Accession ID: MIRT046452 [miRNA, hsa-miR-15b-5p :: BRAT1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-15bLinkOut: [miRBase ]
Synonyms MIRN15B, hsa-mir-15b, miR-15b, MIR15B
Description Homo sapiens miR-15b stem-loop
Comment This miRNA sequence was predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-15b-5p
Mature Sequence 20| UAGCAGCACAUCAUGGUUUACA |41
Evidence Experimental
Experiments Cloned
Putative hsa-miR-15b-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol BRAT1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms BAAT1, C7orf27, RMFSL
Description BRCA1-associated ATM activator 1
Transcript NM_152743    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on BRAT1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of BRAT1
(miRNA target sites are highlighted)
>BRAT1|NM_152743|3'UTR
   1 GCAGAACCAGAGTCTGCCACTGGGGCTCAGGACCAAGGGAGGCAGCACCATGTCCTTCTGTGGGACACTGCCAGCCCCAG
  81 GGCTCCAGCCCAGCCCGGTGGATCCTCTGGGGAAGCCAGGACCAGGAGAGAAGCAAGGTCAAGAAATCCCACAGTTTGAT
 161 GTATTAAAGAAATGACTTATTTCTACTCAAAATAAATGGCATTGAAGTCTTTCTTTAACCCTTTTTGAGTTAATTTAATA
 241 ATAATGATCTGAGACAAGG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' acaUUUGGUACUACACGACGAu 5'
             :|||||  :| |||  || 
Target 5' gcaGAACCAGAGTCTGCCACTg 3'
1 - 22 99.00 -11.04
2
miRNA  3' acauuUGGUACUACACGACGAu 5'
               | ||  |||| || || 
Target 5' gaggcAGCACCATGTCCTTCTg 3'
39 - 60 97.00 -9.20
3
miRNA  3' acauuugguacuacaCGACGau 5'
                         ||| |  
Target 5' actgccagccccaggGCTCCag 3'
67 - 88 68.00 -8.40
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-15b-5p :: BRAT1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
725 hsa-miR-15b-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000276 CCNE1 cyclin E1 5 6
MIRT000607 RECK reversion-inducing-cysteine-rich protein with kazal motifs 5 2
MIRT000978 BCL2 B-cell CLL/lymphoma 2 5 4
MIRT003913 CCND1 cyclin D1 5 3
MIRT004274 VEGFA vascular endothelial growth factor A 3 8
MIRT004526 EIF4A1 eukaryotic translation initiation factor 4A1 2 1
MIRT006750 AXIN2 axin 2 2 4
MIRT006914 IFNG interferon, gamma 2 1
MIRT007001 PURA purine-rich element binding protein A 2 2
MIRT023483 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT046381 C5orf15 chromosome 5 open reading frame 15 1 1
MIRT046382 MTMR6 myotubularin related protein 6 1 1
MIRT046383 AP5S1 adaptor-related protein complex 5, sigma 1 subunit 1 1
MIRT046384 MRPS11 mitochondrial ribosomal protein S11 1 1
MIRT046385 NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) 1 1
MIRT046386 EIF2AK2 eukaryotic translation initiation factor 2-alpha kinase 2 1 1
MIRT046387 CD44 CD44 molecule (Indian blood group) 1 1
MIRT046388 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT046389 HNRNPK heterogeneous nuclear ribonucleoprotein K 1 1
MIRT046390 SERBP1 SERPINE1 mRNA binding protein 1 1 2
MIRT046391 AIG1 androgen-induced 1 1 1
MIRT046392 POU2F1 POU class 2 homeobox 1 1 1
MIRT046393 RAB1B RAB1B, member RAS oncogene family 1 1
MIRT046394 RPS3A ribosomal protein S3A 1 1
MIRT046395 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 1 1
MIRT046396 SYNJ1 synaptojanin 1 1 1
MIRT046397 FAXC failed axon connections homolog (Drosophila) 1 1
MIRT046398 PLSCR4 phospholipid scramblase 4 1 1
MIRT046399 NUP210 nucleoporin 210kDa 1 1
MIRT046400 URB2 URB2 ribosome biogenesis 2 homolog (S. cerevisiae) 1 1
MIRT046401 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT046402 PXMP2 peroxisomal membrane protein 2, 22kDa 1 1
MIRT046403 RLIM ring finger protein, LIM domain interacting 1 1
MIRT046404 TMC7 transmembrane channel-like 7 1 1
MIRT046405 FAM214A family with sequence similarity 214, member A 1 1
MIRT046406 TMEM63B transmembrane protein 63B 1 1
MIRT046407 UACA uveal autoantigen with coiled-coil domains and ankyrin repeats 1 1
MIRT046408 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT046409 RPL27A ribosomal protein L27a 1 1
MIRT046410 WAC WW domain containing adaptor with coiled-coil 1 1
MIRT046411 CHMP7 charged multivesicular body protein 7 1 1
MIRT046412 CDK4 cyclin-dependent kinase 4 1 1
MIRT046413 VDAC2 voltage-dependent anion channel 2 1 1
MIRT046414 PGD phosphogluconate dehydrogenase 1 2
MIRT046415 PIK3C2B phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta 1 1
MIRT046416 MPHOSPH9 M-phase phosphoprotein 9 1 1
MIRT046417 MPP1 membrane protein, palmitoylated 1, 55kDa 1 1
MIRT046418 MARCKS myristoylated alanine-rich protein kinase C substrate 1 1
MIRT046419 NAB1 NGFI-A binding protein 1 (EGR1 binding protein 1) 1 1
MIRT046420 MESDC2 mesoderm development candidate 2 1 1
MIRT046421 ATP6V0E1 ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 1 1
MIRT046422 RPS6 ribosomal protein S6 1 1
MIRT046423 TPD52 tumor protein D52 1 1
