 1
MIRT045015 PPL periplakin 1 1
MIRT045016 ST3GAL5 ST3 beta-galactoside alpha-2,3-sialyltransferase 5 1 1
MIRT045017 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT045018 ILF3 interleukin enhancer binding factor 3, 90kDa 1 1
MIRT045019 TMEM11 transmembrane protein 11 1 1
MIRT045020 NDUFA4 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa 1 1
MIRT045021 CLDN23 claudin 23 1 1
MIRT045022 SEPT9 septin 9 1 1
MIRT045023 MOB3A MOB kinase activator 3A 1 1
MIRT045024 COX3 cytochrome c oxidase III 1 1
MIRT045025 JOSD1 Josephin domain containing 1 1 1
MIRT045026 SRSF2 serine/arginine-rich splicing factor 2 1 1
MIRT045027 RNF40 ring finger protein 40, E3 ubiquitin protein ligase 1 1
MIRT045028 RPL32 ribosomal protein L32 1 1
MIRT045029 AMZ1 archaelysin family metallopeptidase 1 1 1
MIRT045030 FAM117B family with sequence similarity 117, member B 1 2
MIRT045031 YARS tyrosyl-tRNA synthetase 1 1
MIRT045032 XPO7 exportin 7 1 1
MIRT045033 FOXRED2 FAD-dependent oxidoreductase domain containing 2 1 1
MIRT045034 MRFAP1 Morf4 family associated protein 1 1 1
MIRT045035 COG8 component of oligomeric golgi complex 8 1 1
MIRT045036 DDX21 DEAD (Asp-Glu-Ala-Asp) box helicase 21 1 1
MIRT045037 ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 1 1
MIRT045038 XRN2 5'-3' exoribonuclease 2 1 1
MIRT045039 SERPINA12 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 1 1
MIRT045040 ECH1 enoyl CoA hydratase 1, peroxisomal 1 1
MIRT045041 DNASE2 deoxyribonuclease II, lysosomal 1 1
MIRT045042 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT045043 CRAMP1L Crm, cramped-like (Drosophila) 1 1
MIRT045044 SNX6 sorting nexin 6 1 1
MIRT045045 TGOLN2 trans-golgi network protein 2 1 1
MIRT045046 ALDH1B1 aldehyde dehydrogenase 1 family, member B1 1 1
MIRT045047 QRICH1 glutamine-rich 1 1 1
MIRT045048 DOCK3 dedicator of cytokinesis 3 1 1
MIRT045049 ANKRD17 ankyrin repeat domain 17 1 1
MIRT045050 ACAA2 acetyl-CoA acyltransferase 2 1 1
MIRT045051 PCDH10 protocadherin 10 1 1
MIRT045052 ACTL8 actin-like 8 1 1
MIRT045053 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 1 1
MIRT045054 GOLGA4 golgin A4 1 1
MIRT045055 RPS26 ribosomal protein S26 1 1
MIRT045056 RPL14 ribosomal protein L14 1 1
MIRT045057 RBM5 RNA binding motif protein 5 1 1
MIRT045058 PTPN13 protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase) 1 1
MIRT045059 MED8 mediator complex subunit 8 1 1
MIRT045060 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT045061 RPS7 ribosomal protein S7 1 1
MIRT045062 STK24 serine/threonine kinase 24 1 1
MIRT045063 RPL4 ribosomal protein L4 1 1
MIRT045064 TADA3 transcriptional adaptor 3 1 1
MIRT045065 ZMAT2 zinc finger, matrin-type 2 1 1
MIRT045066 CEP192 centrosomal protein 192kDa 1 1
MIRT045067 SP1 Sp1 transcription factor 1 1
MIRT045068 LPCAT1 lysophosphatidylcholine acyltransferase 1 1 1
MIRT045069 APC adenomatous polyposis coli 1 1
MIRT045070 GNG12 guanine nucleotide binding protein (G protein), gamma 12 1 1
MIRT045071 RAG1 recombination activating gene 1 1 1
MIRT045072 PSMA2 proteasome (prosome, macropain) subunit, alpha type, 2 1 1
MIRT045073 KPNA1 karyopherin alpha 1 (importin alpha 5) 1 1
MIRT045074 DAGLB diacylglycerol lipase, beta 1 1
MIRT045075 HIST1H1C histone cluster 1, H1c 1 1
MIRT045076 H1F0 H1 histone family, member 0 1 1
MIRT045077 POLD3 polymerase (DNA-directed), delta 3, accessory subunit 1 1
MIRT045078 ST13 suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) 1 1
MIRT045079 VPS13C vacuolar protein sorting 13 homolog C (S. cerevisiae) 1 1
