Accession ID: MIRT045611 [miRNA, hsa-miR-149-5p :: EWSR1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-149LinkOut: [miRBase ]
Description Homo sapiens miR-149 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-149-5p
Mature Sequence 15| UCUGGCUCCGUGUCUUCACUCCC |37
Evidence Experimental
Experiments Cloned
Putative hsa-miR-149-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol EWSR1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms EWS, bK984G1.4
Description Ewing sarcoma breakpoint region 1
Transcript NM_0011632    LinkOut: [ RefSeq ]
Other Transcripts NM_0011632 , NM_0011632 , NM_0052 , NM_0139   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on EWSR1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of EWSR1
(miRNA target sites are highlighted)
>EWSR1|NM_0011632|3'UTR
   1 TAGATGCAGAGACCCCGCAGAGCTGCATTGACTACCAGATTTATTTTTTAAACCAGAAAATGTTTTAAATTTATAATTCC
  81 ATATTTATAATGTTGGCCACAACATTATGATTATTCCTTGTCTGTACTTTAGTATTTTTCACCATTTGTGAAGAAACATT
 161 AAAACAAGTTAAATGGTAGTGTGCGGAGTTTTTTTTTCTTCCTTCTTTTAAAAATGGTTGTTTAAGACTTTAACAATGGG
 241 AACCCCTTGTGAGCATGCTCAGTATCATTGTGGAGAACCAAGAGGGCCTCTTAACTGTAACAATGTTCATGGTTGTGATG
 321 TTTTTTTTTTTTTTTTAAATAAAATTCCAAATGTTTATAAAGAGTCAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cccUCACUUCUGUGCCUCGGUcu 5'
             | ||   |:|  |||:||  
Target 5' ccaAATGTTTATAAAGAGTCAaa 3'
347 - 369 112.00 -6.10
2
miRNA  3' cccuCACUUCU--GUGC-CUCGGucu 5'
              |||:|||  || | |:|||   
Target 5' cattGTGGAGAACCAAGAGGGCCtct 3'
266 - 291 109.00 -13.92
3
miRNA  3' cccUCACUUCUGUGCCUCGGUcu 5'
             || ||   |:| ||||::  
Target 5' tgcAGAGACCCCGCAGAGCTGca 3'
5 - 27 104.00 -8.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-149-5p :: EWSR1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' ccCTCACTTCTGTGCCTCGGTCt 5'
            ||| ||||||   ||| ::| 
Target 5' tgGAG-GAAGAC---GAGGTGGc 3'
5 - 23
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
308 hsa-miR-149-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT007014 SP1 Sp1 transcription factor 1 2
MIRT045388 SCYL3 SCY1-like 3 (S. cerevisiae) 1 1
MIRT045389 NUP98 nucleoporin 98kDa 1 1
MIRT045390 DYNC1H1 dynein, cytoplasmic 1, heavy chain 1 1 1
MIRT045391 RPL15 ribosomal protein L15 1 1
MIRT045392 CDK5RAP2 CDK5 regulatory subunit associated protein 2 1 1
MIRT045393 ATAD3A ATPase family, AAA domain containing 3A 1 1
MIRT045394 HNRNPH1 heterogeneous nuclear ribonucleoprotein H1 (H) 1 1
MIRT045395 KHSRP KH-type splicing regulatory protein 1 1
MIRT045396 PIGB phosphatidylinositol glycan anchor biosynthesis, class B 1 1
MIRT045397 FAM98B family with sequence similarity 98, member B 1 1
MIRT045398 RBBP6 retinoblastoma binding protein 6 1 1
MIRT045399 MED22 mediator complex subunit 22 1 1
MIRT045400 YBX1 Y box binding protein 1 1 1
MIRT045401 HIST2H2AA3 histone cluster 2, H2aa3 1 1
MIRT045402 ABL1 c-abl oncogene 1, receptor tyrosine kinase 1 1
MIRT045403 EEF1B2 eukaryotic translation elongation factor 1 beta 2 1 1
MIRT045404 C1orf35 chromosome 1 open reading frame 35 1 1
MIRT045405 TOX3 TOX high mobility group box family member 3 1 1
MIRT045406 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT045407 ZNHIT6 zinc finger, HIT type 6 1 1