MIRT046424 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT046425 LIN28B lin-28 homolog B (C. elegans) 1 1
MIRT046426 TARDBP TAR DNA binding protein 1 1
MIRT046427 PHLDB3 pleckstrin homology-like domain, family B, member 3 1 1
MIRT046428 TNPO3 transportin 3 1 1
MIRT046429 PPTC7 PTC7 protein phosphatase homolog (S. cerevisiae) 1 1
MIRT046430 VPS13A vacuolar protein sorting 13 homolog A (S. cerevisiae) 1 1
MIRT046431 QRICH1 glutamine-rich 1 1 1
MIRT046432 SCCPDH saccharopine dehydrogenase (putative) 1 1
MIRT046433 NDFIP1 Nedd4 family interacting protein 1 1 1
MIRT046434 TCP1 t-complex 1 1 1
MIRT046435 DHFR dihydrofolate reductase 1 1
MIRT046436 DSG2 desmoglein 2 1 1
MIRT046437 EDC4 enhancer of mRNA decapping 4 1 1
MIRT046438 ECHS1 enoyl CoA hydratase, short chain, 1, mitochondrial 1 1
MIRT046439 HNRNPM heterogeneous nuclear ribonucleoprotein M 1 1
MIRT046440 PPIL1 peptidylprolyl isomerase (cyclophilin)-like 1 1 5
MIRT046441 TANGO6 transmembrane and coiled-coil domains 7 1 1
MIRT046442 FOXK1 forkhead box K1 1 3
MIRT046443 KMT2C myeloid/lymphoid or mixed-lineage leukemia 3 1 1
MIRT046444 LSM14A LSM14A, SCD6 homolog A (S. cerevisiae) 1 1
MIRT046445 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT046446 CYBA cytochrome b-245, alpha polypeptide 1 1
MIRT046447 BEX1 brain expressed, X-linked 1 1 1
MIRT046448 CYP51A1 cytochrome P450, family 51, subfamily A, polypeptide 1 1 1
MIRT046449 DNAJC5 DnaJ (Hsp40) homolog, subfamily C, member 5 1 1
MIRT046450 CLCN6 chloride channel, voltage-sensitive 6 1 1
MIRT046451 SEPT2 septin 2 1 2
MIRT046452 BRAT1 BRCA1-associated ATM activator 1 1 1
MIRT046453 HSPA8 heat shock 70kDa protein 8 1 1
MIRT046454 TSPAN3 tetraspanin 3 1 1
MIRT046455 CHEK1 checkpoint kinase 1 1 3
MIRT046456 FADD Fas (TNFRSF6)-associated via death domain 1 1
MIRT046457 ZCCHC14 zinc finger, CCHC domain containing 14 1 1
MIRT046458 ITGA6 integrin, alpha 6 1 1
MIRT046459 DDX5 DEAD (Asp-Glu-Ala-Asp) box helicase 5 1 1
MIRT046460 MYCBP2 MYC binding protein 2, E3 ubiquitin protein ligase 1 1
MIRT046461 LRRC41 leucine rich repeat containing 41 1 1
MIRT046462 IFIH1 interferon induced with helicase C domain 1 1 1
MIRT046463 TERF2 telomeric repeat binding factor 2 1 1
MIRT046464 RPLP0 ribosomal protein, large, P0 1 1
MIRT046465 NUP214 nucleoporin 214kDa 1 1
MIRT046466 STT3B STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae) 1 1
MIRT046467 TXLNA taxilin alpha 1 1
MIRT046468 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 1 2
MIRT046469 SFT2D1 SFT2 domain containing 1 1 1
MIRT046470 FBXO30 F-box protein 30 1 1
MIRT046471 JAK1 Janus kinase 1 1 1
MIRT046472 TMEM43 transmembrane protein 43 1 1
MIRT046473 CKAP5 cytoskeleton associated protein 5 1 1
MIRT046474 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 1 2
MIRT046475 DHX30 DEAH (Asp-Glu-Ala-His) box polypeptide 30 1 1
MIRT046476 TGOLN2 trans-golgi network protein 2 1 1
MIRT046477 HNRNPH3 heterogeneous nuclear ribonucleoprotein H3 (2H9) 1 1
MIRT046478 PRPS1 phosphoribosyl pyrophosphate synthetase 1 1 1
MIRT046479 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT046480 UVSSA UV-stimulated scaffold protein A 1 1
MIRT046481 AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon) 1 1
MIRT046482 INADL InaD-like (Drosophila) 1 1
MIRT046483 ZNF217 zinc finger protein 217 1 1
MIRT046484 GNL3L guanine nucleotide binding protein-like 3 (nucleolar)-like 1 1
MIRT046485 VPS35 vacuolar protein sorting 35 homolog (S. cerevisiae) 1 1
MIRT046486 COIL coilin 1 1
MIRT046487 RAE1 RAE1 RNA export 1 homolog (S. pombe) 1 1
MIRT046488 UBE3B ubiquitin protein ligase E3B 1 1
MIRT046489 PPIL2 peptidylprolyl isomerase (cyclophilin)-like 2 1 1
MIRT046490 AP2M1 adaptor-related protein complex 2, mu 1 subunit 1 1
MIRT046491 ZNRF1 zinc and ring finger 1, E3 ubiquitin protein ligase 1 2
MIRT046492 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT046493 SLC39A14 solute carrier family 39 (zinc transporter), member 14 1 1
MIRT046494 CHPF chondroitin polymerizing factor 1 1
MIRT046495 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT046496 NUP160 nucleoporin 160kDa 1 1
MIRT046497 MDH1 malate dehydrogenase 1, NAD (soluble) 1 1
MIRT046498 PPP1CC protein phosphatase 1, catalytic subunit, gamma isozyme 1 1
MIRT046499 SMAD7 SMAD family member 7 4 6
MIRT046500 RANBP10 RAN binding protein 10 1 1
MIRT046501 THRA thyroid hormone receptor, alpha 1 1
MIRT046502 APRT adenine phosphoribosyltransferase 1 1
MIRT046503 QARS glutaminyl-tRNA synthetase 1 1
MIRT046504 MLLT4 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 1 1
MIRT046505 STXBP1 syntaxin binding protein 1 1 1
MIRT046506 VOPP1 vesicular, overexpressed in cancer, prosurvival protein 1 1 1
MIRT046507 MCPH1 microcephalin 1 1 1
MIRT046508 HSP90AB1 heat shock protein 90kDa alpha (cytosolic), class B member 1 1 1
