Accession ID: MIRT045850 [miRNA, hsa-miR-130a-3p :: CTSA, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-130aLinkOut: [miRBase ]
Description Homo sapiens miR-130a stem-loop
Comment miR-130a was first identified by cloning studies in mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-130a-3p
Mature Sequence 55| CAGUGCAAUGUUAAAAGGGCAU |76
Evidence Experimental
Experiments Cloned
Putative hsa-miR-130a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CTSA LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms GLB2, GSL, NGBE, PPCA, PPGB
Description cathepsin A
Transcript NM_0011675    LinkOut: [ RefSeq ]
Other Transcripts NM_0011276 , NM_0003   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CTSA LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CTSA
(miRNA target sites are highlighted)
>CTSA|NM_0011675|3'UTR
   1 CAGCCATACTGATGACCACAGCAACCAGCTCCACGGCCTGATGCAGCCCCTCCCAGCCTCTCCCGCTAGGAGAGTCCTCT
  81 TCTAAGCAAAGTGCCCCTGCAGGCCGGGTTCTGCCGCCAGGACTGCCCCCTTCCCAGAGCCCTGTACATCCCAGACTGGG
 161 CCCAGGGTCTCCCATAGACAGCCTGGGGGCAAGTTAGCACTTTATTCCCGCAGCAGTTCCTGAATGGGGTGGCCTGGCCC
 241 CTTCTCTGCTTAAAGAATGCCCTTTATGATGCACTGATTCCATCCCAGGAACCCAACAGAGCTCAGGACAGCCCACAGGG
 321 AGGTGGTGGACGGACTGTAATTGATAGATTGATTATGGAATTAAATTGGGTACAGCTTCAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uaCGGGAAAAUUGUAACGUGAc 5'
            |||||||  |:: |||||| 
Target 5' atGCCCTTT--ATGATGCACTg 3'
257 - 276 140.00 -21.30
2
miRNA  3' uacgGGAAAAUUGU--AA-CGUGAc 5'
              |||   ::||  || ||||| 
Target 5' acagCCTGGGGGCAAGTTAGCACTt 3'
178 - 202 116.00 -9.50
3
miRNA  3' uaCGGGAAAA-----UUGUAACGUGac 5'
            ||||  ||     |:|  ||:||  
Target 5' ctGCCCCCTTCCCAGAGCCCTGTACat 3'
123 - 149 88.00 -10.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-130a-3p :: CTSA    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
26 hsa-miR-130a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000958 HOXA5 homeobox A5 4 2
MIRT001141 MAFB v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian) 2 1
MIRT003005 TAC1 tachykinin, precursor 1 2 1
MIRT003782 ATXN1 ataxin 1 4 1
MIRT003900 APP amyloid beta (A4) precursor protein 2 1
MIRT004358 MEOX2 mesenchyme homeobox 2 4 2
MIRT004575 CSF1 colony stimulating factor 1 (macrophage) 3 2
MIRT005441 HOXA10 homeobox A10 3 1
MIRT005674 KLF4 Kruppel-like factor 4 (gut) 4 1
MIRT005957 PPARG peroxisome proliferator-activated receptor gamma 3 1
MIRT006258 DICER1 dicer 1, ribonuclease type III 1 1
MIRT006259 ATG2B ATG2 autophagy related 2 homolog B (S. cerevisiae) 1 1
MIRT006356 ESR1 estrogen receptor 1 1 1
MIRT006992 IFITM1 interferon induced transmembrane protein 1 (9-27) 1 1
MIRT007055 RUNX3 runt-related transcription factor 3 2 1
MIRT007137 MET met proto-oncogene (hepatocyte growth factor receptor) 1 1
MIRT007138 RAB5A RAB5A, member RAS oncogene family 1 1
MIRT007139 DNM2 dynamin 2 1 1
MIRT007140 LDLR low density lipoprotein receptor 1 1
MIRT007141 ACVR1 activin A receptor, type I 1 1
MIRT007142 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 1 1
MIRT007143 SMAD5 SMAD family member 5 1 1
MIRT007144 SMAD4 SMAD family member 4 2 2
MIRT021867 ZFPM2 zinc finger protein, multitype 2 1 1
MIRT045849 STK38L serine/threonine kinase 38 like 1 1
MIRT045850 CTSA cathepsin A 1 1