MIRT045080 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT045081 PAPD5 PAP associated domain containing 5 1 4
MIRT045082 PCNP PEST proteolytic signal containing nuclear protein 1 1
MIRT045083 NMT1 N-myristoyltransferase 1 1 1
MIRT045084 FOXM1 forkhead box M1 1 1
MIRT045085 HIST1H2BJ histone cluster 1, H2bj 1 1
MIRT045086 USP9X ubiquitin specific peptidase 9, X-linked 1 1
MIRT045087 CREBRF CREB3 regulatory factor 1 1
MIRT045088 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT045089 SPEN spen homolog, transcriptional regulator (Drosophila) 1 1
MIRT045090 BDP1 B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB 1 1
MIRT045091 ARL14 ADP-ribosylation factor-like 14 1 1
MIRT045092 HN1L hematological and neurological expressed 1-like 1 1
MIRT045093 KCTD12 potassium channel tetramerisation domain containing 12 1 1
MIRT045094 ECHS1 enoyl CoA hydratase, short chain, 1, mitochondrial 1 1
MIRT045095 BEND5 BEN domain containing 5 1 1
MIRT045096 RALA v-ral simian leukemia viral oncogene homolog A (ras related) 1 1
MIRT045097 CHMP2A charged multivesicular body protein 2A 1 1
MIRT045098 EIF5 eukaryotic translation initiation factor 5 1 1
MIRT045099 ZFP36L2 zinc finger protein 36, C3H type-like 2 1 1
MIRT045100 CYTB cytochrome b 1 1
MIRT045101 CCT6A chaperonin containing TCP1, subunit 6A (zeta 1) 1 1
MIRT045102 SNRNP40 small nuclear ribonucleoprotein 40kDa (U5) 1 1
MIRT045103 DUS3L dihydrouridine synthase 3-like (S. cerevisiae) 1 1
MIRT045104 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT045105 LRRFIP1 leucine rich repeat (in FLII) interacting protein 1 1 1
MIRT045106 TRIM2 tripartite motif containing 2 1 1
MIRT045107 ATP1B3 ATPase, Na+/K+ transporting, beta 3 polypeptide 1 1
MIRT045108 WDR62 WD repeat domain 62 1 1
MIRT045109 C2CD5 KIAA0528 1 1
MIRT045110 UBXN6 UBX domain protein 6 1 1
MIRT045111 NSRP1 nuclear speckle splicing regulatory protein 1 1 1
MIRT045112 NCAPD2 non-SMC condensin I complex, subunit D2 1 1
MIRT045113 PSMD3 proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 1 1
MIRT045114 SUPT16H suppressor of Ty 16 homolog (S. cerevisiae) 1 1
MIRT045115 TUBB2B tubulin, beta 2B class IIb 1 1
MIRT045116 STAG2 stromal antigen 2 1 1
MIRT045117 HMOX2 heme oxygenase (decycling) 2 1 1
MIRT045118 FAHD2A fumarylacetoacetate hydrolase domain containing 2A 1 1
MIRT045119 MRPL42 mitochondrial ribosomal protein L42 1 1
MIRT045120 RASSF1 Ras association (RalGDS/AF-6) domain family member 1 1 1
MIRT045121 PLEKHH2 pleckstrin homology domain containing, family H (with MyTH4 domain) member 2 1 1
MIRT045122 SHMT2 serine hydroxymethyltransferase 2 (mitochondrial) 1 1
MIRT045123 IGF2BP3 insulin-like growth factor 2 mRNA binding protein 3 1 1
MIRT045124 CAMK2B calcium/calmodulin-dependent protein kinase II beta 1 1
MIRT045125 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT045126 SAT2 spermidine/spermine N1-acetyltransferase family member 2 1 1
MIRT045127 TMBIM6 transmembrane BAX inhibitor motif containing 6 1 1
MIRT045128 GRIK5 glutamate receptor, ionotropic, kainate 5 1 1
MIRT045129 FAM192A family with sequence similarity 192, member A 1 1
MIRT045130 PTPMT1 protein tyrosine phosphatase, mitochondrial 1 1 1
MIRT045131 TUBB tubulin, beta class I 1 1
MIRT045132 CAND1 cullin-associated and neddylation-dissociated 1 1 1
MIRT045133 LBP lipopolysaccharide binding protein 1 1
MIRT045134 ZNF512B zinc finger protein 512B 1 1
MIRT045135 MSL3 male-specific lethal 3 homolog (Drosophila) 1 1
MIRT045136 ACOT12 acyl-CoA thioesterase 12 1 1
MIRT045137 C17orf70 chromosome 17 open reading frame 70 1 1
MIRT045138 MAP7D1 MAP7 domain containing 1 1 1
