Accession ID: MIRT046243 [miRNA, hsa-miR-23b-3p :: MSH6, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-23bLinkOut: [miRBase ]
Synonyms MIRN23B, hsa-mir-23b, miRNA23B, MIR23B
Description Homo sapiens miR-23b stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-23b-3p
Mature Sequence 58| AUCACAUUGCCAGGGAUUACC |78
Evidence Experimental
Experiments Cloned
Putative hsa-miR-23b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MSH6 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms GTBP, HNPCC5, HSAP
Description mutS homolog 6 (E. coli)
Transcript NM_000179    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MSH6 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MSH6
(miRNA target sites are highlighted)
>MSH6|NM_000179|3'UTR
   1 ACTGACTACATTGGAAGCTTTGAGTTGACTTCTGACAAAGGTGGTAAATTCAGACAACATTATGATCTAATAAACTTTAT
  81 TTTTTAAAAATGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ccAUUAGGGACCG-UUACACUa 5'
            |:| ::||| | || |||: 
Target 5' gtTGACTTCTGACAAAGGTGGt 3'
24 - 45 111.00 -11.20
2
miRNA  3' ccAUUAGGGAC---CGUUACACUA 5'
            ||| ::| |    || | ||||
Target 5' ggTAAATTCAGACAACATTATGAT 3'
43 - 66 87.00 -5.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-23b-3p :: MSH6    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
307 hsa-miR-23b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000125 OPRM1 opioid receptor, mu 1 1 2
MIRT001177 PRAP1 proline-rich acidic protein 1 3 1
MIRT001775 NOTCH1 notch 1 2 1
MIRT003424 E2F1 E2F transcription factor 1 2 1
MIRT003425 RB1 retinoblastoma 1 2 1
MIRT004291 PLAU plasminogen activator, urokinase 4 2
MIRT004292 MET met proto-oncogene (hepatocyte growth factor receptor) 4 1
MIRT006806 PRKACB protein kinase, cAMP-dependent, catalytic, beta 3 2
MIRT006963 PTK2B PTK2B protein tyrosine kinase 2 beta 0 1
MIRT007006 VHL von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase 1 1
MIRT007039 TAB3 TGF-beta activated kinase 1/MAP3K7 binding protein 3 1 1
MIRT007040 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT007041 CHUK conserved helix-loop-helix ubiquitous kinase 1 1
MIRT007051 SRC v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) 1 1
MIRT007096 PTEN phosphatase and tensin homolog 1 1
MIRT023464 DHX57 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 1 1
MIRT023465 CCDC88C coiled-coil domain containing 88C 1 1
MIRT023466 ACAT1 acetyl-CoA acetyltransferase 1 1 1
MIRT023467 ZIC5 Zic family member 5 1 1
MIRT023468 CEPT1 choline/ethanolamine phosphotransferase 1 1 1
MIRT023469 KIAA1279 KIAA1279 1 1
MIRT023470 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 1 1
MIRT023471 BLOC1S2 biogenesis of lysosomal organelles complex-1, subunit 2 1 1
MIRT023472 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 1
MIRT023473 ANKRD17 ankyrin repeat domain 17 1 1
MIRT023474 SPTY2D1 SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae) 1 2
MIRT023475 MED4 mediator complex subunit 4 1 1
MIRT023476 STAT5B signal transducer and activator of transcription 5B 1 1
MIRT023477 PNN pinin, desmosome associated protein 1 1
MIRT023478 ARFIP1 ADP-ribosylation factor interacting protein 1 1 1
MIRT023479 AKAP11 A kinase (PRKA) anchor protein 11 1 1