MIRT045408 DYRK1B dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B 1 1
MIRT045409 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT045410 DNAJA3 DnaJ (Hsp40) homolog, subfamily A, member 3 1 1
MIRT045411 KIAA0355 KIAA0355 1 1
MIRT045412 CALD1 caldesmon 1 1 1
MIRT045413 HDAC7 histone deacetylase 7 1 1
MIRT045414 FPGS folylpolyglutamate synthase 1 1
MIRT045415 LDLR low density lipoprotein receptor 1 1
MIRT045416 ACLY ATP citrate lyase 1 1
MIRT045417 PARP1 poly (ADP-ribose) polymerase 1 1 1
MIRT045418 DGCR14 DiGeorge syndrome critical region gene 14 1 1
MIRT045419 USF1 upstream transcription factor 1 1 1
MIRT045420 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 1 1
MIRT045421 FXR1 fragile X mental retardation, autosomal homolog 1 1 1
MIRT045422 NECAP2 NECAP endocytosis associated 2 1 1
MIRT045423 RPS16 ribosomal protein S16 1 1
MIRT045424 POLR2E polymerase (RNA) II (DNA directed) polypeptide E, 25kDa 1 1
MIRT045425 CCT4 chaperonin containing TCP1, subunit 4 (delta) 1 1
MIRT045426 LRRFIP1 leucine rich repeat (in FLII) interacting protein 1 1 1
MIRT045427 MBTD1 mbt domain containing 1 1 1
MIRT045428 PSKH1 protein serine kinase H1 1 1
MIRT045429 KDM8 jumonji domain containing 5 1 1
MIRT045430 DDX23 DEAD (Asp-Glu-Ala-Asp) box polypeptide 23 1 1
MIRT045431 KIF1A kinesin family member 1A 1 1
MIRT045432 SLC2A1 solute carrier family 2 (facilitated glucose transporter), member 1 1 1
MIRT045433 MATR3 matrin 3 1 1
MIRT045434 RAPGEF2 Rap guanine nucleotide exchange factor (GEF) 2 1 1
MIRT045435 PPP4R1 protein phosphatase 4, regulatory subunit 1 1 1
MIRT045436 HSPA8 heat shock 70kDa protein 8 1 1
MIRT045437 SNRNP200 small nuclear ribonucleoprotein 200kDa (U5) 1 1
MIRT045438 ZNF346 zinc finger protein 346 1 1
MIRT045439 SBF1 SET binding factor 1 1 1
MIRT045440 ZSWIM8 KIAA0913 1 1
MIRT045441 SCAMP3 secretory carrier membrane protein 3 1 1
MIRT045442 RB1 retinoblastoma 1 1 1
MIRT045443 OSBPL8 oxysterol binding protein-like 8 1 1
MIRT045444 POLR3D polymerase (RNA) III (DNA directed) polypeptide D, 44kDa 1 1
MIRT045445 FAM208B chromosome 10 open reading frame 18 1 1
MIRT045446 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT045447 RAB5C RAB5C, member RAS oncogene family 1 1
MIRT045448 YTHDF1 YTH domain family, member 1 1 1
MIRT045449 SPAG5 sperm associated antigen 5 1 1
MIRT045450 EIF3C eukaryotic translation initiation factor 3, subunit C 1 1
MIRT045451 PSMD1 proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 1 1
MIRT045452 FOPNL chromosome 16 open reading frame 63 1 1
MIRT045453 HEATR2 HEAT repeat containing 2 1 1
MIRT045454 ATN1 atrophin 1 1 1
MIRT045455 FZD5 frizzled homolog 5 (Drosophila) 1 1
MIRT045456 NOC2L nucleolar complex associated 2 homolog (S. cerevisiae) 1 1
MIRT045457 FAF2 Fas associated factor family member 2 1 1
MIRT045458 MAN2A1 mannosidase, alpha, class 2A, member 1 1 1
MIRT045459 NRDE2 chromosome 14 open reading frame 102 1 1
MIRT045460 PRRC2C HLA-B associated transcript 2-like 2 1 1
MIRT045461 FKBP4 FK506 binding protein 4, 59kDa 1 1
MIRT045462 KLHDC3 kelch domain containing 3 1 1
MIRT045463 DCTN4 dynactin 4 (p62) 1 1
MIRT045464 EEF1D eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) 1 1
