Accession ID: MIRT046243 [miRNA, hsa-miR-23b-3p :: MSH6, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-23bLinkOut: [miRBase ]
Synonyms MIRN23B, hsa-mir-23b, miRNA23B, MIR23B
Description Homo sapiens miR-23b stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-23b-3p
Mature Sequence 58| AUCACAUUGCCAGGGAUUACC |78
Evidence Experimental
Experiments Cloned
Putative hsa-miR-23b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MSH6 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms GTBP, HNPCC5, HSAP
Description mutS homolog 6 (E. coli)
Transcript NM_0001    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MSH6 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MSH6
(miRNA target sites are highlighted)
>MSH6|NM_0001|3'UTR
   1 TAGACTGACTACATTGGAAGCTTTGAGTTGACTTCTGACAAAGGTGGTAAATTCAGACAACATTATGATCTAATAAACTT
  81 TATTTTTTAAAAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
 161 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ccAUUAGGGACCG-UUACACUa 5'
            |:| ::||| | || |||: 
Target 5' gtTGACTTCTGACAAAGGTGGt 3'
27 - 48 111.00 -11.20
2
miRNA  3' ccAUUAGGGAC---CGUUACACUA 5'
            ||| ::| |    || | ||||
Target 5' ggTAAATTCAGACAACATTATGAT 3'
46 - 69 87.00 -5.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-23b-3p :: MSH6    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
175 hsa-miR-23b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000125 OPRM1 opioid receptor, mu 1 1 2
MIRT001177 PRAP1 proline-rich acidic protein 1 3 1
MIRT001775 NOTCH1 Notch homolog 1, translocation-associated (Drosophila) 2 1
MIRT003424 E2F1 E2F transcription factor 1 2 1
MIRT003425 RB1 retinoblastoma 1 2 1
MIRT004291 PLAU plasminogen activator, urokinase 4 2
MIRT004292 MET met proto-oncogene (hepatocyte growth factor receptor) 4 1
MIRT006806 PRKACB protein kinase, cAMP-dependent, catalytic, beta 2 1
MIRT006963 PTK2B PTK2B protein tyrosine kinase 2 beta 0 1
MIRT007006 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT007039 TAB3 TGF-beta activated kinase 1/MAP3K7 binding protein 3 1 1
MIRT007040 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT007041 CHUK conserved helix-loop-helix ubiquitous kinase 1 1
MIRT007051 SRC v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) 1 1
MIRT007096 PTEN phosphatase and tensin homolog 1 1
MIRT023464 DHX57 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 1 1
MIRT023465 CCDC88C coiled-coil domain containing 88C 1 1
MIRT023466 ACAT1 acetyl-CoA acetyltransferase 1 1 1
MIRT023467 ZIC5 Zic family member 5 (odd-paired homolog, Drosophila) 1 1
MIRT023468 CEPT1 choline/ethanolamine phosphotransferase 1 1 1
MIRT023469 KIAA1279 KIAA1279 1 1
MIRT023470 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 1 1
MIRT023471 BLOC1S2 biogenesis of lysosomal organelles complex-1, subunit 2 1 1
MIRT023472 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 1
MIRT023473 ANKRD17 ankyrin repeat domain 17 1 1
MIRT023474 SPTY2D1 SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae) 1 1
MIRT023475 MED4 mediator complex subunit 4 1 1
MIRT023476 STAT5B signal transducer and activator of transcription 5B 1 1
MIRT023477 PNN pinin, desmosome associated protein 1 1
MIRT023478 ARFIP1 ADP-ribosylation factor interacting protein 1 1 1
MIRT023479 AKAP11 A kinase (PRKA) anchor protein 11 1 1
MIRT023480 SNRPC small nuclear ribonucleoprotein polypeptide C 1 1
MIRT023481 PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 1 1
MIRT023482 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT046240 SOS1 son of sevenless homolog 1 (Drosophila) 1 1
MIRT046241 CATSPERB cation channel, sperm-associated, beta 1 1
MIRT046242 RPS27A ribosomal protein S27a 1 1
MIRT046243 MSH6 mutS homolog 6 (E. coli) 1 1
MIRT046244 RBPMS2 RNA binding protein with multiple splicing 2 1 1
MIRT046245 HK1 hexokinase 1 1 1
MIRT046246 BCL7B B-cell CLL/lymphoma 7B 1 1
MIRT046247 MED13L mediator complex subunit 13-like 1 1
