Accession ID: MIRT046230 [miRNA, hsa-miR-27b-3p :: BRAT1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-27bLinkOut: [miRBase ]
Description Homo sapiens miR-27b stem-loop
Comment Lagos-Quintana et al. determined the expression of miR-27b in mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-27b-3p
Mature Sequence 61| UUCACAGUGGCUAAGUUCUGC |81
Evidence Experimental
Experiments Cloned
Putative hsa-miR-27b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-27b-3p :: BRAT1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' cgTCTTGAATCGGTGACACtt 5'
            ||  | |:|||||||||  
Target 5' gcAGTTCGTGGCCACTGTGct 3'
1 - 21
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
88 hsa-miR-27b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001768 NOTCH1 Notch homolog 1, translocation-associated (Drosophila) 3 2
MIRT003388 ST14 suppression of tumorigenicity 14 (colon carcinoma) 5 2
MIRT003427 MMP13 matrix metallopeptidase 13 (collagenase 3) 4 1
MIRT004499 ADORA2B adenosine A2b receptor 3 1
MIRT004826 CYP1B1 cytochrome P450, family 1, subfamily B, polypeptide 1 4 1
MIRT004863 TRAPPC2P1 trafficking protein particle complex 2 pseudogene 1 2 1
MIRT005023 PPARG peroxisome proliferator-activated receptor gamma 4 3
MIRT005753 EDNRA endothelin receptor type A 3 1
MIRT005754 EYA4 eyes absent homolog 4 (Drosophila) 3 1
MIRT006101 WEE1 WEE1 homolog (S. pombe) 2 1
MIRT006509 VDR vitamin D (1,25- dihydroxyvitamin D3) receptor 1 1
MIRT006510 CYP3A4 cytochrome P450, family 3, subfamily A, polypeptide 4 1 1
MIRT006522 PAX3 paired box 3 3 1
MIRT006547 CCNT1 cyclin T1 4 1
MIRT006988 KHSRP KH-type splicing regulatory protein 1 1
MIRT023463 PAX7 paired box 7 2 1
MIRT046168 RPS15A ribosomal protein S15a 1 1
MIRT046169 UBXN1 UBX domain protein 1 1 1
MIRT046170 CALM3 calmodulin 3 (phosphorylase kinase, delta) 1 1
MIRT046171 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT046172 C1orf74 chromosome 1 open reading frame 74 1 1
MIRT046173 RAPGEF1 Rap guanine nucleotide exchange factor (GEF) 1 1 1
MIRT046174 SUPV3L1 suppressor of var1, 3-like 1 (S. cerevisiae) 1 1
MIRT046175 HIST2H3A histone cluster 2, H3a 1 1
MIRT046176 RGMB RGM domain family, member B 1 1
MIRT046177 FASN fatty acid synthase 1 1
MIRT046178 KIF1B kinesin family member 1B 1 1
MIRT046179 GNB4 guanine nucleotide binding protein (G protein), beta polypeptide 4 1 1
MIRT046180 RPL19 ribosomal protein L19 1 1
MIRT046181 SPAG9 sperm associated antigen 9 1 1
MIRT046182 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT046183 ATN1 atrophin 1 1 1
MIRT046184 HIST1H1C histone cluster 1, H1c 1 1
MIRT046185 CEP192 centrosomal protein 192kDa 1 1
MIRT046186 RPTOR regulatory associated protein of MTOR, complex 1 1 1
MIRT046187 CTSB cathepsin B 1 1
MIRT046188 DIAPH1 diaphanous homolog 1 (Drosophila) 1 1
MIRT046189 EHMT2 euchromatic histone-lysine N-methyltransferase 2 1 1
MIRT046190 NDUFS6 NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase) 1 1
MIRT046191 DUSP5 dual specificity phosphatase 5 1 1
MIRT046192 CUL4B cullin 4B 1 1
MIRT046193 SLC5A6 solute carrier family 5 (sodium-dependent vitamin transporter), member 6 1 1
MIRT046194 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 1 1
MIRT046195 NOTCH2 Notch homolog 2 (Drosophila) 1 1
MIRT046196 SLC25A5 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5 1 1
MIRT046197 SEC16A SEC16 homolog A (S. cerevisiae) 1 1
MIRT046198 ANKRD52 ankyrin repeat domain 52 1 1
MIRT046199 CUL1 cullin 1 1 1
MIRT046200 HNRNPU heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A) 1 1
MIRT046201 ZC3H11A zinc finger CCCH-type containing 11A 1 1
MIRT046202 DDX17 DEAD (Asp-Glu-Ala-Asp) box polypeptide 17 1 1
MIRT046203 SNX19 sorting nexin 19 1 1
MIRT046204 TBC1D9 TBC1 domain family, member 9 (with GRAM domain) 1 1
MIRT046205 INPPL1 inositol polyphosphate phosphatase-like 1 1 1
MIRT046206 PAXBP1 GC-rich sequence DNA-binding factor 1 1 1
MIRT046207 MAPK9 mitogen-activated protein kinase 9 1 1
MIRT046208 SLC43A1 solute carrier family 43, member 1 1 1
MIRT046209 PRR3 proline rich 3 1 1
MIRT046210 MTMR3 myotubularin related protein 3 1 1
MIRT046211 THOC3 THO complex 3 1 1
MIRT046212 LCOR ligand dependent nuclear receptor corepressor 1 1
MIRT046213 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT046214 DPF1 D4, zinc and double PHD fingers family 1 1 1
MIRT046215 ANKRD2 ankyrin repeat domain 2 (stretch responsive muscle) 1 1
MIRT046216 EML1 echinoderm microtubule associated protein like 1 1 1
MIRT046217 MDH2 malate dehydrogenase 2, NAD (mitochondrial) 1 1
MIRT046218 POGZ pogo transposable element with ZNF domain 1 1
MIRT046219 ZMYND11 zinc finger, MYND domain containing 11 1 1
MIRT046220 LAPTM4B lysosomal protein transmembrane 4 beta 1 1
MIRT046221 RPS24 ribosomal protein S24 1 1
MIRT046222 KHDRBS1 KH domain containing, RNA binding, signal transduction associated 1 1 1
MIRT046223 RAB3B RAB3B, member RAS oncogene family 1 1
MIRT046224 KIAA1211 KIAA1211 1 1
MIRT046225 GALNT11 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11) 1 1
MIRT046226 ZNF45 zinc finger protein 45 1 1
MIRT046227 LRIG3 leucine-rich repeats and immunoglobulin-like domains 3 1 1
MIRT046228 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT046229 ATP7B ATPase, Cu++ transporting, beta polypeptide 1 1
MIRT046230 BRAT1 chromosome 7 open reading frame 27 1 1
MIRT046231 LMF2 lipase maturation factor 2 1 1
MIRT046232 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT046233 UTP14A UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) 1 1
MIRT046234 TSR1 TSR1, 20S rRNA accumulation, homolog (S. cerevisiae) 1 1
MIRT046235 TMEM19 transmembrane protein 19 1 1
MIRT046236 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 1
MIRT046237 UBA1 ubiquitin-like modifier activating enzyme 1 1 1
MIRT046238 CCND3 cyclin D3 1 1
MIRT046239 TMTC1 transmembrane and tetratricopeptide repeat containing 1 1 1