MIRT045465 AGAP3 ArfGAP with GTPase domain, ankyrin repeat and PH domain 3 1 1
MIRT045466 MYH9 myosin, heavy chain 9, non-muscle 1 1
MIRT045467 NSD1 nuclear receptor binding SET domain protein 1 1 1
MIRT045468 FHOD1 formin homology 2 domain containing 1 1 1
MIRT045469 EP300 E1A binding protein p300 1 1
MIRT045470 CNOT11 chromosome 2 open reading frame 29 1 1
MIRT045471 KNTC1 kinetochore associated 1 1 1
MIRT045472 DESI1 PPPDE peptidase domain containing 2 1 1
MIRT045473 RGS12 regulator of G-protein signaling 12 1 1
MIRT045474 SEPN1 selenoprotein N, 1 1 1
MIRT045475 EIF4B eukaryotic translation initiation factor 4B 1 1
MIRT045476 RPAIN RPA interacting protein 1 1
MIRT045477 ARMC10 armadillo repeat containing 10 1 1
MIRT045478 NSUN2 NOP2/Sun domain family, member 2 1 1
MIRT045479 C21orf58 chromosome 21 open reading frame 58 1 1
MIRT045480 COG1 component of oligomeric golgi complex 1 1 1
MIRT045481 POLD3 polymerase (DNA-directed), delta 3, accessory subunit 1 1
MIRT045482 TRIP12 thyroid hormone receptor interactor 12 1 1
MIRT045483 HNRNPU heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A) 1 1
MIRT045484 PHKA2 phosphorylase kinase, alpha 2 (liver) 1 1
MIRT045485 DDB1 damage-specific DNA binding protein 1, 127kDa 1 1
MIRT045486 ARRB2 arrestin, beta 2 1 1
MIRT045487 MARS2 methionyl-tRNA synthetase 2, mitochondrial 1 1
MIRT045488 KCTD20 potassium channel tetramerisation domain containing 20 1 1
MIRT045489 CSTF2 cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa 1 1
MIRT045490 ILF3 interleukin enhancer binding factor 3, 90kDa 1 1
MIRT045491 EDF1 endothelial differentiation-related factor 1 1 1
MIRT045492 LRRC16A leucine rich repeat containing 16A 1 1
MIRT045493 ZNF276 zinc finger protein 276 1 1
MIRT045494 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT045495 HUWE1 HECT, UBA and WWE domain containing 1 1 1
MIRT045496 SEC23IP SEC23 interacting protein 1 1
MIRT045497 GPI glucose-6-phosphate isomerase 1 1
MIRT045498 MAD1L1 MAD1 mitotic arrest deficient-like 1 (yeast) 1 1
MIRT045499 PBX1 pre-B-cell leukemia homeobox 1 1 1
MIRT045500 YARS2 tyrosyl-tRNA synthetase 2, mitochondrial 1 1
MIRT045501 VAV3 vav 3 guanine nucleotide exchange factor 1 1
MIRT045502 CCT6A chaperonin containing TCP1, subunit 6A (zeta 1) 1 1
MIRT045503 HIPK2 homeodomain interacting protein kinase 2 1 1
MIRT045504 TRIP6 thyroid hormone receptor interactor 6 1 1
MIRT045505 SATB2 SATB homeobox 2 1 1
MIRT045506 LRRC41 leucine rich repeat containing 41 1 1
MIRT045507 PIK3C3 phosphoinositide-3-kinase, class 3 1 1
MIRT045508 ATP5G2 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9) 1 1
MIRT045509 M6PR mannose-6-phosphate receptor (cation dependent) 1 1
MIRT045510 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT045511 LEPREL2 leprecan-like 2 1 1
MIRT045512 KPNB1 karyopherin (importin) beta 1 1 1
MIRT045513 PQBP1 polyglutamine binding protein 1 1 1
MIRT045514 PLSCR3 phospholipid scramblase 3 1 1
MIRT045515 STAG1 stromal antigen 1 1 1
MIRT045516 C11orf95 chromosome 11 open reading frame 95 1 1
MIRT045517 PABPC3 poly(A) binding protein, cytoplasmic 3 1 1
MIRT045518 RCC1 regulator of chromosome condensation 1 1 1
MIRT045519 PABPC1 poly(A) binding protein, cytoplasmic 1 1 1
