Accession ID: MIRT045850 [miRNA, hsa-miR-130a-3p :: CTSA, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-130aLinkOut: [miRBase ]
Description Homo sapiens miR-130a stem-loop
Comment miR-130a was first identified by cloning studies in mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-130a-3p
Mature Sequence 55| CAGUGCAAUGUUAAAAGGGCAU |76
Evidence Experimental
Experiments Cloned
Putative hsa-miR-130a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CTSA LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms GLB2, GSL, NGBE, PPCA, PPGB
Description cathepsin A
Transcript NM_000308    LinkOut: [ RefSeq ]
Other Transcripts NM_001127695 , NM_001167594   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CTSA LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CTSA
(miRNA target sites are highlighted)
>CTSA|NM_000308|3'UTR
   1 CAGCCATACTGATGACCACAGCAACCAGCTCCACGGCCTGATGCAGCCCCTCCCAGCCTCTCCCGCTAGGAGAGTCCTCT
  81 TCTAAGCAAAGTGCCCCTGCAGGCCGGGTTCTGCCGCCAGGACTGCCCCCTTCCCAGAGCCCTGTACATCCCAGACTGGG
 161 CCCAGGGTCTCCCATAGACAGCCTGGGGGCAAGTTAGCACTTTATTCCCGCAGCAGTTCCTGAATGGGGTGGCCTGGCCC
 241 CTTCTCTGCTTAAAGAATGCCCTTTATGATGCACTGATTCCATCCCAGGAACCCAACAGAGCTCAGGACAGCCCACAGGG
 321 AGGTGGTGGACGGACTGTAATTGATAGATTGATTATGGAATTAAATTGGGTACAGCTTCAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uaCGGGAAAAUUGUAACGUGAc 5'
            |||||||  |:: |||||| 
Target 5' atGCCCTTT--ATGATGCACTg 3'
257 - 276 140.00 -21.30
2
miRNA  3' uacgGGAAAAUUGU--AA-CGUGAc 5'
              |||   ::||  || ||||| 
Target 5' acagCCTGGGGGCAAGTTAGCACTt 3'
178 - 202 116.00 -9.50
3
miRNA  3' uaCGGGAAAA-----UUGUAACGUGac 5'
            ||||  ||     |:|  ||:||  
Target 5' ctGCCCCCTTCCCAGAGCCCTGTACat 3'
123 - 149 88.00 -10.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-130a-3p :: CTSA    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
368 hsa-miR-130a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000958 HOXA5 homeobox A5 5 3
MIRT001141 MAFB v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian) 2 1
MIRT003005 TAC1 tachykinin, precursor 1 2 1
MIRT003782 ATXN1 ataxin 1 4 1
MIRT003900 APP amyloid beta (A4) precursor protein 2 1
MIRT004358 MEOX2 mesenchyme homeobox 2 4 2
MIRT004575 CSF1 colony stimulating factor 1 (macrophage) 3 2
MIRT005441 HOXA10 homeobox A10 3 1
MIRT005674 KLF4 Kruppel-like factor 4 (gut) 4 1
MIRT005957 PPARG peroxisome proliferator-activated receptor gamma 4 2
MIRT006258 DICER1 dicer 1, ribonuclease type III 2 5
MIRT006259 ATG2B autophagy related 2B 1 1
MIRT006356 ESR1 estrogen receptor 1 2 2
MIRT006992 IFITM1 interferon induced transmembrane protein 1 1 1
MIRT007055 RUNX3 runt-related transcription factor 3 2 2
MIRT007137 MET met proto-oncogene (hepatocyte growth factor receptor) 1 1
MIRT007138 RAB5A RAB5A, member RAS oncogene family 1 1
MIRT007139 DNM2 dynamin 2 1 1
MIRT007140 LDLR low density lipoprotein receptor 2 4
MIRT007141 ACVR1 activin A receptor, type I 2 2
MIRT007142 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 2 2
MIRT007143 SMAD5 SMAD family member 5 2 2
MIRT007144 SMAD4 SMAD family member 4 4 6
MIRT021867 ZFPM2 zinc finger protein, multitype 2 1 1
MIRT045849 STK38L serine/threonine kinase 38 like 1 1
MIRT045850 CTSA cathepsin A 1 1
MIRT053132 GJA1 gap junction protein, alpha 1, 43kDa 2 1