MIRT046248 ATXN10 ataxin 10 1 1
MIRT046249 CDC73 cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT046250 FLNA filamin A, alpha 1 1
MIRT046251 CUL4A cullin 4A 1 1
MIRT046252 ZNFX1 zinc finger, NFX1-type containing 1 1 1
MIRT046253 WDR54 WD repeat domain 54 1 1
MIRT046254 UQCRC2 ubiquinol-cytochrome c reductase core protein II 1 1
MIRT046255 HERC3 hect domain and RLD 3 1 1
MIRT046256 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT046257 CDK2 cyclin-dependent kinase 2 1 1
MIRT046258 RPL19 ribosomal protein L19 1 1
MIRT046259 ACTN4 actinin, alpha 4 1 1
MIRT046260 ATP1A1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 1 1
MIRT046261 DDX47 DEAD (Asp-Glu-Ala-Asp) box polypeptide 47 1 1
MIRT046262 CEP104 KIAA0562 1 1
MIRT046263 PPM1A protein phosphatase, Mg2+/Mn2+ dependent, 1A 1 1
MIRT046264 PPP1CB protein phosphatase 1, catalytic subunit, beta isozyme 1 1
MIRT046265 CPSF7 cleavage and polyadenylation specific factor 7, 59kDa 1 1
MIRT046266 GNS glucosamine (N-acetyl)-6-sulfatase 1 1
MIRT046267 SORCS2 sortilin-related VPS10 domain containing receptor 2 1 1
MIRT046268 LASP1 LIM and SH3 protein 1 1 1
MIRT046269 CAP1 CAP, adenylate cyclase-associated protein 1 (yeast) 1 1
MIRT046270 RRAGD Ras-related GTP binding D 1 1
MIRT046271 TCF25 transcription factor 25 (basic helix-loop-helix) 1 1
MIRT046272 FAM168B family with sequence similarity 168, member B 1 1
MIRT046273 BCS1L BCS1-like (yeast) 1 1
MIRT046274 RMND5A required for meiotic nuclear division 5 homolog A (S. cerevisiae) 1 1
MIRT046275 ILF2 interleukin enhancer binding factor 2, 45kDa 1 1
MIRT046276 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT046277 ABCF1 ATP-binding cassette, sub-family F (GCN20), member 1 1 1
MIRT046278 CCT7 chaperonin containing TCP1, subunit 7 (eta) 1 1
MIRT046279 SLC9A6 solute carrier family 9 (sodium/hydrogen exchanger), member 6 1 1
MIRT046280 DNAJC5 DnaJ (Hsp40) homolog, subfamily C, member 5 1 1
MIRT046281 KDM1A lysine (K)-specific demethylase 1A 1 1
MIRT046282 SSRP1 structure specific recognition protein 1 1 1
MIRT046283 INPP4A inositol polyphosphate-4-phosphatase, type I, 107kDa 1 1
MIRT046284 SBF1 SET binding factor 1 1 1
MIRT046285 PRPF6 PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae) 1 1
MIRT046286 GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 1 1
MIRT046287 TCP1 t-complex 1 1 1
MIRT046288 ILVBL ilvB (bacterial acetolactate synthase)-like 1 1
MIRT046289 PI4KB phosphatidylinositol 4-kinase, catalytic, beta 1 1
MIRT046290 AMOTL1 angiomotin like 1 1 1
MIRT046291 ATF7IP activating transcription factor 7 interacting protein 1 1
MIRT046292 BCL2L1 BCL2-like 1 1 1
MIRT046293 ZMYM2 zinc finger, MYM-type 2 1 1
MIRT046294 GANAB glucosidase, alpha; neutral AB 1 1
MIRT046295 IMPDH2 IMP (inosine 5'-monophosphate) dehydrogenase 2 1 1
MIRT046296 GJA1 gap junction protein, alpha 1, 43kDa 1 1
MIRT046297 COX1 cytochrome c oxidase subunit I 1 1
MIRT046298 HIST2H4B histone cluster 2, H4b 1 1
MIRT046299 CDCA8 cell division cycle associated 8 1 1
MIRT046300 DIAPH1 diaphanous homolog 1 (Drosophila) 1 1
MIRT046301 PLOD1 procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1 1 1
MIRT046302 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT046303 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT046304 AP4B1 adaptor-related protein complex 4, beta 1 subunit 1 1
MIRT046305 RAB5B RAB5B, member RAS oncogene family 1 1
MIRT046306 STK11IP serine/threonine kinase 11 interacting protein 1 1
MIRT046307 PSMD14 proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 1 1
MIRT046308 CLUAP1 clusterin associated protein 1 1 1
MIRT046309 CD302 CD302 molecule 1 1
MIRT046310 XPO1 exportin 1 (CRM1 homolog, yeast) 1 1
MIRT046311 GNA12 guanine nucleotide binding protein (G protein) alpha 12 1 1
MIRT046312 JAK1 Janus kinase 1 1 1
MIRT046313 PPARGC1B peroxisome proliferator-activated receptor gamma, coactivator 1 beta 1 1
MIRT046314 CYB561D1 cytochrome b-561 domain containing 1 1 1