MIRT046509 PSMD7 proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 1 1
MIRT046510 SUPT3H suppressor of Ty 3 homolog (S. cerevisiae) 1 1
MIRT046511 DHX37 DEAH (Asp-Glu-Ala-His) box polypeptide 37 1 1
MIRT046512 DENR density-regulated protein 1 1
MIRT046513 FAM115C family with sequence similarity 115, member C 1 1
MIRT046514 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT046515 BAMBI BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) 1 1
MIRT046516 PPP1CB protein phosphatase 1, catalytic subunit, beta isozyme 1 1
MIRT046517 LZTR1 leucine-zipper-like transcription regulator 1 1 1
MIRT046518 TRAPPC1 trafficking protein particle complex 1 1 1
MIRT046519 CPOX coproporphyrinogen oxidase 1 1
MIRT046520 RBM27 RNA binding motif protein 27 1 1
MIRT046521 ARID2 AT rich interactive domain 2 (ARID, RFX-like) 1 1
MIRT046522 ZFAND5 zinc finger, AN1-type domain 5 1 1
MIRT046523 EIF5B eukaryotic translation initiation factor 5B 1 1
MIRT046524 PRDX3 peroxiredoxin 3 1 1
MIRT046525 AIFM2 apoptosis-inducing factor, mitochondrion-associated, 2 1 1
MIRT046526 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT046527 HIST2H3A histone cluster 2, H3a 1 1
MIRT046528 AMMECR1L AMME chromosomal region gene 1-like 1 1
MIRT046529 FGF5 fibroblast growth factor 5 1 1
MIRT046530 XKR9 XK, Kell blood group complex subunit-related family, member 9 1 1
MIRT046531 C1orf43 chromosome 1 open reading frame 43 1 1
MIRT046532 FANCC Fanconi anemia, complementation group C 1 1
MIRT046533 RNF149 ring finger protein 149 1 2
MIRT046534 IFNGR2 interferon gamma receptor 2 (interferon gamma transducer 1) 1 1
MIRT046535 TBRG4 transforming growth factor beta regulator 4 1 1
MIRT046536 AP4S1 adaptor-related protein complex 4, sigma 1 subunit 1 1
MIRT046537 ETNK1 ethanolamine kinase 1 1 2
MIRT046538 BTAF1 BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae) 1 1
MIRT046539 NRIP1 nuclear receptor interacting protein 1 1 1
MIRT046540 RPS3 ribosomal protein S3 1 1
MIRT046541 PTBP1 polypyrimidine tract binding protein 1 1 1
MIRT046542 PPT1 palmitoyl-protein thioesterase 1 1 1
MIRT052909 FOXO1 forkhead box O1 3 1
MIRT054796 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 4 2
MIRT054797 CRIM1 cysteine rich transmembrane BMP regulator 1 (chordin-like) 4 4
MIRT054815 FGF2 fibroblast growth factor 2 (basic) 2 3
MIRT055423 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 6
MIRT055816 PLEKHA1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 1 1
MIRT057516 CEP55 centrosomal protein 55kDa 1 4
MIRT057734 ZDHHC16 zinc finger, DHHC-type containing 16 1 1
MIRT057908 STXBP3 syntaxin binding protein 3 1 1
MIRT061006 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061246 AMOTL1 angiomotin like 1 1 6
MIRT061530 BTG2 BTG family, member 2 1 1
MIRT064687 CCND2 cyclin D2 1 2
MIRT065715 TARBP2 TAR (HIV-1) RNA binding protein 2 1 2
MIRT066295 MTFR1L family with sequence similarity 54, member B 1 1
MIRT066313 USP15 ubiquitin specific peptidase 15 1 1
MIRT068657 AKAP11 A kinase (PRKA) anchor protein 11 1 1
MIRT071210 FCF1 FCF1 small subunit (SSU) processome component homolog (S. cerevisiae) 1 1
MIRT072824 ARIH1 ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) 1 3
MIRT074532 PAGR1 PAXIP1 associated glutamate-rich protein 1 1 2
MIRT075253 SNTB2 syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) 1 2
MIRT075276 VPS4A vacuolar protein sorting 4 homolog A (S. cerevisiae) 1 4
MIRT075895 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076794 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077784 MINK1 misshapen-like kinase 1 1 1
MIRT078284 RPS6KB1 ribosomal protein S6 kinase, 70kDa, polypeptide 1 1 1
MIRT079656 NAPG N-ethylmaleimide-sensitive factor attachment protein, gamma 1 6
MIRT080013 GALNT1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) 1 2
MIRT082987 PNPLA6 patatin-like phospholipase domain containing 6 1 1
MIRT083267 ZCCHC3 zinc finger, CCHC domain containing 3 1 3
MIRT084464 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085216 CCNT2 cyclin T2 1 1
MIRT086011 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087425 ZNRF3 zinc and ring finger 3 1 1
MIRT087556 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide 1 1
MIRT089110 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089210 ACTR2 ARP2 actin-related protein 2 homolog (yeast) 1 2
MIRT090449 CDV3 CDV3 homolog (mouse) 1 1
MIRT090690 U2SURP U2 snRNP-associated SURP domain containing 1 1
MIRT091672 RARB retinoic acid receptor, beta 1 3
MIRT092194 ITPR1 inositol 1,4,5-trisphosphate receptor, type 1 1 1
MIRT092212 BHLHE40 basic helix-loop-helix family, member e40 1 1
MIRT093686 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096237 CANX calnexin 1 1