MIRT053635 TGFBR1 transforming growth factor, beta receptor 1 1 1
MIRT053636 WNT10A wingless-type MMTV integration site family, member 10A 1 1
MIRT053637 PDGFRA platelet-derived growth factor receptor, alpha polypeptide 1 1
MIRT053638 SOX5 SRY (sex determining region Y)-box 5 1 1
MIRT054762 TNF tumor necrosis factor 3 1
MIRT057494 CEP55 centrosomal protein 55kDa 1 2
MIRT060500 PPP6R3 protein phosphatase 6, regulatory subunit 3 1 1
MIRT061516 OTUD3 OTU domain containing 3 1 1
MIRT061791 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 5
MIRT062709 MLEC malectin 1 2
MIRT063595 FBXO28 F-box protein 28 1 1
MIRT064800 ZBTB18 zinc finger protein 238 1 1
MIRT065620 CLIC4 chloride intracellular channel 4 1 2
MIRT065888 RAB5B RAB5B, member RAS oncogene family 1 4
MIRT070999 SMOC1 SPARC related modular calcium binding 1 1 1
MIRT071907 ZFYVE9 zinc finger, FYVE domain containing 9 1 1
MIRT075114 C16ORF70 chromosome 16 open reading frame 70 1 2
MIRT076025 COX10 cytochrome c oxidase assembly homolog 10 (yeast) 1 3
MIRT079264 NPTX1 neuronal pentraxin I 1 1
MIRT079347 CCDC137 coiled-coil domain containing 137 1 1
MIRT083127 BTBD3 BTB (POZ) domain containing 3 1 6
MIRT083152 SEC23B Sec23 homolog B (S. cerevisiae) 1 2
MIRT086430 NABP1 nucleic acid binding protein 1 1 3
MIRT087864 CBY1 chibby homolog 1 (Drosophila) 1 2
MIRT088339 MAPRE3 microtubule-associated protein, RP/EB family, member 3 1 4
MIRT090802 MBNL1 muscleblind-like splicing regulator 1 1 2
MIRT090898 ARHGEF26 Rho guanine nucleotide exchange factor (GEF) 26 1 1
MIRT091213 USP13 ubiquitin specific peptidase 13 (isopeptidase T-3) 1 1
MIRT091687 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 1 3
MIRT092488 PTPRG protein tyrosine phosphatase, receptor type, G 1 1
MIRT095378 UBE2D2 ubiquitin-conjugating enzyme E2D 2 1 1
MIRT096894 ERBB2IP erbb2 interacting protein 1 1
MIRT097418 JMY junction mediating and regulatory protein, p53 cofactor 1 1
MIRT097460 PAPD4 PAP associated domain containing 4 1 1
MIRT099313 QKI QKI, KH domain containing, RNA binding 1 2
MIRT099828 SOX4 SRY (sex determining region Y)-box 4 1 5
MIRT100768 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) 1 1
MIRT101818 PNRC1 proline-rich nuclear receptor coactivator 1 1 1
MIRT102151 POP7 processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae) 1 2
MIRT102224 HBP1 HMG-box transcription factor 1 1 1
MIRT102617 UBN2 ubinuclein 2 1 4
MIRT105305 VPS37A vacuolar protein sorting 37 homolog A (S. cerevisiae) 1 1
MIRT105431 ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 1 5
MIRT105797 RAB11FIP1 RAB11 family interacting protein 1 (class I) 1 1
MIRT107276 FAM73B family with sequence similarity 73, member B 1 1
MIRT108261 HABP4 hyaluronan binding protein 4 1 2
MIRT108877 HPRT1 hypoxanthine phosphoribosyltransferase 1 1 1
MIRT109827 MID1IP1 MID1 interacting protein 1 1 4
MIRT123859 FZD6 frizzled family receptor 6 1 4
MIRT126555 MASTL microtubule associated serine/threonine kinase-like 1 1
MIRT130081 TXNIP thioredoxin interacting protein 1 3
MIRT132490 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT134746 CCND2 cyclin D2 1 1
MIRT139875 BTF3L4 basic transcription factor 3-like 4 1 3
MIRT142395 TNRC6A trinucleotide repeat containing 6A 1 3
MIRT153974 PRNP prion protein 1 1
MIRT162264 LMLN leishmanolysin-like (metallopeptidase M8 family) 1 2