MIRT045520 LEPROTL1 leptin receptor overlapping transcript-like 1 1 1
MIRT045521 CBS cystathionine-beta-synthase 1 1
MIRT045522 ZNF318 zinc finger protein 318 1 1
MIRT045523 RAP1GAP2 RAP1 GTPase activating protein 2 1 1
MIRT045524 DMTN erythrocyte membrane protein band 4.9 (dematin) 1 1
MIRT045525 NELFB cofactor of BRCA1 1 1
MIRT045526 LRIG1 leucine-rich repeats and immunoglobulin-like domains 1 1 1
MIRT045527 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 1
MIRT045528 PLOD1 procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1 1 1
MIRT045529 FDFT1 farnesyl-diphosphate farnesyltransferase 1 1 1
MIRT045530 TKT transketolase 1 1
MIRT045531 HIST1H2AI histone cluster 1, H2ai 1 1
MIRT045532 KCTD2 potassium channel tetramerisation domain containing 2 1 1
MIRT045533 PPP6R2 SAPS domain family, member 2 1 1
MIRT045534 LTBP3 latent transforming growth factor beta binding protein 3 1 1
MIRT045535 DHX30 DEAH (Asp-Glu-Ala-His) box polypeptide 30 1 1
MIRT045536 UBE2E2 ubiquitin-conjugating enzyme E2E 2 (UBC4/5 homolog, yeast) 1 1
MIRT045537 ND6 NADH dehydrogenase, subunit 6 (complex I) 1 1
MIRT045538 SDC1 syndecan 1 1 1
MIRT045539 CENPB centromere protein B, 80kDa 1 1
MIRT045540 FBN2 fibrillin 2 1 1
MIRT045541 HES4 hairy and enhancer of split 4 (Drosophila) 1 1
MIRT045542 LGI2 leucine-rich repeat LGI family, member 2 1 1
MIRT045543 DBN1 drebrin 1 1 1
MIRT045544 ETS2 v-ets erythroblastosis virus E26 oncogene homolog 2 (avian) 1 1
MIRT045545 DCUN1D5 DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae) 1 1
MIRT045546 ZNF621 zinc finger protein 621 1 1
MIRT045547 E2F3 E2F transcription factor 3 1 1
MIRT045548 CALR calreticulin 1 1
MIRT045549 HDAC2 histone deacetylase 2 1 1
MIRT045550 PSMD8 proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 1 1
MIRT045551 ELMSAN1 chromosome 14 open reading frame 43 1 1
MIRT045552 SAR1A SAR1 homolog A (S. cerevisiae) 1 1
MIRT045553 SIGIRR single immunoglobulin and toll-interleukin 1 receptor (TIR) domain 1 1
MIRT045554 DDT D-dopachrome tautomerase 1 1
MIRT045555 SUPT5H suppressor of Ty 5 homolog (S. cerevisiae) 1 1
MIRT045556 RPL18A ribosomal protein L18a 1 1
MIRT045557 PLEKHO1 pleckstrin homology domain containing, family O member 1 1 1
MIRT045558 RAN RAN, member RAS oncogene family 1 1
MIRT045559 EIF4H eukaryotic translation initiation factor 4H 1 1
MIRT045560 WASH3P WAS protein family homolog 3 pseudogene 1 1
MIRT045561 ERAL1 Era G-protein-like 1 (E. coli) 1 1
MIRT045562 PSAP prosaposin 1 1
MIRT045563 TBC1D10B TBC1 domain family, member 10B 1 1
MIRT045564 ALYREF THO complex 4 1 1
MIRT045565 RBM7 RNA binding motif protein 7 1 1
MIRT045566 DCTN5 dynactin 5 (p25) 1 1
MIRT045567 NONO non-POU domain containing, octamer-binding 1 1
MIRT045568 NR2F1 nuclear receptor subfamily 2, group F, member 1 1 1
MIRT045569 AKT2 v-akt murine thymoma viral oncogene homolog 2 1 1
MIRT045570 KIF22 kinesin family member 22 1 1
MIRT045571 TRIM28 tripartite motif-containing 28 1 1
MIRT045572 UBE2S ubiquitin-conjugating enzyme E2S 1 1
MIRT045573 DNAJC19 DnaJ (Hsp40) homolog, subfamily C, member 19 1 1
MIRT045574 TTL tubulin tyrosine ligase 1 1
MIRT045575 USP15 ubiquitin specific peptidase 15 1 1
MIRT045576 SMS spermine synthase 1 1