MIRT023480 SNRPC small nuclear ribonucleoprotein polypeptide C 1 1
MIRT023481 PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 1 1
MIRT023482 MCFD2 multiple coagulation factor deficiency 2 1 2
MIRT046240 SOS1 son of sevenless homolog 1 (Drosophila) 1 1
MIRT046241 CATSPERB catsper channel auxiliary subunit beta 1 1
MIRT046242 RPS27A ribosomal protein S27a 1 1
MIRT046243 MSH6 mutS homolog 6 (E. coli) 1 1
MIRT046244 RBPMS2 RNA binding protein with multiple splicing 2 1 1
MIRT046245 HK1 hexokinase 1 1 1
MIRT046246 BCL7B B-cell CLL/lymphoma 7B 1 1
MIRT046247 MED13L mediator complex subunit 13-like 1 1
MIRT046248 ATXN10 ataxin 10 1 1
MIRT046249 CDC73 cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT046250 FLNA filamin A, alpha 1 1
MIRT046251 CUL4A cullin 4A 1 1
MIRT046252 ZNFX1 zinc finger, NFX1-type containing 1 1 1
MIRT046253 WDR54 WD repeat domain 54 1 1
MIRT046254 UQCRC2 ubiquinol-cytochrome c reductase core protein II 1 1
MIRT046255 HERC3 HECT and RLD domain containing E3 ubiquitin protein ligase 3 1 1
MIRT046256 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT046257 CDK2 cyclin-dependent kinase 2 1 1
MIRT046258 RPL19 ribosomal protein L19 1 1
MIRT046259 ACTN4 actinin, alpha 4 1 1
MIRT046260 ATP1A1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 1 1
MIRT046261 DDX47 DEAD (Asp-Glu-Ala-Asp) box polypeptide 47 1 1
MIRT046262 CEP104 centrosomal protein 104kDa 1 1
MIRT046263 PPM1A protein phosphatase, Mg2+/Mn2+ dependent, 1A 1 1
MIRT046264 PPP1CB protein phosphatase 1, catalytic subunit, beta isozyme 1 1
MIRT046265 CPSF7 cleavage and polyadenylation specific factor 7, 59kDa 1 1
MIRT046266 GNS glucosamine (N-acetyl)-6-sulfatase 1 1
MIRT046267 SORCS2 sortilin-related VPS10 domain containing receptor 2 1 1
MIRT046268 LASP1 LIM and SH3 protein 1 1 1
MIRT046269 CAP1 CAP, adenylate cyclase-associated protein 1 (yeast) 1 1
MIRT046270 RRAGD Ras-related GTP binding D 1 1
MIRT046271 TCF25 transcription factor 25 (basic helix-loop-helix) 1 1
MIRT046272 FAM168B family with sequence similarity 168, member B 1 1
MIRT046273 BCS1L BC1 (ubiquinol-cytochrome c reductase) synthesis-like 1 1
MIRT046274 RMND5A required for meiotic nuclear division 5 homolog A (S. cerevisiae) 1 1
MIRT046275 ILF2 interleukin enhancer binding factor 2, 45kDa 1 1
MIRT046276 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT046277 ABCF1 ATP-binding cassette, sub-family F (GCN20), member 1 1 1
MIRT046278 CCT7 chaperonin containing TCP1, subunit 7 (eta) 1 1
MIRT046279 SLC9A6 solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6 1 1
MIRT046280 DNAJC5 DnaJ (Hsp40) homolog, subfamily C, member 5 1 1
MIRT046281 KDM1A lysine (K)-specific demethylase 1A 1 1
MIRT046282 SSRP1 structure specific recognition protein 1 1 1
MIRT046283 INPP4A inositol polyphosphate-4-phosphatase, type I, 107kDa 1 1
MIRT046284 SBF1 SET binding factor 1 1 1
MIRT046285 PRPF6 PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae) 1 1
MIRT046286 GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 1 1
MIRT046287 TCP1 t-complex 1 1 1
MIRT046288 ILVBL ilvB (bacterial acetolactate synthase)-like 1 1
MIRT046289 PI4KB phosphatidylinositol 4-kinase, catalytic, beta 1 1