MIRT164528 MSMO1 methylsterol monooxygenase 1 1 1
MIRT178064 SAMD8 sterile alpha motif domain containing 8 1 1
MIRT178926 C11ORF57 chromosome 11 open reading frame 57 1 1
MIRT179067 PAFAH1B2 platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) 1 3
MIRT180843 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 2
MIRT182970 TROVE2 TROVE domain family, member 2 1 1
MIRT193023 TMOD3 tropomodulin 3 (ubiquitous) 1 4
MIRT195753 ATMIN ATM interactor 1 3
MIRT196620 TAOK1 TAO kinase 1 1 3
MIRT212150 CLCN3 chloride channel, voltage-sensitive 3 1 2
MIRT217602 NUS1 nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) 1 1
MIRT220697 MTPN myotrophin 1 2
MIRT222271 CCT6A chaperonin containing TCP1, subunit 6A (zeta 1) 1 1
MIRT223634 ATP6V1C1 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 1 2
MIRT224751 DPYSL2 dihydropyrimidinase-like 2 1 1
MIRT227993 NFIB nuclear factor I/B 1 2
MIRT230968 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT242660 SALL3 sal-like 3 (Drosophila) 1 2
MIRT243092 LCLAT1 lysocardiolipin acyltransferase 1 1 2
MIRT244076 EDN1 endothelin 1 1 1
MIRT246459 ZBTB7B zinc finger and BTB domain containing 7B 1 1
MIRT248073 SLC38A2 solute carrier family 38, member 2 1 2
MIRT270937 GPRC5A G protein-coupled receptor, family C, group 5, member A 1 1
MIRT295175 ZNF317 zinc finger protein 317 1 2
MIRT296527 STX16 syntaxin 16 1 1
MIRT301573 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT316373 PPP1R14C protein phosphatase 1, regulatory (inhibitor) subunit 14C 1 1
MIRT323694 PLEKHF2 pleckstrin homology domain containing, family F (with FYVE domain) member 2 1 2
MIRT327911 CHIC1 cysteine-rich hydrophobic domain 1 1 1
MIRT367107 ZNF711 zinc finger protein 711 1 2
MIRT368752 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT407331 IGFBP5 insulin-like growth factor binding protein 5 1 1
MIRT438510 XIAP X-linked inhibitor of apoptosis 2 2
MIRT438606 Acvr1 activin A receptor, type 1 2 1
MIRT438748 IL18 interleukin 18 (interferon-gamma-inducing factor) 2 1
MIRT438749 TGFB1 transforming growth factor, beta 1 2 1
MIRT438762 PPARA peroxisome proliferator-activated receptor alpha 1 1
MIRT448326 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT448958 CDK19 cyclin-dependent kinase 19 1 2
MIRT449151 UQCRB ubiquinol-cytochrome c reductase binding protein 1 1
MIRT454123 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT459839 TPP1 tripeptidyl peptidase I 1 1
MIRT460424 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 1 2
MIRT461664 G6PC glucose-6-phosphatase, catalytic subunit 1 1
MIRT462950 ZNF800 zinc finger protein 800 1 6
MIRT463648 YY1 YY1 transcription factor 1 4
MIRT464859 RPS27A ribosomal protein S27a 1 6
MIRT464871 UBB ubiquitin B 1 4
MIRT466327 THRA thyroid hormone receptor, alpha 1 1
MIRT466834 STX6 syntaxin 6 1 3
MIRT467421 SNTB1 syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1) 1 2
MIRT467461 SNAPIN SNAP-associated protein 1 1
MIRT468562 SERINC3 serine incorporator 3 1 5
MIRT469810 RAB14 RAB14, member RAS oncogene family 1 1
MIRT469867 PXK PX domain containing serine/threonine kinase 1 4
MIRT470330 PPP6R1 protein phosphatase 6, regulatory subunit 1 1 1
MIRT473771 MAP3K9 mitogen-activated protein kinase kinase kinase 9 1 1
MIRT474739 KIF13A kinesin family member 13A 1 3