MIRT045139 SOAT1 sterol O-acyltransferase 1 1 1
MIRT045140 NASP nuclear autoantigenic sperm protein (histone-binding) 1 1
MIRT045141 SPTY2D1 SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae) 1 1
MIRT045142 NID1 nidogen 1 1 1
MIRT045143 RNASEH1 ribonuclease H1 1 1
MIRT045144 XRCC1 X-ray repair complementing defective repair in Chinese hamster cells 1 1 1
MIRT045145 KDM3B lysine (K)-specific demethylase 3B 1 1
MIRT045146 HDGF hepatoma-derived growth factor 1 1
MIRT045147 HIST1H2BO histone cluster 1, H2bo 1 1
MIRT045148 PROCA1 protein interacting with cyclin A1 1 1
MIRT045149 DSP desmoplakin 1 1
MIRT045150 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 1 1
MIRT045151 HIST2H3A histone cluster 2, H3a 1 1
MIRT045152 CBR1 carbonyl reductase 1 1 1
MIRT045153 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT045154 UTP11L UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast) 1 1
MIRT045155 MYLIP myosin regulatory light chain interacting protein 1 1
MIRT045156 COG2 component of oligomeric golgi complex 2 1 1
MIRT045157 DBN1 drebrin 1 1 1
MIRT045158 DDX42 DEAD (Asp-Glu-Ala-Asp) box polypeptide 42 1 1
MIRT045159 SNRNP35 small nuclear ribonucleoprotein 35kDa (U11/U12) 1 1
MIRT045160 SETD8 SET domain containing (lysine methyltransferase) 8 1 1
MIRT045161 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT045162 ARRB1 arrestin, beta 1 1 1
MIRT045163 PGAM1 phosphoglycerate mutase 1 (brain) 1 1
MIRT045164 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 1 1
MIRT045165 GCSAML germinal center-associated, signaling and motility-like 1 1
MIRT045166 SPTLC1 serine palmitoyltransferase, long chain base subunit 1 1 1
MIRT045167 CLK1 CDC-like kinase 1 1 1
MIRT045168 ANKZF1 ankyrin repeat and zinc finger domain containing 1 1 1
MIRT045169 ERCC3 excision repair cross-complementing rodent repair deficiency, complementation group 3 1 1
MIRT045170 RANBP10 RAN binding protein 10 1 1
MIRT045171 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 1
MIRT045172 SMN2 survival of motor neuron 2, centromeric 1 1
MIRT045173 RPS4X ribosomal protein S4, X-linked 1 1
MIRT045174 MZT2B mitotic spindle organizing protein 2B 1 1
MIRT045175 PPM1F protein phosphatase, Mg2+/Mn2+ dependent, 1F 1 1
MIRT045176 VPS13B vacuolar protein sorting 13 homolog B (yeast) 1 1
MIRT045177 SLC4A1AP solute carrier family 4 (anion exchanger), member 1, adaptor protein 1 1
MIRT045178 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 3
MIRT045179 FAM177A1 family with sequence similarity 177, member A1 1 1
MIRT045180 RNF149 ring finger protein 149 1 1
MIRT045181 FAM57A family with sequence similarity 57, member A 1 1
MIRT045182 HNRNPL heterogeneous nuclear ribonucleoprotein L 1 1
MIRT045183 DLG3 discs, large homolog 3 (Drosophila) 1 1
MIRT045184 RBM8A RNA binding motif protein 8A 1 1
MIRT045185 DCAF16 DDB1 and CUL4 associated factor 16 1 1
MIRT045186 EMC2 ER membrane protein complex subunit 2 1 1
MIRT045187 VPS45 vacuolar protein sorting 45 homolog (S. cerevisiae) 1 1
MIRT045188 AMBRA1 autophagy/beclin-1 regulator 1 1 1
MIRT045189 STOX2 storkhead box 2 1 1
MIRT045190 DHPS deoxyhypusine synthase 1 1
MIRT045191 TOP2A topoisomerase (DNA) II alpha 170kDa 1 1
MIRT045192 TRAP1 TNF receptor-associated protein 1 1 1
MIRT045193 SLC25A13 solute carrier family 25 (aspartate/glutamate carrier), member 13 1 1
MIRT045194 EIF3G eukaryotic translation initiation factor 3, subunit G 1 1
MIRT045195 RNF113A ring finger protein 113A 1 1
MIRT045196 MTSS1L metastasis suppressor 1-like 1 1
MIRT045197 TEX261 testis expressed 261 1 1