MIRT098829 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099632 E2F3 E2F transcription factor 3 1 1
MIRT100209 PPP1R11 protein phosphatase 1, regulatory (inhibitor) subunit 11 1 1
MIRT100366 HSPA1B heat shock 70kDa protein 1B 1 4
MIRT100570 PIM1 pim-1 oncogene 1 1
MIRT100898 CD2AP CD2-associated protein 1 1
MIRT102438 CALU calumenin 1 2
MIRT102634 UBN2 ubinuclein 2 1 6
MIRT102972 EN2 engrailed homeobox 2 1 3
MIRT103095 MAFK v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) 1 3
MIRT104017 USP42 ubiquitin specific peptidase 42 1 3
MIRT104234 DMTF1 cyclin D binding myb-like transcription factor 1 1 2
MIRT106296 ZFHX4 zinc finger homeobox 4 1 3
MIRT106735 RAD23B RAD23 homolog B (S. cerevisiae) 1 2
MIRT107219 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108984 SLC9A6 solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6 1 1
MIRT109243 ZNF275 zinc finger protein 275 1 1
MIRT110055 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112973 LUZP1 leucine zipper protein 1 1 3
MIRT114925 CHAC1 ChaC, cation transport regulator homolog 1 (E. coli) 1 1
MIRT117658 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120682 PAK2 p21 protein (Cdc42/Rac)-activated kinase 2 1 1
MIRT125922 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 1 1
MIRT127732 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128804 UBE4A ubiquitination factor E4A 1 1
MIRT129058 ARCN1 archain 1 1 1
MIRT130382 PTPRJ protein tyrosine phosphatase, receptor type, J 1 1
MIRT131100 TMEM138 transmembrane protein 138 1 1
MIRT132744 RASSF5 Ras association (RalGDS/AF-6) domain family member 5 1 1
MIRT132834 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133337 BCL7A B-cell CLL/lymphoma 7A 1 1
MIRT133772 SKI v-ski sarcoma viral oncogene homolog (avian) 1 2
MIRT137519 RCOR1 REST corepressor 1 1 1
MIRT140149 SPRED1 sprouty-related, EVH1 domain containing 1 1 2
MIRT140825 SMAD3 SMAD family member 3 1 1
MIRT141245 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141282 UBE2Q2 ubiquitin-conjugating enzyme E2Q family member 2 1 1
MIRT142243 DCTN5 dynactin 5 (p25) 1 5
MIRT144028 PSKH1 protein serine kinase H1 1 1
MIRT145382 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146019 EZH1 enhancer of zeste homolog 1 (Drosophila) 1 1
MIRT146355 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146501 SNX11 sorting nexin 11 1 1
MIRT148307 RNF138 ring finger protein 138, E3 ubiquitin protein ligase 1 1
MIRT150357 IER2 immediate early response 2 1 1
MIRT152283 TNFSF9 tumor necrosis factor (ligand) superfamily, member 9 1 2
MIRT152510 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152749 KIF3B kinesin family member 3B 1 1
MIRT152929 NOL4L chromosome 20 open reading frame 112 1 1
MIRT154048 RASSF2 Ras association (RalGDS/AF-6) domain family member 2 1 1
MIRT154401 CDS2 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 1 1
MIRT156461 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9) 1 1
MIRT158526 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT159000 EPT1 ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific) 1 1
MIRT159591 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160171 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163257 PRKCD protein kinase C, delta 1 1
MIRT164269 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164958 TADA2B transcriptional adaptor 2B 1 1
MIRT165177 GRAMD3 GRAM domain containing 3 1 2
MIRT165893 CREBRF CREB3 regulatory factor 1 2
MIRT168589 HMGA1 high mobility group AT-hook 1 1 1
MIRT168682 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 1
MIRT169067 IRF4 interferon regulatory factor 4 1 1
MIRT170152 KLHDC10 kelch domain containing 10 1 1
MIRT170738 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171603 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172817 HMBOX1 homeobox containing 1 1 1
MIRT174791 RNF38 ring finger protein 38 1 1
MIRT175234 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175526 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179011 PAFAH1B2 platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) 1 1
MIRT180910 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186373 PNRC2 proline-rich nuclear receptor coactivator 2 1 1
MIRT189762 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189963 AGO4 eukaryotic translation initiation factor 2C, 4 1 1
MIRT190186 GPR180 G protein-coupled receptor 180 1 3
MIRT191456 PPM1A protein phosphatase, Mg2+/Mn2+ dependent, 1A 1 1
MIRT191627 SLC39A9 solute carrier family 39 (zinc transporter), member 9 1 3
MIRT194239 FAM103A1 family with sequence similarity 103, member A1 1 3
MIRT194906 RBBP6 retinoblastoma binding protein 6 1 4
MIRT196277 PAFAH1B1 platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa) 1 1
MIRT196453 TAOK1 TAO kinase 1 1 1