MIRT474962 KCTD10 potassium channel tetramerisation domain containing 10 1 2
MIRT475485 HSPA8 heat shock 70kDa protein 8 1 3
MIRT476296 GMFB glia maturation factor, beta 1 5
MIRT477368 EOGT EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase 1 2
MIRT477497 ELL2 elongation factor, RNA polymerase II, 2 1 1
MIRT478107 DLG5 discs, large homolog 5 (Drosophila) 1 3
MIRT479816 CCNA2 cyclin A2 1 3
MIRT480014 CAPRIN2 caprin family member 2 1 2
MIRT480840 BLCAP bladder cancer associated protein 1 5
MIRT481611 ARHGAP1 Rho GTPase activating protein 1 1 3
MIRT481876 ANKRD50 ankyrin repeat domain 50 1 1
MIRT484942 ZFYVE26 zinc finger, FYVE domain containing 26 1 2
MIRT485125 SECISBP2L SECIS binding protein 2-like 1 2
MIRT485441 KLF6 Kruppel-like factor 6 1 1
MIRT485578 FOXQ1 forkhead box Q1 1 1
MIRT486749 CNOT4 CCR4-NOT transcription complex, subunit 4 1 3
MIRT490891 OSBP oxysterol binding protein 1 1
MIRT491429 PDZD11 PDZ domain containing 11 1 2
MIRT491651 PDRG1 p53 and DNA-damage regulated 1 1 5
MIRT491798 ZNF24 zinc finger protein 24 1 1
MIRT492264 SIK1 salt-inducible kinase 1 1 3
MIRT493094 MMGT1 membrane magnesium transporter 1 1 6
MIRT498063 SNX5 sorting nexin 5 1 3
MIRT498881 ZNF12 zinc finger protein 12 1 5
MIRT499900 KIAA1191 KIAA1191 1 2
MIRT500399 ZMAT3 zinc finger, matrin-type 3 1 5
MIRT500502 ZBTB4 zinc finger and BTB domain containing 4 1 3
MIRT500727 TRIM37 tripartite motif containing 37 1 1
MIRT500924 STARD13 StAR-related lipid transfer (START) domain containing 13 1 2
MIRT501473 PTPN4 protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte) 1 4
MIRT501558 POC1B-GALNT4 POC1B-GALNT4 readthrough 1 1
MIRT501786 NRBF2 nuclear receptor binding factor 2 1 3
MIRT501987 MAPK1 mitogen-activated protein kinase 1 1 5
MIRT502011 MAP7 microtubule-associated protein 7 1 4
MIRT502422 GALNT4 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4) 1 1
MIRT502762 CLIP1 CAP-GLY domain containing linker protein 1 1 4
MIRT503048 CAMSAP2 calmodulin regulated spectrin-associated protein family, member 2 1 1
MIRT503479 ZNF154 zinc finger protein 154 1 3
MIRT503682 SLC46A1 solute carrier family 46 (folate transporter), member 1 1 1
MIRT504276 PARP1 poly (ADP-ribose) polymerase 1 1 3
MIRT504559 ZNF417 zinc finger protein 417 1 3
MIRT504689 ATP6V0D1 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 1 3
MIRT505251 UBE2D3 ubiquitin-conjugating enzyme E2D 3 1 1
MIRT505871 POLR1B polymerase (RNA) I polypeptide B, 128kDa 1 2
MIRT506225 PHF12 PHD finger protein 12 1 1
MIRT506469 NACC2 NACC family member 2, BEN and BTB (POZ) domain containing 1 2
MIRT506511 MSANTD4 Myb/SANT-like DNA-binding domain containing 4 with coiled-coils 1 2
MIRT506695 LZIC leucine zipper and CTNNBIP1 domain containing 1 2
MIRT507911 CALM2 calmodulin 2 (phosphorylase kinase, delta) 1 3
MIRT509665 ZNF354B zinc finger protein 354B 1 5
MIRT510719 SPG20 spastic paraplegia 20 (Troyer syndrome) 1 3
MIRT510869 RAN RAN, member RAS oncogene family 1 4
MIRT511095 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 1 2
MIRT511253 KLHL36 kelch-like 36 (Drosophila) 1 3
MIRT513218 RFT1 RFT1 homolog (S. cerevisiae) 1 1
MIRT513624 VPS37B vacuolar protein sorting 37 homolog B (S. cerevisiae) 1 1
MIRT513713 RBM20 RNA binding motif protein 20 1 2