MIRT045198 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 1 1
MIRT045199 SRPK1 SRSF protein kinase 1 1 1
MIRT045200 TUFM Tu translation elongation factor, mitochondrial 1 1
MIRT045201 CDT1 chromatin licensing and DNA replication factor 1 1 1
MIRT045202 MED15 mediator complex subunit 15 1 1
MIRT045203 RPL29 ribosomal protein L29 1 1
MIRT045204 UBE2E3 ubiquitin-conjugating enzyme E2E 3 1 1
MIRT045205 RPS2 ribosomal protein S2 1 1
MIRT045206 ZNF629 zinc finger protein 629 1 1
MIRT045207 RPL9 ribosomal protein L9 1 1
MIRT045208 CD2AP CD2-associated protein 1 1
MIRT045209 COX17 cytochrome c oxidase assembly homolog 17 (yeast) 1 1
MIRT045210 AHCTF1 AT hook containing transcription factor 1 1 1
MIRT045211 ABCF2 ATP-binding cassette, sub-family F (GCN20), member 2 1 1
MIRT045212 SUMO2 SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) 1 1
MIRT045213 NAA10 N(alpha)-acetyltransferase 10, NatA catalytic subunit 1 1
MIRT045214 TTI2 TELO2 interacting protein 2 1 1
MIRT045215 KHSRP KH-type splicing regulatory protein 1 1
MIRT045216 ZFP90 zinc finger protein 90 homolog (mouse) 1 1
MIRT045217 NCAPD3 non-SMC condensin II complex, subunit D3 1 1
MIRT045218 RPL7L1 ribosomal protein L7-like 1 1 1
MIRT045219 PLEKHM3 pleckstrin homology domain containing, family M, member 3 1 1
MIRT045220 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 1 1
MIRT045221 SMARCC2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 1 1
MIRT045222 LLGL1 lethal giant larvae homolog 1 (Drosophila) 1 1
MIRT045223 PEG10 paternally expressed 10 1 2
MIRT045224 CHTOP chromatin target of PRMT1 1 1
MIRT045225 KMT2C myeloid/lymphoid or mixed-lineage leukemia 3 1 1
MIRT045226 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT045227 CRNKL1 crooked neck pre-mRNA splicing factor-like 1 (Drosophila) 1 1
MIRT045228 RBFOX2 RNA binding protein, fox-1 homolog (C. elegans) 2 1 1
MIRT045229 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT045230 WEE1 WEE1 homolog (S. pombe) 1 1
MIRT045231 PLS1 plastin 1 1 1
MIRT045232 METTL21A methyltransferase like 21A 1 1
MIRT045233 TARSL2 threonyl-tRNA synthetase-like 2 1 1
MIRT045234 PSMD8 proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 1 1
MIRT045235 NXN nucleoredoxin 1 1
MIRT045236 UBE2E2 ubiquitin-conjugating enzyme E2E 2 1 1
MIRT045237 SLC6A6 solute carrier family 6 (neurotransmitter transporter, taurine), member 6 1 1
MIRT045238 CCT4 chaperonin containing TCP1, subunit 4 (delta) 1 1
MIRT045239 RNF167 ring finger protein 167 1 1
MIRT045240 CCAR1 cell division cycle and apoptosis regulator 1 1 1
MIRT045241 GUCY1B3 guanylate cyclase 1, soluble, beta 3 1 1
MIRT045242 NENF neudesin neurotrophic factor 1 1
MIRT045243 ZNF80 zinc finger protein 80 1 1
MIRT045244 RANBP2 RAN binding protein 2 1 1
MIRT045245 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT045246 ULK1 unc-51-like kinase 1 (C. elegans) 1 1
MIRT045247 IKBIP IKBKB interacting protein 1 1
MIRT045248 TLN1 talin 1 1 1
MIRT045249 SIN3B SIN3 transcription regulator homolog B (yeast) 1 1
MIRT045250 ALDH16A1 aldehyde dehydrogenase 16 family, member A1 1 1
MIRT045251 ARHGAP39 Rho GTPase activating protein 39 1 1
MIRT045252 CNOT6L CCR4-NOT transcription complex, subunit 6-like 1 1
MIRT045253 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT045254 ARL6IP4 ADP-ribosylation-like factor 6 interacting protein 4 1 1
MIRT045255 ZNF793 zinc finger protein 793 1 1
MIRT045256 HNRNPU heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A) 1 2
MIRT045257 ZNF324 zinc finger protein 324 1 1
MIRT045258 AGO2 eukaryotic translation initiation factor 2C, 2 1 3