MIRT046290 AMOTL1 angiomotin like 1 1 1
MIRT046291 ATF7IP activating transcription factor 7 interacting protein 1 1
MIRT046292 BCL2L1 BCL2-like 1 1 1
MIRT046293 ZMYM2 zinc finger, MYM-type 2 1 1
MIRT046294 GANAB glucosidase, alpha; neutral AB 1 1
MIRT046295 IMPDH2 IMP (inosine 5'-monophosphate) dehydrogenase 2 1 1
MIRT046296 GJA1 gap junction protein, alpha 1, 43kDa 1 1
MIRT046297 COX1 cytochrome c oxidase subunit I 1 1
MIRT046298 HIST2H4B histone cluster 2, H4b 1 1
MIRT046299 CDCA8 cell division cycle associated 8 1 1
MIRT046300 DIAPH1 diaphanous homolog 1 (Drosophila) 1 1
MIRT046301 PLOD1 procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 1 1
MIRT046302 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT046303 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT046304 AP4B1 adaptor-related protein complex 4, beta 1 subunit 1 1
MIRT046305 RAB5B RAB5B, member RAS oncogene family 1 1
MIRT046306 STK11IP serine/threonine kinase 11 interacting protein 1 1
MIRT046307 PSMD14 proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 1 1
MIRT046308 CLUAP1 clusterin associated protein 1 1 1
MIRT046309 CD302 CD302 molecule 1 1
MIRT046310 XPO1 exportin 1 (CRM1 homolog, yeast) 1 1
MIRT046311 GNA12 guanine nucleotide binding protein (G protein) alpha 12 1 1
MIRT046312 JAK1 Janus kinase 1 1 1
MIRT046313 PPARGC1B peroxisome proliferator-activated receptor gamma, coactivator 1 beta 1 1
MIRT046314 CYB561D1 cytochrome b-561 domain containing 1 1 1
MIRT046315 PRDX1 peroxiredoxin 1 1 1
MIRT046316 ABCC1 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 1 1
MIRT046317 NHP2L1 NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) 1 1
MIRT046318 AARS2 alanyl-tRNA synthetase 2, mitochondrial 1 1
MIRT046319 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT046320 RPN2 ribophorin II 1 1
MIRT046321 C11orf68 chromosome 11 open reading frame 68 1 1
MIRT046322 CPSF3L cleavage and polyadenylation specific factor 3-like 1 1
MIRT046323 MLLT6 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 1 1
MIRT046324 DDX27 DEAD (Asp-Glu-Ala-Asp) box polypeptide 27 1 1
MIRT046325 ITPR3 inositol 1,4,5-trisphosphate receptor, type 3 1 1
MIRT046326 SYDE2 synapse defective 1, Rho GTPase, homolog 2 (C. elegans) 1 1
MIRT046327 PRR14L proline rich 14-like 1 1
MIRT046328 SUPT7L suppressor of Ty 7 (S. cerevisiae)-like 1 1
MIRT046329 BBS12 Bardet-Biedl syndrome 12 1 1
MIRT046330 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT046331 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT046332 GHITM growth hormone inducible transmembrane protein 1 1
MIRT046333 EWSR1 Ewing sarcoma breakpoint region 1 1 1
MIRT046334 EP300 E1A binding protein p300 1 1
MIRT046335 PDCD6IP programmed cell death 6 interacting protein 1 1
MIRT046336 SLC16A1 solute carrier family 16, member 1 (monocarboxylic acid transporter 1) 1 1
MIRT046337 DMTN erythrocyte membrane protein band 4.9 (dematin) 1 1
MIRT046338 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT046339 HIF1AN hypoxia inducible factor 1, alpha subunit inhibitor 1 1
MIRT046340 DONSON downstream neighbor of SON 1 1
MIRT046341 DNMBP dynamin binding protein 1 1
MIRT046342 KLHL2 kelch-like 2, Mayven (Drosophila) 1 1