MIRT513912 GRB10 growth factor receptor-bound protein 10 1 3
MIRT514372 UBBP4 ubiquitin B pseudogene 4 1 3
MIRT517871 NCAPD2 non-SMC condensin I complex, subunit D2 1 2
MIRT521313 RRAGD Ras-related GTP binding D 1 2
MIRT521701 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 4
MIRT521777 PPIG peptidylprolyl isomerase G (cyclophilin G) 1 4
MIRT524506 CEP170 centrosomal protein 170kDa 1 2
MIRT527465 CLEC12B C-type lectin domain family 12, member B 1 1
MIRT530131 HADHB hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit 1 1
MIRT530850 RAG1 recombination activating gene 1 1 2
MIRT531105 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT533496 TRIM71 tripartite motif containing 71, E3 ubiquitin protein ligase 1 1
MIRT534272 SLC12A7 solute carrier family 12 (potassium/chloride transporters), member 7 1 1
MIRT534723 RFX7 regulatory factor X, 7 1 1
MIRT535266 PIGA phosphatidylinositol glycan anchor biosynthesis, class A 1 2
MIRT536343 LEFTY1 left-right determination factor 1 1 1
MIRT536411 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT538272 CUL3 cullin 3 1 2
MIRT538417 COX20 COX20 Cox2 chaperone homolog (S. cerevisiae) 1 1
MIRT539460 ADARB2 adenosine deaminase, RNA-specific, B2 1 1
MIRT540451 RBM43 RNA binding motif protein 43 1 1
MIRT541133 RAB34 RAB34, member RAS oncogene family 1 1
MIRT543574 RPF2 ribosome production factor 2 homolog (S. cerevisiae) 1 2
MIRT544111 IPMK inositol polyphosphate multikinase 1 1
MIRT544492 TRIM4 tripartite motif containing 4 1 1
MIRT544696 ZNF224 zinc finger protein 224 1 2
MIRT544991 MFF mitochondrial fission factor 1 2
MIRT546279 TMEM30A transmembrane protein 30A 1 2
MIRT546568 SATB2 SATB homeobox 2 1 1
MIRT546657 RPS6KA5 ribosomal protein S6 kinase, 90kDa, polypeptide 5 1 1
MIRT546770 RLIM ring finger protein, LIM domain interacting 1 1
MIRT546954 SFTPA1 surfactant protein A1 1 1
MIRT547045 POGZ pogo transposable element with ZNF domain 1 1
MIRT547495 MBNL3 muscleblind-like splicing regulator 3 1 2
MIRT548403 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 1 2
MIRT548477 EGLN3 egl nine homolog 3 (C. elegans) 1 1
MIRT548652 DAPK1 death-associated protein kinase 1 1 1
MIRT548856 CERCAM cerebral endothelial cell adhesion molecule 1 1
MIRT548895 CHEK2 checkpoint kinase 2 1 2
MIRT549136 BRWD1 bromodomain and WD repeat domain containing 1 1 2
MIRT549181 BMP3 bone morphogenetic protein 3 1 1
MIRT549332 ARHGAP12 Rho GTPase activating protein 12 1 2
MIRT549460 ACSL4 acyl-CoA synthetase long-chain family member 4 1 1
MIRT549486 ACBD5 acyl-CoA binding domain containing 5 1 1
MIRT550218 MAVS mitochondrial antiviral signaling protein 1 2
MIRT551708 ASB16 ankyrin repeat and SOCS box containing 16 1 1
MIRT552158 DAD1 defender against cell death 1 1 1
MIRT552364 ZNF620 zinc finger protein 620 1 1
MIRT552523 ZIC5 Zic family member 5 1 1
MIRT552854 WIPF2 WAS/WASL interacting protein family, member 2 1 1
MIRT552891 WASL Wiskott-Aldrich syndrome-like 1 2
MIRT553312 TSPAN3 tetraspanin 3 1 1
MIRT553352 TRPC3 transient receptor potential cation channel, subfamily C, member 3 1 2
MIRT553717 TCF7L2 transcription factor 7-like 2 (T-cell specific, HMG-box) 1 1
MIRT553900 SUN2 Sad1 and UNC84 domain containing 2 1 2
MIRT554856 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 1 1