MIRT045577 ESD esterase D 1 1
MIRT045578 FLNA filamin A, alpha 1 1
MIRT045579 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT045580 DHX9 DEAH (Asp-Glu-Ala-His) box polypeptide 9 1 1
MIRT045581 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT045582 PALM2 paralemmin 2 1 1
MIRT045583 FAM21C family with sequence similarity 21, member C 1 1
MIRT045584 FAM21B family with sequence similarity 21, member B 1 1
MIRT045585 GJA3 gap junction protein, alpha 3, 46kDa 1 1
MIRT045586 HOXD13 homeobox D13 1 1
MIRT045587 LRRC8A leucine rich repeat containing 8 family, member A 1 1
MIRT045588 COX1 cytochrome c oxidase subunit I 1 1
MIRT045589 RNPS1 RNA binding protein S1, serine-rich domain 1 1
MIRT045590 ITSN2 intersectin 2 1 1
MIRT045591 ESPL1 extra spindle pole bodies homolog 1 (S. cerevisiae) 1 1
MIRT045592 PTPRK protein tyrosine phosphatase, receptor type, K 1 1
MIRT045593 SIPA1L3 signal-induced proliferation-associated 1 like 3 1 1
MIRT045594 KIAA1462 KIAA1462 1 1
MIRT045595 CYFIP2 cytoplasmic FMR1 interacting protein 2 1 1
MIRT045596 AATF apoptosis antagonizing transcription factor 1 1
MIRT045597 MLX MAX-like protein X 1 1
MIRT045598 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 1 1
MIRT045599 SRSF1 splicing factor, arginine/serine-rich 1 1 1
MIRT045600 SNRPD2 small nuclear ribonucleoprotein D2 polypeptide 16.5kDa 1 1
MIRT045601 MID1 midline 1 (Opitz/BBB syndrome) 1 1
MIRT045602 TXN thioredoxin 1 1
MIRT045603 CTNNBL1 catenin, beta like 1 1 1
MIRT045604 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT045605 UBE2N ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast) 1 1
MIRT045606 HOXA10 homeobox A10 1 1
MIRT045607 TACC3 transforming, acidic coiled-coil containing protein 3 1 1
MIRT045608 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT045609 GIGYF1 GRB10 interacting GYF protein 1 1 1
MIRT045610 ANKRD11 ankyrin repeat domain 11 1 1
MIRT045611 EWSR1 Ewing sarcoma breakpoint region 1 1 1
MIRT045612 CSNK1E casein kinase 1, epsilon 1 1
MIRT045613 SMC1A structural maintenance of chromosomes 1A 1 1
MIRT045614 SERINC1 serine incorporator 1 1 1
MIRT045615 DNMT1 DNA (cytosine-5-)-methyltransferase 1 1 1
MIRT045616 GNA12 guanine nucleotide binding protein (G protein) alpha 12 1 1
MIRT045617 KANSL1 KIAA1267 1 1
MIRT045618 FOXK1 forkhead box K1 1 1
MIRT045619 GSK3A glycogen synthase kinase 3 alpha 1 1
MIRT045620 ZWINT ZW10 interactor 1 1
MIRT045621 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT045622 GCN1L1 GCN1 general control of amino-acid synthesis 1-like 1 (yeast) 1 1
MIRT045623 KIAA1967 KIAA1967 1 1
MIRT045624 C9orf41 chromosome 9 open reading frame 41 1 1
MIRT045625 GFPT2 glutamine-fructose-6-phosphate transaminase 2 1 1
MIRT045626 GLUL glutamate-ammonia ligase 1 1
MIRT045627 AGPAT3 1-acylglycerol-3-phosphate O-acyltransferase 3 1 1
MIRT045628 HECTD4 chromosome 12 open reading frame 51 1 1
MIRT045629 EZR ezrin 1 1
MIRT045630 PRPF6 PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae) 1 1
MIRT045631 EFCAB14 KIAA0494 1 1
MIRT045632 AKAP13 A kinase (PRKA) anchor protein 13 1 1
MIRT045633 OBSL1 obscurin-like 1 1 1
MIRT045634 LRRC42 leucine rich repeat containing 42 1 1
MIRT045635 NAT10 N-acetyltransferase 10 (GCN5-related) 1 1