MIRT045259 MYSM1 Myb-like, SWIRM and MPN domains 1 1 1
MIRT045260 PSMD13 proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 1 1
MIRT045261 PSME1 proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) 1 1
MIRT045262 PPAPDC1A phosphatidic acid phosphatase type 2 domain containing 1A 1 1
MIRT045263 ZNF214 zinc finger protein 214 1 1
MIRT045264 NDUFA2 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa 1 1
MIRT045265 PPRC1 peroxisome proliferator-activated receptor gamma, coactivator-related 1 1 1
MIRT045266 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) 1 1
MIRT045267 FOCAD focadhesin 1 1
MIRT045268 KIF21A kinesin family member 21A 1 1
MIRT045269 STARD8 StAR-related lipid transfer (START) domain containing 8 1 1
MIRT045270 DDB1 damage-specific DNA binding protein 1, 127kDa 1 1
MIRT045271 RRM2 ribonucleotide reductase M2 1 1
MIRT045272 CEBPG CCAAT/enhancer binding protein (C/EBP), gamma 1 1
MIRT045273 SSR2 signal sequence receptor, beta (translocon-associated protein beta) 1 1
MIRT045274 INPP5F inositol polyphosphate-5-phosphatase F 1 1
MIRT045275 PDAP1 PDGFA associated protein 1 1 1
MIRT045276 RRP1B ribosomal RNA processing 1 homolog B (S. cerevisiae) 1 1
MIRT045277 KIAA0020 KIAA0020 1 1
MIRT045278 ANKRD11 ankyrin repeat domain 11 1 1
MIRT045279 RPL27 ribosomal protein L27 1 1
MIRT045280 SYNJ2BP synaptojanin 2 binding protein 1 1
MIRT045281 MINK1 misshapen-like kinase 1 1 1
MIRT045282 JUND jun D proto-oncogene 1 1
MIRT045283 PLXNA1 plexin A1 1 1
MIRT045284 BICD1 bicaudal D homolog 1 (Drosophila) 1 1
MIRT045285 MRPS16 mitochondrial ribosomal protein S16 1 1
MIRT045286 USP19 ubiquitin specific peptidase 19 1 1
MIRT045287 MDH1 malate dehydrogenase 1, NAD (soluble) 1 1
MIRT045288 AKR1A1 aldo-keto reductase family 1, member A1 (aldehyde reductase) 1 1
MIRT045289 MAVS mitochondrial antiviral signaling protein 1 1
MIRT045290 PSMD2 proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 1 1
MIRT045291 NOL8 nucleolar protein 8 1 1
MIRT045292 MDN1 MDN1, midasin homolog (yeast) 1 1
MIRT045293 CAD carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase 1 1
MIRT045294 ZDHHC6 zinc finger, DHHC-type containing 6 1 1
MIRT045295 MYO19 myosin XIX 1 1
MIRT045296 BTF3L4 basic transcription factor 3-like 4 1 1
MIRT045297 SRSF11 serine/arginine-rich splicing factor 11 1 1
MIRT045298 DPYSL5 dihydropyrimidinase-like 5 1 1
MIRT045299 RNPEP arginyl aminopeptidase (aminopeptidase B) 1 1
MIRT045300 CUEDC2 CUE domain containing 2 1 1
MIRT045301 NSD1 nuclear receptor binding SET domain protein 1 1 1
MIRT045302 FNIP2 folliculin interacting protein 2 1 1
MIRT045303 THOC1 THO complex 1 1 1
MIRT045304 RBM27 RNA binding motif protein 27 1 1
MIRT045305 SETD7 SET domain containing (lysine methyltransferase) 7 1 1
MIRT045306 NGLY1 N-glycanase 1 1 1
MIRT045307 TCP1 t-complex 1 1 1
MIRT045308 SPECC1L sperm antigen with calponin homology and coiled-coil domains 1-like 1 1
MIRT045309 ZNF516 zinc finger protein 516 1 1
MIRT045310 GGPS1 geranylgeranyl diphosphate synthase 1 1 1
MIRT045311 RBM10 RNA binding motif protein 10 1 1
MIRT057803 SLC30A7 solute carrier family 30 (zinc transporter), member 7 1 1
MIRT058020 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 1 2
MIRT075399 ZFHX3 zinc finger homeobox 3 1 1
MIRT093149 NAA15 N(alpha)-acetyltransferase 15, NatA auxiliary subunit 1 3
MIRT107790 SLC1A1 solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 1 1
MIRT171356 PHTF2 putative homeodomain transcription factor 2 1 1
MIRT192480 KNSTRN chromosome 15 open reading frame 23 1 1
MIRT207304 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 1 3