MIRT197720 PPM1D protein phosphatase, Mg2+/Mn2+ dependent, 1D 2 1
MIRT201457 SNRPB2 small nuclear ribonucleoprotein polypeptide B 1 4
MIRT204595 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204626 MOB4 MOB family member 4, phocein 1 4
MIRT204742 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206021 NUP50 nucleoporin 50kDa 1 4
MIRT211315 HSPA4L heat shock 70kDa protein 4-like 1 2
MIRT212608 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217746 TBPL1 TBP-like 1 1 2
MIRT223691 FZD6 frizzled family receptor 6 1 3
MIRT224967 BAG4 BCL2-associated athanogene 4 1 1
MIRT229347 ZNF449 zinc finger protein 449 1 1
MIRT229862 YIPF6 Yip1 domain family, member 6 1 1
MIRT230121 DDX3Y DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked 1 1
MIRT234344 MSL1 male-specific lethal 1 homolog (Drosophila) 1 4
MIRT245005 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246939 PRRC2C proline-rich coiled-coil 2C 1 1
MIRT247097 WEE1 WEE1 homolog (S. pombe) 1 2
MIRT247238 ELK4 ELK4, ETS-domain protein (SRF accessory protein 1) 1 2
MIRT247369 GABARAPL1 GABA(A) receptor-associated protein like 1 1 3
MIRT248554 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248767 ATXN7L3B ataxin 7-like 3B 1 2
MIRT249451 ZNF691 zinc finger protein 691 1 2
MIRT251491 DYNLL2 dynein, light chain, LC8-type 2 1 2
MIRT255336 SRPRB signal recognition particle receptor, B subunit 1 3
MIRT256309 CDC42SE2 CDC42 small effector 2 1 1
MIRT258412 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265057 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT267255 TMEM109 transmembrane protein 109 1 1
MIRT267530 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270455 SIRT4 sirtuin 4 1 1
MIRT270554 SETD1B SET domain containing 1B 1 1
MIRT273667 HOXC8 homeobox C8 1 1
MIRT274743 RAB3IP RAB3A interacting protein (rabin3) 1 1
MIRT277507 PPP2R5C protein phosphatase 2, regulatory subunit B', gamma 1 2
MIRT282536 SLCO3A1 solute carrier organic anion transporter family, member 3A1 1 1
MIRT286969 MLLT6 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 1 1
MIRT289630 CBX2 chromobox homolog 2 1 1
MIRT294285 ZFP28 zinc finger protein 28 homolog (mouse) 1 1
MIRT295813 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297780 GABPA GA binding protein transcription factor, alpha subunit 60kDa 1 2
MIRT300107 STRADB STE20-related kinase adaptor beta 1 1
MIRT300996 MTMR3 myotubularin related protein 3 1 1
MIRT302827 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307143 CTDSPL CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like 1 2
MIRT313677 ITGA2 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) 1 1
MIRT314053 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 1 4
MIRT319333 CAPZA2 capping protein (actin filament) muscle Z-line, alpha 2 1 1
MIRT320629 ZNRF2 zinc and ring finger 2 1 1
MIRT324840 IFT74 intraflagellar transport 74 homolog (Chlamydomonas) 1 1
MIRT326304 OCRL oculocerebrorenal syndrome of Lowe 1 1
MIRT327965 CHIC1 cysteine-rich hydrophobic domain 1 1 3
MIRT367266 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT437485 FUT2 fucosyltransferase 2 (secretor status included) 3 1
MIRT437786 KDR kinase insert domain receptor (a type III receptor tyrosine kinase) 3 1
MIRT437966 HNF1A HNF1 homeobox A 3 1
MIRT443812 SIDT2 SID1 transmembrane family, member 2 1 1
MIRT446507 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447777 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448445 TLL1 tolloid-like 1 1 1
MIRT449189 LUC7L3 LUC7-like 3 (S. cerevisiae) 1 1
MIRT451838 ALDH3B1 aldehyde dehydrogenase 3 family, member B1 1 1
MIRT453287 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453753 CSNK1E casein kinase 1, epsilon 1 1
MIRT454969 TPM2 tropomyosin 2 (beta) 1 1
MIRT456866 ZNF460 zinc finger protein 460 1 5
MIRT460223 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460437 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461563 ACTR3B ARP3 actin-related protein 3 homolog B (yeast) 1 1
MIRT463171 ZNF367 zinc finger protein 367 1 5
MIRT464663 UBE2V1 ubiquitin-conjugating enzyme E2 variant 1 1 4
MIRT464750 UBE2Q1 ubiquitin-conjugating enzyme E2Q family member 1 1 2
MIRT465162 TSC22D2 TSC22 domain family, member 2 1 1
MIRT465569 TOB2 transducer of ERBB2, 2 1 1
MIRT465931 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466006 TMEM189 transmembrane protein 189 1 4
MIRT466297 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466435 TFAP2A transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) 1 4
MIRT466918 STK38 serine/threonine kinase 38 1 5
MIRT467001 SSRP1 structure specific recognition protein 1 1 3
MIRT468054 SIK1 salt-inducible kinase 1 1 2
MIRT468150 SH3BP4 SH3-domain binding protein 4 1 1
MIRT468677 SEC24A SEC24 family, member A (S. cerevisiae) 1 2