MIRT555083 PURG purine-rich element binding protein G 1 1
MIRT555197 PRUNE2 prune homolog 2 (Drosophila) 1 1
MIRT556195 MCC mutated in colorectal cancers 1 1
MIRT556228 MB21D2 Mab-21 domain containing 2 1 1
MIRT556488 LIPA lipase A, lysosomal acid, cholesterol esterase 1 1
MIRT556970 IER3IP1 immediate early response 3 interacting protein 1 1 1
MIRT557028 HOXD11 homeobox D11 1 1
MIRT557073 HOXB3 homeobox B3 1 1
MIRT557586 GNPTAB N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits 1 1
MIRT558277 DYNC1LI2 dynein, cytoplasmic 1, light intermediate chain 2 1 1
MIRT558411 DEPDC1 DEP domain containing 1 1 1
MIRT558775 CFL2 cofilin 2 (muscle) 1 1
MIRT559626 AKIRIN2 akirin 2 1 1
MIRT560235 KLHL21 kelch-like 21 (Drosophila) 1 2
MIRT560655 ZNF107 zinc finger protein 107 1 1
MIRT560937 CDK2AP2 cyclin-dependent kinase 2 associated protein 2 1 1
MIRT563760 ZNF678 zinc finger protein 678 1 1
MIRT566008 RNF11 ring finger protein 11 1 1
MIRT566155 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT566698 MYLIP myosin regulatory light chain interacting protein 1 1
MIRT567067 KCNB1 potassium voltage-gated channel, Shab-related subfamily, member 1 1 1
MIRT567538 FGFR1OP FGFR1 oncogene partner 1 1
MIRT567771 DLC1 deleted in liver cancer 1 1 1
MIRT567828 DCUN1D3 DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae) 1 1
MIRT571623 SRSF2 serine/arginine-rich splicing factor 2 1 1
MIRT573082 ABCD2 ATP-binding cassette, sub-family D (ALD), member 2 1 1
MIRT610914 NF2 neurofibromin 2 (merlin) 1 1
MIRT620062 ODF4 outer dense fiber of sperm tails 4 1 1
MIRT623183 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT627022 FIG4 FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae) 1 1
MIRT627088 SF3A1 splicing factor 3a, subunit 1, 120kDa 1 1
MIRT628286 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629105 F2RL1 coagulation factor II (thrombin) receptor-like 1 1 1
MIRT629245 CINP cyclin-dependent kinase 2 interacting protein 1 1
MIRT629421 ADM2 adrenomedullin 2 1 1
MIRT629596 RFC2 replication factor C (activator 1) 2, 40kDa 1 1
MIRT629649 WDR31 WD repeat domain 31 1 1
MIRT629810 GPR82 G protein-coupled receptor 82 1 1
MIRT629884 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629928 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 1 1
MIRT629993 NARS asparaginyl-tRNA synthetase 1 1
MIRT630054 TERF2 telomeric repeat binding factor 2 1 1
MIRT630072 NIP7 nuclear import 7 homolog (S. cerevisiae) 1 1
MIRT630166 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630262 SMTNL2 smoothelin-like 2 1 1
MIRT630292 PSMB5 proteasome (prosome, macropain) subunit, beta type, 5 1 1
MIRT630356 NKAP NFKB activating protein 1 1
MIRT630506 CYP20A1 cytochrome P450, family 20, subfamily A, polypeptide 1 1 1
MIRT632057 ATF7IP activating transcription factor 7 interacting protein 1 1
MIRT632482 RPS15A ribosomal protein S15a 1 1
MIRT632609 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT633005 DUSP18 dual specificity phosphatase 18 1 1
MIRT633092 CXorf21 chromosome X open reading frame 21 1 1
MIRT635062 MYH11 myosin, heavy chain 11, smooth muscle 1 1
MIRT635955 PLA2G12A phospholipase A2, group XIIA 1 1
MIRT636666 CDK4 cyclin-dependent kinase 4 1 1
MIRT637197 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637936 LILRA2 leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2 1 1