MIRT235833 FAM217B family with sequence similarity 217, member B 1 1
MIRT240364 RAB2A RAB2A, member RAS oncogene family 1 1
MIRT240846 PLS3 plastin 3 1 1
MIRT258390 KIAA0895 KIAA0895 1 1
MIRT264776 PAFAH1B2 platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) 1 2
MIRT270749 TMED2 transmembrane emp24 domain trafficking protein 2 1 1
MIRT271336 ADIPOR2 adiponectin receptor 2 1 2
MIRT272742 ALG10B asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast) 1 1
MIRT286706 CDK5R1 cyclin-dependent kinase 5, regulatory subunit 1 (p35) 1 2
MIRT309169 SPATA5 spermatogenesis associated 5 1 2
MIRT336555 SDE2 SDE2 telomere maintenance homolog (S. pombe) 1 1
MIRT357419 HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 1 2
MIRT365281 PSAT1 phosphoserine aminotransferase 1 1 1
MIRT437949 TERF2IP telomeric repeat binding factor 2, interacting protein 1 1
MIRT438453 NCSTN nicastrin 1 1
MIRT441452 MTX3 metaxin 3 1 1
MIRT441510 ERN1 endoplasmic reticulum to nucleus signaling 1 1 1
MIRT441579 EXOC5 exocyst complex component 5 1 1
MIRT441587 POLR1B polymerase (RNA) I polypeptide B, 128kDa 1 1
MIRT441723 HAUS6 HAUS augmin-like complex, subunit 6 1 1
MIRT441734 SEPT8 septin 8 1 1
MIRT441864 TEX35 testis expressed 35 1 1
MIRT442179 TRIM59 tripartite motif containing 59 1 2
MIRT442276 TLX3 T-cell leukemia homeobox 3 1 1
MIRT442488 TBC1D19 TBC1 domain family, member 19 1 1
MIRT442830 AZIN1 antizyme inhibitor 1 1 1
MIRT443211 VPS36 vacuolar protein sorting 36 homolog (S. cerevisiae) 1 1
MIRT443241 ANKRD26 ankyrin repeat domain 26 1 1
MIRT443269 ZWINT ZW10 interactor 1 1
MIRT443493 ZNF583 zinc finger protein 583 1 1
MIRT444113 CEPT1 choline/ethanolamine phosphotransferase 1 1 1
MIRT445849 FPGT fucose-1-phosphate guanylyltransferase 1 1
MIRT446050 CDC73 cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT446420 ABHD2 abhydrolase domain containing 2 1 1
MIRT446573 ZSCAN16 zinc finger and SCAN domain containing 16 1 1
MIRT447652 RAB3GAP1 RAB3 GTPase activating protein subunit 1 (catalytic) 1 1
MIRT447888 ERI1 exoribonuclease 1 1 1
MIRT448331 UPF1 UPF1 regulator of nonsense transcripts homolog (yeast) 1 1
MIRT449563 GPC5 glypican 5 1 1
MIRT459812 POTED POTE ankyrin domain family, member D 1 4
MIRT461691 ZNF426 zinc finger protein 426 1 1
MIRT462013 SNRNP27 small nuclear ribonucleoprotein 27kDa (U4/U6.U5) 1 1
MIRT465149 TSC22D2 TSC22 domain family, member 2 1 1
MIRT466399 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT467143 SREK1IP1 SREK1-interacting protein 1 1 1
MIRT469277 RHOB ras homolog family member B 1 4
MIRT476845 FIGN fidgetin 1 5
MIRT477337 EPHA2 EPH receptor A2 1 1
MIRT477852 DYRK3 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 1 1
MIRT481112 B2M beta-2-microglobulin 1 1
MIRT481295 ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 1 5
MIRT485093 SLC30A1 solute carrier family 30 (zinc transporter), member 1 1 2
MIRT492457 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT493340 LAPTM4A lysosomal protein transmembrane 4 alpha 1 6
MIRT494516 BDNF-AS BDNF antisense RNA 1 1
MIRT498995 HAT1 histone acetyltransferase 1 1 5
MIRT500066 SFT2D2 SFT2 domain containing 2 1 2
MIRT502381 GCC2 GRIP and coiled-coil domain containing 2 1 3
MIRT502726 CNOT6 CCR4-NOT transcription complex, subunit 6 1 1
MIRT503083 BTG2 BTG family, member 2 1 2
MIRT503271 SLC7A5 solute carrier family 7 (amino acid transporter light chain, L system), member 5 1 1
MIRT504006 SAT1 spermidine/spermine N1-acetyltransferase 1 1 2
MIRT504405 CSDE1 cold shock domain containing E1, RNA-binding 1 3