MIRT046315 PRDX1 peroxiredoxin 1 1 1
MIRT046316 ABCC1 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 1 1
MIRT046317 NHP2L1 NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) 1 1
MIRT046318 AARS2 alanyl-tRNA synthetase 2, mitochondrial (putative) 1 1
MIRT046319 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT046320 RPN2 ribophorin II 1 1
MIRT046321 C11orf68 chromosome 11 open reading frame 68 1 1
MIRT046322 CPSF3L cleavage and polyadenylation specific factor 3-like 1 1
MIRT046323 MLLT6 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 1 1
MIRT046324 DDX27 DEAD (Asp-Glu-Ala-Asp) box polypeptide 27 1 1
MIRT046325 ITPR3 inositol 1,4,5-triphosphate receptor, type 3 1 1
MIRT046326 SYDE2 synapse defective 1, Rho GTPase, homolog 2 (C. elegans) 1 1
MIRT046327 PRR14L chromosome 22 open reading frame 30 1 1
MIRT046328 SUPT7L suppressor of Ty 7 (S. cerevisiae)-like 1 1
MIRT046329 BBS12 Bardet-Biedl syndrome 12 1 1
MIRT046330 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT046331 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT046332 GHITM growth hormone inducible transmembrane protein 1 1
MIRT046333 EWSR1 Ewing sarcoma breakpoint region 1 1 1
MIRT046334 EP300 E1A binding protein p300 1 1
MIRT046335 PDCD6IP programmed cell death 6 interacting protein 1 1
MIRT046336 SLC16A1 solute carrier family 16, member 1 (monocarboxylic acid transporter 1) 1 1
MIRT046337 DMTN erythrocyte membrane protein band 4.9 (dematin) 1 1
MIRT046338 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT046339 HIF1AN hypoxia inducible factor 1, alpha subunit inhibitor 1 1
MIRT046340 DONSON downstream neighbor of SON 1 1
MIRT046341 DNMBP dynamin binding protein 1 1
MIRT046342 KLHL2 kelch-like 2, Mayven (Drosophila) 1 1
MIRT046343 RAF1 v-raf-1 murine leukemia viral oncogene homolog 1 1 1
MIRT046344 KANSL1 KIAA1267 1 1
MIRT046345 COPA coatomer protein complex, subunit alpha 1 1
MIRT046346 PHF10 PHD finger protein 10 1 1
MIRT046347 CCNB2 cyclin B2 1 1
MIRT046348 LBR lamin B receptor 1 1
MIRT046349 DHX33 DEAH (Asp-Glu-Ala-His) box polypeptide 33 1 1
MIRT046350 ECH1 enoyl CoA hydratase 1, peroxisomal 1 1
MIRT046351 RPL22 ribosomal protein L22 1 1
MIRT046352 HNRNPK heterogeneous nuclear ribonucleoprotein K 1 1
MIRT046353 ITFG1 integrin alpha FG-GAP repeat containing 1 1 1
MIRT046354 UNC45A unc-45 homolog A (C. elegans) 1 1
MIRT046355 C8orf33 chromosome 8 open reading frame 33 1 1
MIRT046356 SLC6A15 solute carrier family 6 (neutral amino acid transporter), member 15 1 1
MIRT046357 MAP4 microtubule-associated protein 4 1 1
MIRT046358 RAD51 RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) 1 1
MIRT046359 SOCS6 suppressor of cytokine signaling 6 1 1
MIRT046360 PSAP prosaposin 1 1
MIRT046361 WWP2 WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT046362 CLTA clathrin, light chain A 1 1
MIRT046363 ALDOA aldolase A, fructose-bisphosphate 1 1
MIRT046364 HNRNPL heterogeneous nuclear ribonucleoprotein L 1 1
MIRT046365 TPCN1 two pore segment channel 1 1 1
MIRT046366 MPV17 MpV17 mitochondrial inner membrane protein 1 1
MIRT046367 NSD1 nuclear receptor binding SET domain protein 1 1 1
MIRT046368 DGCR2 DiGeorge syndrome critical region gene 2 1 1
MIRT046369 CDC20 cell division cycle 20 homolog (S. cerevisiae) 1 1
MIRT046370 PANK2 pantothenate kinase 2 1 1
MIRT046371 USP31 ubiquitin specific peptidase 31 1 1
MIRT046372 NMT1 N-myristoyltransferase 1 1 1
MIRT046373 TSR1 TSR1, 20S rRNA accumulation, homolog (S. cerevisiae) 1 1
MIRT046374 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT046375 E2F4 E2F transcription factor 4, p107/p130-binding 1 1
MIRT046376 GTF2I general transcription factor IIi 1 1
MIRT046377 NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) 1 1
MIRT046378 EMC1 KIAA0090 1 1
MIRT046379 ABCC4 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 1 1
MIRT046380 CMTM4 CKLF-like MARVEL transmembrane domain containing 4 1 1