MIRT641812 USP32 ubiquitin specific peptidase 32 1 1
MIRT642654 PTGR2 prostaglandin reductase 2 1 1
MIRT644246 SLC35E3 solute carrier family 35, member E3 1 1
MIRT644676 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645103 SLC35E2B solute carrier family 35, member E2B 1 1
MIRT646003 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646518 FAM217B family with sequence similarity 217, member B 1 1
MIRT646785 IL23R interleukin 23 receptor 1 1
MIRT648525 PIGG phosphatidylinositol glycan anchor biosynthesis, class G 1 1
MIRT654359 RBM27 RNA binding motif protein 27 1 1
MIRT660837 AGO3 eukaryotic translation initiation factor 2C, 3 1 1
MIRT661189 S1PR2 sphingosine-1-phosphate receptor 2 1 1
MIRT661250 ARL17B ADP-ribosylation factor-like 17B 1 1
MIRT662853 OMD osteomodulin 1 1
MIRT662928 MED18 mediator complex subunit 18 1 1
MIRT663555 CCR6 chemokine (C-C motif) receptor 6 1 1
MIRT664366 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT666091 SSTR2 somatostatin receptor 2 1 1
MIRT666267 SLC31A1 solute carrier family 31 (copper transporters), member 1 1 1
MIRT666687 RBM23 RNA binding motif protein 23 1 1
MIRT667239 NFE2L1 nuclear factor (erythroid-derived 2)-like 1 1 1
MIRT667766 KDELR1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 1 1
MIRT669259 C4orf36 chromosome 4 open reading frame 36 1 1
MIRT671486 FLYWCH2 FLYWCH family member 2 1 1
MIRT671508 SLC38A9 solute carrier family 38, member 9 1 1
MIRT671936 PLEKHS1 pleckstrin homology domain containing, family S member 1 1 2
MIRT672303 GP2 glycoprotein 2 (zymogen granule membrane) 1 1
MIRT672615 IRF1 interferon regulatory factor 1 1 1
MIRT674039 ANKRD9 ankyrin repeat domain 9 1 1
MIRT674231 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674541 PRR23A proline rich 23A 1 1
MIRT675113 SNTB2 syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) 1 1
MIRT675279 ZNF431 zinc finger protein 431 1 1
MIRT684276 PRPF4 PRP4 pre-mRNA processing factor 4 homolog (yeast) 1 1
MIRT694286 ZNF529 zinc finger protein 529 1 2
MIRT698259 TMEM2 transmembrane protein 2 1 1
MIRT699918 RUNDC1 RUN domain containing 1 1 1
MIRT702592 JARID2 jumonji, AT rich interactive domain 2 1 1
MIRT705205 BTG1 B-cell translocation gene 1, anti-proliferative 1 1
MIRT706933 THAP6 THAP domain containing 6 1 1
MIRT708884 MOCS2 molybdenum cofactor synthesis 2 1 1
MIRT709121 C3orf18 chromosome 3 open reading frame 18 1 1
MIRT709621 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 1
MIRT710595 CDCA4 cell division cycle associated 4 1 1
MIRT710799 IFNLR1 interleukin 28 receptor, alpha (interferon, lambda receptor) 1 1
MIRT711781 RFXAP regulatory factor X-associated protein 1 1
MIRT713342 KLRD1 killer cell lectin-like receptor subfamily D, member 1 1 1
MIRT713639 MED8 mediator complex subunit 8 1 1
MIRT713913 IGF2R insulin-like growth factor 2 receptor 1 1
MIRT715067 TMTC1 transmembrane and tetratricopeptide repeat containing 1 1 1
MIRT715184 DTX4 deltex homolog 4 (Drosophila) 1 1
MIRT715202 FKTN fukutin 1 1
MIRT715278 RNF125 ring finger protein 125, E3 ubiquitin protein ligase 1 1
MIRT717806 FAM114A1 family with sequence similarity 114, member A1 1 1
MIRT720542 CHERP calcium homeostasis endoplasmic reticulum protein 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*