MIRT046343 RAF1 v-raf-1 murine leukemia viral oncogene homolog 1 1 1
MIRT046344 KANSL1 KAT8 regulatory NSL complex subunit 1 1 1
MIRT046345 COPA coatomer protein complex, subunit alpha 1 1
MIRT046346 PHF10 PHD finger protein 10 1 1
MIRT046347 CCNB2 cyclin B2 1 1
MIRT046348 LBR lamin B receptor 1 1
MIRT046349 DHX33 DEAH (Asp-Glu-Ala-His) box polypeptide 33 1 1
MIRT046350 ECH1 enoyl CoA hydratase 1, peroxisomal 1 1
MIRT046351 RPL22 ribosomal protein L22 1 1
MIRT046352 HNRNPK heterogeneous nuclear ribonucleoprotein K 1 1
MIRT046353 ITFG1 integrin alpha FG-GAP repeat containing 1 1 1
MIRT046354 UNC45A unc-45 homolog A (C. elegans) 1 1
MIRT046355 C8orf33 chromosome 8 open reading frame 33 1 1
MIRT046356 SLC6A15 solute carrier family 6 (neutral amino acid transporter), member 15 1 1
MIRT046357 MAP4 microtubule-associated protein 4 1 1
MIRT046358 RAD51 RAD51 homolog (S. cerevisiae) 1 1
MIRT046359 SOCS6 suppressor of cytokine signaling 6 1 1
MIRT046360 PSAP prosaposin 1 1
MIRT046361 WWP2 WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT046362 CLTA clathrin, light chain A 1 1
MIRT046363 ALDOA aldolase A, fructose-bisphosphate 1 1
MIRT046364 HNRNPL heterogeneous nuclear ribonucleoprotein L 1 1
MIRT046365 TPCN1 two pore segment channel 1 1 1
MIRT046366 MPV17 MpV17 mitochondrial inner membrane protein 1 1
MIRT046367 NSD1 nuclear receptor binding SET domain protein 1 1 1
MIRT046368 DGCR2 DiGeorge syndrome critical region gene 2 1 1
MIRT046369 CDC20 cell division cycle 20 homolog (S. cerevisiae) 1 1
MIRT046370 PANK2 pantothenate kinase 2 1 1
MIRT046371 USP31 ubiquitin specific peptidase 31 1 1
MIRT046372 NMT1 N-myristoyltransferase 1 1 1
MIRT046373 TSR1 TSR1, 20S rRNA accumulation, homolog (S. cerevisiae) 1 1
MIRT046374 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT046375 E2F4 E2F transcription factor 4, p107/p130-binding 1 1
MIRT046376 GTF2I general transcription factor IIi 1 1
MIRT046377 NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) 1 1
MIRT046378 EMC1 ER membrane protein complex subunit 1 1 1
MIRT046379 ABCC4 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 1 1
MIRT046380 CMTM4 CKLF-like MARVEL transmembrane domain containing 4 1 1
MIRT053244 ZEB1 zinc finger E-box binding homeobox 1 2 1
MIRT054308 TUSC7 LSAMP antisense RNA 3 5 1
MIRT054635 RUNX2 runt-related transcription factor 2 3 1
MIRT064147 TSNAX translin-associated factor X 1 1
MIRT066948 ATXN7L3B ataxin 7-like 3B 1 4
MIRT067321 SESN2 sestrin 2 1 2
MIRT074334 TNRC6A trinucleotide repeat containing 6A 1 3
MIRT097059 TNPO1 transportin 1 1 1
MIRT110338 ADD3 adducin 3 (gamma) 1 1
MIRT133659 ETNK1 ethanolamine kinase 1 1 1
MIRT134660 PNRC2 proline-rich nuclear receptor coactivator 2 1 1
MIRT156700 C2ORF69 chromosome 2 open reading frame 69 1 1
MIRT213995 DCP2 DCP2 decapping enzyme homolog (S. cerevisiae) 1 1
MIRT235221 ZNF257 zinc finger protein 257 1 4
MIRT266430 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT269204 FUT4 fucosyltransferase 4 (alpha (1,3) fucosyltransferase, myeloid-specific) 1 1
MIRT281197 SEMA6D sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D 1 1
MIRT322936 PLAG1 pleiomorphic adenoma gene 1 1 1