MIRT505452 SUGT1 SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae) 1 3
MIRT508173 FRK fyn-related kinase 1 2
MIRT509231 KIF14 kinesin family member 14 1 3
MIRT509480 GNL3L guanine nucleotide binding protein-like 3 (nucleolar)-like 1 3
MIRT509529 INTU inturned planar cell polarity effector homolog (Drosophila) 1 3
MIRT509547 BTLA B and T lymphocyte associated 1 4
MIRT510741 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 1 3
MIRT510901 PURG purine-rich element binding protein G 1 3
MIRT510910 PTGES3 prostaglandin E synthase 3 (cytosolic) 1 2
MIRT511329 KIAA1522 KIAA1522 1 2
MIRT513827 LZIC leucine zipper and CTNNBIP1 domain containing 1 2
MIRT514754 ACER3 alkaline ceramidase 3 1 4
MIRT515763 KRTAP5-6 keratin associated protein 5-6 1 1
MIRT517391 TBK1 TANK-binding kinase 1 1 2
MIRT521782 PPIG peptidylprolyl isomerase G (cyclophilin G) 1 4
MIRT521922 PHIP pleckstrin homology domain interacting protein 1 2
MIRT522888 KDELR1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 1 1
MIRT524064 DNAJC8 DnaJ (Hsp40) homolog, subfamily C, member 8 1 1
MIRT525148 ZNF256 zinc finger protein 256 1 1
MIRT525940 C11orf74 chromosome 11 open reading frame 74 1 1
MIRT526304 C7orf73 chromosome 7 open reading frame 73 1 1
MIRT526875 ERCC8 excision repair cross-complementing rodent repair deficiency, complementation group 8 1 1
MIRT527548 DLGAP5 discs, large (Drosophila) homolog-associated protein 5 1 2
MIRT527605 ANKRD42 ankyrin repeat domain 42 1 1
MIRT527802 KLRD1 killer cell lectin-like receptor subfamily D, member 1 1 1
MIRT528396 PGK1 phosphoglycerate kinase 1 1 1
MIRT529672 SLC28A1 solute carrier family 28 (sodium-coupled nucleoside transporter), member 1 1 1
MIRT530357 HPSE heparanase 1 1
MIRT530907 KIAA1161 KIAA1161 1 1
MIRT531168 ZNF333 zinc finger protein 333 1 1
MIRT531202 PLA2G4D phospholipase A2, group IVD (cytosolic) 1 1
MIRT531561 CENPC1P1 centromere protein C 1 pseudogene 1 1 1
MIRT532782 LDHD lactate dehydrogenase D 1 1
MIRT532847 ZNF699 zinc finger protein 699 1 1
MIRT533259 VCAM1 vascular cell adhesion molecule 1 1 1
MIRT533770 TMEM135 transmembrane protein 135 1 1
MIRT535316 PHC3 polyhomeotic homolog 3 (Drosophila) 1 1
MIRT536222 LRRC41 leucine rich repeat containing 41 1 1
MIRT536926 HEMK1 HemK methyltransferase family member 1 1 1
MIRT537416 FBXO47 F-box protein 47 1 1
MIRT538664 CCSAP centriole, cilia and spindle-associated protein 1 1
MIRT539340 AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon) 1 1
MIRT540290 RGR retinal G protein coupled receptor 1 2
MIRT543331 KIAA1456 KIAA1456 1 1
MIRT543391 CC2D2A coiled-coil and C2 domain containing 2A 1 1
MIRT543890 AIMP1 aminoacyl tRNA synthetase complex-interacting multifunctional protein 1 1 1
MIRT544996 MFF mitochondrial fission factor 1 2
MIRT545608 SIGLEC9 sialic acid binding Ig-like lectin 9 1 1
MIRT545913 ZFP91 zinc finger protein 91 homolog (mouse) 1 2
MIRT546688 RORA RAR-related orphan receptor A 1 2
MIRT547394 MOB1A MOB kinase activator 1A 1 1
MIRT548049 GOLIM4 golgi integral membrane protein 4 1 1
MIRT549456 ACSL4 acyl-CoA synthetase long-chain family member 4 1 1
MIRT550406 SLC29A1 solute carrier family 29 (nucleoside transporters), member 1 1 2
MIRT550566 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 1 2
MIRT550920 SIGLEC14 sialic acid binding Ig-like lectin 14 1 1
MIRT551196 GAB2 GRB2-associated binding protein 2 1 1
MIRT552221 LINC00598 long intergenic non-protein coding RNA 598 1 2
MIRT552715 YTHDF1 YTH domain family, member 1 1 1
MIRT552742 YRDC yrdC domain containing (E. coli) 1 1