MIRT469089 RNF168 ring finger protein 168, E3 ubiquitin protein ligase 1 1
MIRT469414 REL v-rel reticuloendotheliosis viral oncogene homolog (avian) 1 3
MIRT471037 PISD phosphatidylserine decarboxylase 1 5
MIRT471494 PDE4D phosphodiesterase 4D, cAMP-specific 1 2
MIRT471955 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 1
MIRT472268 NFIC nuclear factor I/C (CCAAT-binding transcription factor) 1 1
MIRT472664 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474319 LAMC1 laminin, gamma 1 (formerly LAMB2) 1 1
MIRT474834 KIAA0226 KIAA0226 1 1
MIRT475067 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475121 IPPK inositol 1,3,4,5,6-pentakisphosphate 2-kinase 1 1
MIRT475538 HOXA3 homeobox A3 1 4
MIRT475719 HEYL hairy/enhancer-of-split related with YRPW motif-like 1 1
MIRT475839 HDGF hepatoma-derived growth factor 1 2
MIRT476258 GNB1 guanine nucleotide binding protein (G protein), beta polypeptide 1 1 4
MIRT476275 GNAL guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type 1 3
MIRT476699 FURIN furin (paired basic amino acid cleaving enzyme) 1 1
MIRT477564 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477848 DYRK3 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 1 1
MIRT478910 CPSF7 cleavage and polyadenylation specific factor 7, 59kDa 1 3
MIRT479454 CDK6 cyclin-dependent kinase 6 1 1
MIRT479631 CDC25A cell division cycle 25 homolog A (S. pombe) 1 2
MIRT479984 CARD10 caspase recruitment domain family, member 10 1 1
MIRT481184 AVL9 AVL9 homolog (S. cerevisiase) 1 3
MIRT482118 AKT3 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 1 2
MIRT482371 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT482555 ABL2 v-abl Abelson murine leukemia viral oncogene homolog 2 1 5
MIRT482580 ABHD2 abhydrolase domain containing 2 1 1
MIRT484777 ABCC6 ATP-binding cassette, sub-family C (CFTR/MRP), member 6 1 2
MIRT485218 PRKAR2A protein kinase, cAMP-dependent, regulatory, type II, alpha 1 4
MIRT487393 C10orf54 chromosome 10 open reading frame 54 1 1
MIRT492714 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494348 CASKIN1 CASK interacting protein 1 1 1
MIRT496018 CD180 CD180 molecule 1 1
MIRT497775 KIAA0895 KIAA0895 1 1
MIRT498983 ORC4 origin recognition complex, subunit 4 1 4
MIRT499455 ODF2L outer dense fiber of sperm tails 2-like 1 4
MIRT499618 DNAJA1 DnaJ (Hsp40) homolog, subfamily A, member 1 1 4
MIRT500096 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500322 ZNF622 zinc finger protein 622 1 5
MIRT500424 ZMAT3 zinc finger, matrin-type 3 1 2
MIRT500578 USP53 ubiquitin specific peptidase 53 1 1
MIRT500861 SYPL1 synaptophysin-like 1 1 4
MIRT500938 SRPR signal recognition particle receptor (docking protein) 1 4
MIRT500952 SREK1 splicing regulatory glutamine/lysine-rich protein 1 1 4
MIRT501505 PRICKLE2 prickle homolog 2 (Drosophila) 1 1
MIRT502039 LRIG2 leucine-rich repeats and immunoglobulin-like domains 2 1 1
MIRT502150 KIF5B kinesin family member 5B 1 5
MIRT502500 FAM122B family with sequence similarity 122B 1 4
MIRT502572 E2F7 E2F transcription factor 7 1 6
MIRT502648 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 4
MIRT502921 CDCA4 cell division cycle associated 4 1 5
MIRT502951 CDC37L1 cell division cycle 37 homolog (S. cerevisiae)-like 1 1 5
MIRT503144 ATG9A autophagy related 9A 1 4
MIRT504337 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504539 ZNF620 zinc finger protein 620 1 3
MIRT504854 HAUS3 HAUS augmin-like complex, subunit 3 1 3
MIRT505115 YTHDC1 YTH domain containing 1 1 3
MIRT505348 TMEM245 transmembrane protein 245 1 3
MIRT505393 TMEM100 transmembrane protein 100 1 1
MIRT505504 SRSF1 serine/arginine-rich splicing factor 1 1 3
MIRT505548 SNX16 sorting nexin 16 1 3
MIRT505687 SESTD1 SEC14 and spectrin domains 1 1 3
MIRT505910 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505929 RCAN3 RCAN family member 3 1 2
MIRT506111 PPIG peptidylprolyl isomerase G (cyclophilin G) 1 3
MIRT506137 PLRG1 pleiotropic regulator 1 1 2
MIRT506168 PLAG1 pleiomorphic adenoma gene 1 1 5
MIRT506189 PHKA1 phosphorylase kinase, alpha 1 (muscle) 1 3
MIRT506488 MYO5A myosin VA (heavy chain 12, myoxin) 1 4
MIRT506856 KIF23 kinesin family member 23 1 4
MIRT507001 HNRNPDL heterogeneous nuclear ribonucleoprotein D-like 1 3
MIRT507823 CDK1 cyclin-dependent kinase 1 1 3
MIRT507852 CCNE2 cyclin E2 1 3
MIRT507879 CBX6 chromobox homolog 6 1 1
MIRT508643 CASK calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 2
MIRT509367 DMPK dystrophia myotonica-protein kinase 1 5
MIRT509692 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510046 AKR1B10 aldo-keto reductase family 1, member B10 (aldose reductase) 1 2
MIRT511842 GPATCH8 G patch domain containing 8 1 3
MIRT512289 ARHGDIA Rho GDP dissociation inhibitor (GDI) alpha 1 4