MIRT323483 CA2 carbonic anhydrase II 3 1
MIRT326651 ZNF275 zinc finger protein 275 1 2
MIRT332709 QSER1 glutamine and serine rich 1 1 1
MIRT399756 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT437896 MARCKS myristoylated alanine-rich protein kinase C substrate 1 1
MIRT438004 RRAS2 related RAS viral (r-ras) oncogene homolog 2 1 1
MIRT438260 HMGA2 high mobility group AT-hook 2 1 1
MIRT438321 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 3 1
MIRT438322 NOTCH2 notch 2 3 1
MIRT438323 HMGB2 high mobility group box 2 4 3
MIRT438324 ATG12 autophagy related 12 3 2
MIRT448266 ZNF704 zinc finger protein 704 1 4
MIRT461717 ZNF426 zinc finger protein 426 1 1
MIRT462563 STS steroid sulfatase (microsomal), isozyme S 1 1
MIRT466131 TMEM170A transmembrane protein 170A 1 1
MIRT466154 TMED7 transmembrane emp24 protein transport domain containing 7 1 1
MIRT466970 STARD7 StAR-related lipid transfer (START) domain containing 7 1 2
MIRT468567 SERINC3 serine incorporator 3 1 6
MIRT468708 SDHD succinate dehydrogenase complex, subunit D, integral membrane protein 1 1
MIRT471442 PDIA6 protein disulfide isomerase family A, member 6 1 1
MIRT471789 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT472552 NACC1 nucleus accumbens associated 1, BEN and BTB (POZ) domain containing 1 2
MIRT474686 KLF10 Kruppel-like factor 10 1 1
MIRT479114 CNN2 calponin 2 1 1
MIRT480259 C8orf58 chromosome 8 open reading frame 58 1 1
MIRT485406 MGAT5 mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase 1 2
MIRT493595 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble) 1 1
MIRT499305 ZNF485 zinc finger protein 485 1 5
MIRT499480 ZNF669 zinc finger protein 669 1 3
MIRT500384 ZNF281 zinc finger protein 281 1 3
MIRT500593 UQCRFS1 ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 1 2
MIRT501539 POM121C POM121 transmembrane nucleoporin C 1 3
MIRT502717 CNOT6 CCR4-NOT transcription complex, subunit 6 1 1
MIRT504207 VAV3 vav 3 guanine nucleotide exchange factor 1 6
MIRT504351 VCAM1 vascular cell adhesion molecule 1 1 4
MIRT507519 DSTN destrin (actin depolymerizing factor) 1 2
MIRT510410 ZNF268 zinc finger protein 268 1 2
MIRT513494 SSR1 signal sequence receptor, alpha 1 3
MIRT514676 ZNF701 zinc finger protein 701 1 2
MIRT515105 ZNF578 zinc finger protein 578 1 3
MIRT515366 ZNF208 zinc finger protein 208 1 3
MIRT523134 HS2ST1 heparan sulfate 2-O-sulfotransferase 1 1 3
MIRT524023 DOCK4 dedicator of cytokinesis 4 1 2
MIRT526726 ZNF138 zinc finger protein 138 1 2
MIRT527297 KIAA1210 KIAA1210 1 1
MIRT527774 DNAJC21 DnaJ (Hsp40) homolog, subfamily C, member 21 1 1
MIRT527957 MTAP methylthioadenosine phosphorylase 1 1
MIRT528476 STAMBPL1 STAM binding protein-like 1 1 1
MIRT528677 CEP57L1 centrosomal protein 57kDa-like 1 1 1
MIRT529968 MC2R melanocortin 2 receptor (adrenocorticotropic hormone) 1 1
MIRT530628 PPIC peptidylprolyl isomerase C (cyclophilin C) 1 2
MIRT531700 ADAM28 ADAM metallopeptidase domain 28 1 1
MIRT532126 NOL11 nucleolar protein 11 1 1
MIRT533565 TOR1AIP1 torsin A interacting protein 1 1 1
MIRT534695 RNF111 ring finger protein 111 1 1
MIRT535234 PIGM phosphatidylinositol glycan anchor biosynthesis, class M 1 1