MIRT552943 VKORC1L1 vitamin K epoxide reductase complex, subunit 1-like 1 1 1
MIRT554716 RNF146 ring finger protein 146 1 1
MIRT555751 PDCD10 programmed cell death 10 1 1
MIRT557338 HHIP hedgehog interacting protein 1 1
MIRT558599 CREBL2 cAMP responsive element binding protein-like 2 1 1
MIRT559226 BLMH bleomycin hydrolase 1 1
MIRT559935 PHEX phosphate regulating endopeptidase homolog, X-linked 1 1
MIRT560712 ZNF324B zinc finger protein 324B 1 1
MIRT561189 TNFRSF10A tumor necrosis factor receptor superfamily, member 10a 1 1
MIRT561816 NUP50 nucleoporin 50kDa 1 1
MIRT562017 LCLAT1 lysocardiolipin acyltransferase 1 1 1
MIRT562136 IGFBP5 insulin-like growth factor binding protein 5 1 1
MIRT562846 LINC00346 long intergenic non-protein coding RNA 346 1 1
MIRT563251 SETD6 SET domain containing 6 1 1
MIRT564000 THAP2 THAP domain containing, apoptosis associated protein 2 1 1
MIRT564382 BAAT bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase) 1 1
MIRT566551 PANK3 pantothenate kinase 3 1 1
MIRT567644 EXT1 exostosin 1 1 1
MIRT567946 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 1 1
MIRT568060 CHERP calcium homeostasis endoplasmic reticulum protein 1 1
MIRT568233 C11orf24 chromosome 11 open reading frame 24 1 1
MIRT572226 BTN3A3 butyrophilin, subfamily 3, member A3 1 1
MIRT573573 RANBP1 RAN binding protein 1 1 1
MIRT573612 COX6A1P2 cytochrome c oxidase subunit VIa polypeptide 1 pseudogene 2 1 1
MIRT573882 GBP2 guanylate binding protein 2, interferon-inducible 1 1
MIRT574288 COX6A1 cytochrome c oxidase subunit VIa polypeptide 1 1 1
MIRT574379 YY1 YY1 transcription factor 1 1
MIRT576840 Tgfbr3 transforming growth factor, beta receptor III 1 1
MIRT613141 DSEL dermatan sulfate epimerase-like 1 1
MIRT616660 ORAI1 ORAI calcium release-activated calcium modulator 1 1 1
MIRT619344 SASH1 SAM and SH3 domain containing 1 1 1
MIRT628340 CCDC80 coiled-coil domain containing 80 1 1
MIRT640657 FRY furry homolog (Drosophila) 1 1
MIRT641082 TGIF1 TGFB-induced factor homeobox 1 1 1
MIRT641528 SLC30A4 solute carrier family 30 (zinc transporter), member 4 1 1
MIRT642080 FUT11 fucosyltransferase 11 (alpha (1,3) fucosyltransferase) 1 1
MIRT644828 DNAJC21 DnaJ (Hsp40) homolog, subfamily C, member 21 1 1
MIRT648181 TBCA tubulin folding cofactor A 1 1
MIRT652464 TMEM2 transmembrane protein 2 1 1
MIRT653382 SMAD1 SMAD family member 1 1 1
MIRT654286 RCAN3 RCAN family member 3 1 1
MIRT658432 FAM175B family with sequence similarity 175, member B 1 1
MIRT659569 CGGBP1 CGG triplet repeat binding protein 1 1 1
MIRT675308 CD3EAP CD3e molecule, epsilon associated protein 1 1
MIRT675456 SRP19 signal recognition particle 19kDa 1 1
MIRT687827 ITGB8 integrin, beta 8 1 1
MIRT697295 ZNF654 zinc finger protein 654 1 1
MIRT699803 SEC24A SEC24 family, member A (S. cerevisiae) 1 1
MIRT702001 MIER3 mesoderm induction early response 1, family member 3 1 1
MIRT704866 CD164 CD164 molecule, sialomucin 1 1
MIRT705308 AVL9 AVL9 homolog (S. cerevisiase) 1 1
MIRT705322 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT709330 CLEC12B C-type lectin domain family 12, member B 1 1
MIRT712320 PER2 period homolog 2 (Drosophila) 1 1
MIRT713816 XRCC2 X-ray repair complementing defective repair in Chinese hamster cells 2 1 1
MIRT715956 PODXL podocalyxin-like 1 1
MIRT717157 LRRC3C leucine rich repeat containing 3C 1 1
MIRT717256 SLC44A1 solute carrier family 44, member 1 1 1
MIRT719955 BLOC1S6 biogenesis of lysosomal organelles complex-1, subunit 6, pallidin 1 1
MIRT719964 SAMD15 sterile alpha motif domain containing 15 1 1
MIRT725407 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*