MIRT512645 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513855 JARID2 jumonji, AT rich interactive domain 2 1 4
MIRT514021 CAMSAP1 calmodulin regulated spectrin-associated protein 1 1 3
MIRT514045 ATG14 autophagy related 14 1 1
MIRT518094 TRIM35 tripartite motif containing 35 1 1
MIRT518532 FLCN folliculin 1 3
MIRT518997 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521054 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 1 2
MIRT521201 SBNO1 strawberry notch homolog 1 (Drosophila) 1 3
MIRT521812 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522097 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 3
MIRT522777 LAMP2 lysosomal-associated membrane protein 2 1 3
MIRT537814 EFNB2 ephrin-B2 1 2
MIRT539901 RPL14 ribosomal protein L14 1 2
MIRT540846 GNAT1 guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1 1 2
MIRT541215 HOXA10 homeobox A10 1 1
MIRT541429 CBX4 chromobox homolog 4 1 2
MIRT542809 PHC3 polyhomeotic homolog 3 (Drosophila) 1 2
MIRT542835 PDCD1 programmed cell death 1 1 3
MIRT543056 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT543076 APP amyloid beta (A4) precursor protein 1 1
MIRT543309 ZNF585B zinc finger protein 585B 1 1
MIRT543410 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543528 PRSS21 protease, serine, 21 (testisin) 1 1
MIRT543800 RALGAPB Ral GTPase activating protein, beta subunit (non-catalytic) 1 2
MIRT543838 GSG1 germ cell associated 1 1 1
MIRT544574 POLDIP3 polymerase (DNA-directed), delta interacting protein 3 1 1
MIRT544592 AP5Z1 adaptor-related protein complex 5, zeta 1 subunit 1 2
MIRT544915 CLSPN claspin 1 1
MIRT544968 UGT2B4 UDP glucuronosyltransferase 2 family, polypeptide B4 1 1
MIRT545189 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545350 CCDC83 coiled-coil domain containing 83 1 1
MIRT545685 DECR1 2,4-dienoyl CoA reductase 1, mitochondrial 1 1
MIRT545960 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545972 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide 1 1
MIRT546117 USP48 ubiquitin specific peptidase 48 1 2
MIRT546607 SALL1 sal-like 1 (Drosophila) 1 2
MIRT546622 RUNX1T1 runt-related transcription factor 1; translocated to, 1 (cyclin D-related) 1 1
MIRT546636 RTN4 reticulon 4 1 1
MIRT547065 PNISR PNN-interacting serine/arginine-rich protein 1 2
MIRT547130 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547237 PAG1 phosphoprotein associated with glycosphingolipid microdomains 1 1 2
MIRT547304 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 2
MIRT547405 MKX mohawk homeobox 1 1
MIRT547458 MBD4 methyl-CpG binding domain protein 4 1 1
MIRT547552 LRRFIP2 leucine rich repeat (in FLII) interacting protein 2 1 2
MIRT547662 KPNA3 karyopherin alpha 3 (importin alpha 4) 1 1
MIRT547703 KPNA1 karyopherin alpha 1 (importin alpha 5) 1 2
MIRT547972 HIGD1A HIG1 hypoxia inducible domain family, member 1A 1 2
MIRT548000 HCFC2 host cell factor C2 1 2
MIRT548017 GRB2 growth factor receptor-bound protein 2 1 2
MIRT548224 FKBP1A FK506 binding protein 1A, 12kDa 1 1
MIRT548274 FBXL20 F-box and leucine-rich repeat protein 20 1 1
MIRT548282 FASN fatty acid synthase 1 2
MIRT548808 CLIP4 CAP-GLY domain containing linker protein family, member 4 1 2
MIRT548945 CDK17 cyclin-dependent kinase 17 1 2
MIRT549077 CACUL1 CDK2-associated, cullin domain 1 1 1
MIRT549125 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549275 ASH1L ash1 (absent, small, or homeotic)-like (Drosophila) 1 2
MIRT549388 AMOT angiomotin 1 1
MIRT550404 SLC29A1 solute carrier family 29 (nucleoside transporters), member 1 1 2
MIRT550469 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550617 MTHFR methylenetetrahydrofolate reductase (NAD(P)H) 1 1
MIRT550826 FAM229B chromosome 6 open reading frame 225 1 1
MIRT551382 EPM2AIP1 EPM2A (laforin) interacting protein 1 1 1
MIRT551620 ZNF267 zinc finger protein 267 1 1
MIRT551739 SSU72 SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) 1 1
MIRT552038 DNAJC10 DnaJ (Hsp40) homolog, subfamily C, member 10 1 1
MIRT552347 ZNF704 zinc finger protein 704 1 1
MIRT552745 YRDC yrdC domain containing (E. coli) 1 1
MIRT553441 TPM3 tropomyosin 3 1 1
MIRT553564 TMEM161B transmembrane protein 161B 1 1
MIRT553615 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553775 TAF13 TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa 1 2
MIRT553811 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554964 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555034 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555146 PTPRD protein tyrosine phosphatase, receptor type, D 1 1
MIRT555228 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 2
MIRT555276 PRDM4 PR domain containing 4 1 1
MIRT555433 PPAP2B phosphatidic acid phosphatase type 2B 1 1
MIRT556386 LURAP1L leucine rich adaptor protein 1-like 1 1