MIRT535673 NLGN4X neuroligin 4, X-linked 1 1
MIRT536168 MAP1B microtubule-associated protein 1B 1 1
MIRT536574 JMJD1C jumonji domain containing 1C 1 1
MIRT537660 ERBB2IP erbb2 interacting protein 1 1
MIRT539515 ACSS3 acyl-CoA synthetase short-chain family member 3 1 1
MIRT549738 ZNF273 zinc finger protein 273 1 1
MIRT549945 RPL7L1 ribosomal protein L7-like 1 1 1
MIRT551461 TRIM59 tripartite motif containing 59 1 1
MIRT552500 ZIK1 zinc finger protein interacting with K protein 1 homolog (mouse) 1 1
MIRT552596 ZCCHC2 zinc finger, CCHC domain containing 2 1 1
MIRT553492 TNFAIP3 tumor necrosis factor, alpha-induced protein 3 1 1
MIRT557973 FAM222B family with sequence similarity 222, member B 1 1
MIRT562010 LMNB1 lamin B1 1 1
MIRT564154 ZNF117 zinc finger protein 117 1 1
MIRT565001 WEE1 WEE1 homolog (S. pombe) 1 1
MIRT565258 TPM3 tropomyosin 3 1 1
MIRT565966 RPP14 ribonuclease P/MRP 14kDa subunit 1 1
MIRT566189 PTPN14 protein tyrosine phosphatase, non-receptor type 14 1 1
MIRT566924 LMAN2 lectin, mannose-binding 2 1 1
MIRT573022 SWAP70 SWAP switching B-cell complex 70kDa subunit 1 1
MIRT574869 ARL6IP1 ADP-ribosylation factor-like 6 interacting protein 1 1 1
MIRT574946 Vav3 vav 3 oncogene 1 1
MIRT611159 BTLA B and T lymphocyte associated 1 1
MIRT611238 ZNF550 zinc finger protein 550 1 2
MIRT611619 SLC35G3 solute carrier family 35, member G3 1 1
MIRT617562 RPSAP58 ribosomal protein SA pseudogene 58 1 2
MIRT623715 HAPLN1 hyaluronan and proteoglycan link protein 1 1 1
MIRT623970 FBN2 fibrillin 2 1 1
MIRT624023 EN2 engrailed homeobox 2 1 1
MIRT625208 TNFAIP8 tumor necrosis factor, alpha-induced protein 8 1 2
MIRT630782 CRLS1 cardiolipin synthase 1 1 1
MIRT631658 NDUFV3 NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa 1 1
MIRT642821 SOD2 superoxide dismutase 2, mitochondrial 1 1
MIRT642994 SNTG1 syntrophin, gamma 1 1 1
MIRT646025 S100A7A S100 calcium binding protein A7A 1 1
MIRT651178 ZNF319 zinc finger protein 319 1 1
MIRT652569 TLR6 toll-like receptor 6 1 1
MIRT652688 THUMPD3 THUMP domain containing 3 1 1
MIRT652805 TBL2 transducin (beta)-like 2 1 1
MIRT658074 FOXR2 forkhead box R2 1 1
MIRT668317 FNIP1 folliculin interacting protein 1 1 1
MIRT669082 CELF1 CUGBP, Elav-like family member 1 1 1
MIRT683292 ZNF253 zinc finger protein 253 1 1
MIRT683827 ZNF682 zinc finger protein 682 1 1
MIRT686223 ZNF267 zinc finger protein 267 1 1
MIRT687152 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT687164 PTGFRN prostaglandin F2 receptor negative regulator 1 1
MIRT697749 USP5 ubiquitin specific peptidase 5 (isopeptidase T) 1 1
MIRT698110 TOPBP1 topoisomerase (DNA) II binding protein 1 1 1
MIRT700085 RNF38 ring finger protein 38 1 1
MIRT701910 MMGT1 membrane magnesium transporter 1 1 1
MIRT702053 RNMT RNA (guanine-7-) methyltransferase 1 1
MIRT705919 ADAM17 ADAM metallopeptidase domain 17 1 1
MIRT707570 DYNC2LI1 dynein, cytoplasmic 2, light intermediate chain 1 1 1
MIRT709246 CENPM centromere protein M 1 1
MIRT710505 BSDC1 BSD domain containing 1 1 1
MIRT720193 MPP6 membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6) 1 1
MIRT723229 FAM91A1 family with sequence similarity 91, member A1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*