Accession ID: MIRT045817 [miRNA, hsa-miR-191-5p :: GBA, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-191LinkOut: [miRBase ]
Synonyms MIRN191, miR-191, MIR191
Description Homo sapiens miR-191 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-191-5p
Mature Sequence 16| CAACGGAAUCCCAAAAGCAGCUG |38
Evidence Experimental
Experiments Cloned
Putative hsa-miR-191-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol GBA LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms GBA1, GCB, GLUC
Description glucosidase, beta, acid
Transcript NM_0011718    LinkOut: [ RefSeq ]
Other Transcripts NM_0010057 , NM_0010057 , NM_0001 , NM_0011718   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on GBA LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of GBA
(miRNA target sites are highlighted)
>GBA|NM_0011718|3'UTR
   1 TGATGGAGCAGATACTCAAGGAGGCACTGGGCTCAGCCTGGGCATTAAAGGGACAGAGTCAGCTCACACGCTGTCTGTGA
  81 CTAAAGAGGGCACAGCAGGGCCAGTGTGAGCTTACAGCGACGTAAGCCCAGGGGCAATGGTTTGGGTGACTCACTTTCCC
 161 CTCTAGGTGGTGCCAGGGGCTGGAGGCCCCTAGAAAAAGATCAGTAAGCCCCAGTGTCCCCCCAGCCCCCATGCTTATGT
 241 GAACATGCGCTGTGTGCTGCTTGCTTTGGAAACTGGGCCTGGGTCCAGGCCTAGGGTGAGCTCACTGTCCGTACAAACAC
 321 AAGATCAGGGCTGAGGGTAAGGAAAAGAAGAGACTAGGAAAGCTGGGCCCAAAACTGGAGACTGTTTGTCTTTCCTGGAG
 401 ATGCAGAACTGGGCCCGTGGAGCAGCAGTGTCAGCATCAGGGCGGAAGCCTTAAAGCAGCAGCGGGTGTGCCCAGGCACC
 481 CAGATGATTCCTATGGCACCAGCCAGGAAAAATGGCAGCTCTTAAAGGAGAAAATGTTTGAGCCCAGTCA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gucgacgaaaacccuaAGGCAac 5'
                          |||||  
Target 5' tagggtgagctcactgTCCGTac 3'
292 - 314 100.00 -8.50
2
miRNA  3' gucGACGAAAACCCUAAGGcaac 5'
             |||  ||||   ||||    
Target 5' agaCTG--TTTGTCTTTCCtgga 3'
379 - 399 96.00 -8.80
3
miRNA  3' gucgACGAAAACC-CU------AAGGcaac 5'
              || ||| || ||      ||||    
Target 5' gcaaTGGTTTGGGTGACTCACTTTCCcctc 3'
134 - 163 93.00 -7.26
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-191-5p :: GBA    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 5'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gtCGACGAAAACCCTAAGGCAAc 5'
            |||||   |||||||:|||| 
Target 5' agGCTGC-GGTGGGATTTCGTTt 3'
5 - 26
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
46 hsa-miR-191-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004688 TMC7 transmembrane channel-like 7 4 1
MIRT004689 IL1A interleukin 1, alpha 4 1
MIRT004691 SOX4 SRY (sex determining region Y)-box 4 4 1
MIRT006120 NDST1 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 3 1
MIRT006570 MDM4 Mdm4 p53 binding protein homolog (mouse) 1 1
MIRT006697 Cdk6 cyclin-dependent kinase 6 3 1
MIRT006721 CDK6 cyclin-dependent kinase 6 3 1
MIRT006722 SATB1 SATB homeobox 1 3 2
MIRT021488 TLE1 transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) 1 1
MIRT021489 PI4KB phosphatidylinositol 4-kinase, catalytic, beta 1 1
MIRT021490 TNPO2 transportin 2 1 1
MIRT021491 MPST mercaptopyruvate sulfurtransferase 1 1
MIRT045784 TMEM33 transmembrane protein 33 1 1
MIRT045785 RPL37 ribosomal protein L37 1 1
MIRT045786 ACSS1 acyl-CoA synthetase short-chain family member 1 1 1
MIRT045787 MTSS1L metastasis suppressor 1-like 1 1
MIRT045788 PSMA2 proteasome (prosome, macropain) subunit, alpha type, 2 1 1
MIRT045789 IRS4 insulin receptor substrate 4 1 1
MIRT045790 UHRF1 ubiquitin-like with PHD and ring finger domains 1 1 1
MIRT045791 PDHA1 pyruvate dehydrogenase (lipoamide) alpha 1 1 1
MIRT045792 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT045793 EIF3I eukaryotic translation initiation factor 3, subunit I 1 1
MIRT045794 AGL amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase 1 1
MIRT045795 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 1 1
MIRT045796 ATF6 activating transcription factor 6 1 1
MIRT045797 BCOR BCL6 corepressor 1 1
MIRT045798 BZW2 basic leucine zipper and W2 domains 2 1 1
MIRT045799 PPIAL4G peptidylprolyl isomerase A (cyclophilin A)-like 4G 1 1
MIRT045800 RABL6 chromosome 9 open reading frame 86 1 1
MIRT045801 RRN3 RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae) 1 1
MIRT045802 GOLGA7 golgin A7 1 1
MIRT045803 BRAF v-raf murine sarcoma viral oncogene homolog B1 1 1
MIRT045804 PSAP prosaposin 1 1
MIRT045805 HNRNPM heterogeneous nuclear ribonucleoprotein M 1 1
MIRT045806 CYTH2 cytohesin 2 1 1
MIRT045807 TARS threonyl-tRNA synthetase 1 1
MIRT045808 RAD21 RAD21 homolog (S. pombe) 1 1
MIRT045809 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT045810 AACS acetoacetyl-CoA synthetase 1 1
MIRT045811 ENAH enabled homolog (Drosophila) 1 1
MIRT045812 DCUN1D2 DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae) 1 1
MIRT045813 HSD17B12 hydroxysteroid (17-beta) dehydrogenase 12 1 1
MIRT045814 ACSL1 acyl-CoA synthetase long-chain family member 1 1 1
MIRT045815 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT045816 RPIA ribose 5-phosphate isomerase A 1 1
MIRT045817 GBA glucosidase, beta, acid 1 1