MIRT045636 PITX1 paired-like homeodomain 1 1 1
MIRT045637 FBXL16 F-box and leucine-rich repeat protein 16 1 1
MIRT045638 SSR2 signal sequence receptor, beta (translocon-associated protein beta) 1 1
MIRT045639 FAM216A chromosome 12 open reading frame 24 1 1
MIRT045640 BIN3 bridging integrator 3 1 1
MIRT045641 NUP214 nucleoporin 214kDa 1 1
MIRT045642 MICAL1 microtubule associated monoxygenase, calponin and LIM domain containing 1 1 1
MIRT045643 CD3EAP CD3e molecule, epsilon associated protein 1 1
MIRT045644 NFIX nuclear factor I/X (CCAAT-binding transcription factor) 1 1
MIRT045645 TMEM59 transmembrane protein 59 1 1
MIRT045646 UXT ubiquitously-expressed transcript 1 1
MIRT045647 RPS9 ribosomal protein S9 1 1
MIRT045648 TNPO3 transportin 3 1 1
MIRT045649 ACTG1 actin, gamma 1 1 1
MIRT045650 HCFC1 host cell factor C1 (VP16-accessory protein) 1 1
MIRT045651 GRAMD4 GRAM domain containing 4 1 1
MIRT045652 WDR62 WD repeat domain 62 1 1
MIRT045653 LIG1 ligase I, DNA, ATP-dependent 1 1
MIRT045654 NUDCD3 NudC domain containing 3 1 1
MIRT045655 ZNF385A zinc finger protein 385A 1 1
MIRT045656 YIPF5 Yip1 domain family, member 5 1 1
MIRT045657 TMEM237 amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4 1 1
MIRT045658 TRAP1 TNF receptor-associated protein 1 1 1
MIRT045659 ARPC2 actin related protein 2/3 complex, subunit 2, 34kDa 1 1
MIRT045660 WNK1 WNK lysine deficient protein kinase 1 1 1
MIRT045661 BID BH3 interacting domain death agonist 1 1
MIRT045662 AGPAT6 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta) 1 1
MIRT045663 IFI30 interferon, gamma-inducible protein 30 1 1
MIRT045664 RPL18 ribosomal protein L18 1 1
MIRT045665 CNTROB centrobin, centrosomal BRCA2 interacting protein 1 1
MIRT045666 NOMO3 NODAL modulator 3 1 1
MIRT045667 ZNF146 zinc finger protein 146 1 1
MIRT045668 RPLP0 ribosomal protein, large, P0 1 1
MIRT045669 MSRB1 selenoprotein X, 1 1 1
MIRT045670 TMEM50A transmembrane protein 50A 1 1
MIRT045671 GOLIM4 golgi integral membrane protein 4 1 1
MIRT045672 PFKL phosphofructokinase, liver 1 1
MIRT045673 SPHK2 sphingosine kinase 2 1 1
MIRT045674 ILF2 interleukin enhancer binding factor 2, 45kDa 1 1
MIRT045675 HARS histidyl-tRNA synthetase 1 1
MIRT045676 NACA nascent polypeptide-associated complex alpha subunit 1 1
MIRT045677 DCTN2 dynactin 2 (p50) 1 1
MIRT045678 RAVER2 ribonucleoprotein, PTB-binding 2 1 1
MIRT045679 RFC2 replication factor C (activator 1) 2, 40kDa 1 1
MIRT045680 NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) 1 1
MIRT045681 RRP1 ribosomal RNA processing 1 homolog (S. cerevisiae) 1 1
MIRT045682 FSTL1 follistatin-like 1 1 1
MIRT045683 CEP170B KIAA0284 1 1
MIRT045684 PEX6 peroxisomal biogenesis factor 6 1 1
MIRT045685 KIF1C kinesin family member 1C 1 1
MIRT045686 BTBD9 BTB (POZ) domain containing 9 1 1
MIRT045687 PPP4C protein phosphatase 4, catalytic subunit 1 1
MIRT045688 LIG3 ligase III, DNA, ATP-dependent 1 1
MIRT045689 DCAF13 DDB1 and CUL4 associated factor 13 1 1
MIRT045690 BIRC5 baculoviral IAP repeat-containing 5 1 1
MIRT045691 TCF20 transcription factor 20 (AR1) 1 1
MIRT045692 NGRN neugrin, neurite outgrowth associated 1 1
MIRT045693 JUN jun oncogene 1 1
MIRT052645 FOXM1 forkhead box M1 2 1