MIRT556857 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557283 HIST2H2BE histone cluster 2, H2be 1 1
MIRT557483 GPR27 G protein-coupled receptor 27 1 2
MIRT558040 EXT1 exostosin 1 1 1
MIRT558510 CYP26B1 cytochrome P450, family 26, subfamily B, polypeptide 1 1 2
MIRT558591 CREBL2 cAMP responsive element binding protein-like 2 1 2
MIRT558660 CNKSR3 CNKSR family member 3 1 1
MIRT559007 CA8 carbonic anhydrase VIII 1 1
MIRT559156 BTN3A3 butyrophilin, subfamily 3, member A3 1 1
MIRT559534 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560854 OSBPL3 oxysterol binding protein-like 3 1 1
MIRT561152 KRT33B keratin 33B 1 1
MIRT561403 TUBB2A tubulin, beta 2A class IIa 1 1
MIRT561877 MSANTD4 Myb/SANT-like DNA-binding domain containing 4 with coiled-coils 1 1
MIRT562030 LANCL1 LanC lantibiotic synthetase component C-like 1 (bacterial) 1 1
MIRT562205 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562880 KIAA1456 KIAA1456 1 1
MIRT563089 SLC25A12 solute carrier family 25 (aspartate/glutamate carrier), member 12 1 2
MIRT563506 DLGAP3 discs, large (Drosophila) homolog-associated protein 3 1 1
MIRT563704 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563848 SMDT1 chromosome 22 open reading frame 32 1 1
MIRT563899 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564335 CCNT1 cyclin T1 1 1
MIRT564481 ZNF391 zinc finger protein 391 1 1
MIRT564555 CCDC80 coiled-coil domain containing 80 1 1
MIRT564842 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564953 XKR7 XK, Kell blood group complex subunit-related family, member 7 1 1
MIRT564984 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565042 VAV2 vav 2 guanine nucleotide exchange factor 1 1
MIRT565398 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT566124 RASEF RAS and EF-hand domain containing 1 1
MIRT566653 NCKAP1 NCK-associated protein 1 1 1
MIRT566833 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567016 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT567449 GNG12 guanine nucleotide binding protein (G protein), gamma 12 1 1
MIRT567480 FZD9 frizzled family receptor 9 1 1
MIRT568024 CMTM4 CKLF-like MARVEL transmembrane domain containing 4 1 1
MIRT568147 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568476 ARMC12 armadillo repeat containing 12 1 1
MIRT568578 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568624 ACVR2A activin A receptor, type IIA 1 1
MIRT570463 TLK1 tousled-like kinase 1 1 2
MIRT571122 UBE2H ubiquitin-conjugating enzyme E2H 1 1
MIRT571286 TTLL5 tubulin tyrosine ligase-like family, member 5 1 1
MIRT571430 RIF1 RAP1 interacting factor homolog (yeast) 1 1
MIRT571826 PHF19 PHD finger protein 19 1 1
MIRT571931 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574060 PROSC proline synthetase co-transcribed homolog (bacterial) 1 1
MIRT574206 CLEC2D C-type lectin domain family 2, member D 1 1
MIRT574541 PDIA6 protein disulfide isomerase family A, member 6 1 2
MIRT574597 N4BP1 NEDD4 binding protein 1 1 2
MIRT575885 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575927 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576098 Pdcd1 programmed cell death 1 1 1
MIRT576595 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614696 TRAK1 trafficking protein, kinesin binding 1 1 1
MIRT616470 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618899 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT632868 GPRC5A G protein-coupled receptor, family C, group 5, member A 1 1
MIRT640541 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645513 BSPRY B-box and SPRY domain containing 1 1
MIRT646598 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648787 KLHL40 kelch repeat and BTB (POZ) domain containing 5 1 1
MIRT655814 NOTCH2 notch 2 1 2
MIRT658795 EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa 1 1
MIRT659259 CUL3 cullin 3 1 1
MIRT680985 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682284 RS1 retinoschisin 1 1 1
MIRT682517 GLP2R glucagon-like peptide 2 receptor 1 1
MIRT691712 FLOT2 flotillin 2 1 2
MIRT693933 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701509 NEGR1 neuronal growth regulator 1 1 1
MIRT702095 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702876 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713422 SLC35E2B solute carrier family 35, member E2B 1 1
MIRT714441 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716435 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717464 ADORA3 adenosine A3 receptor 1 1
MIRT720154 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725133 SYNRG synergin, gamma 1 1
MIRT726006 ZNF91 zinc finger protein 91 1 1
MIRT726085 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726127 VPS33B vacuolar protein sorting 33 homolog B (yeast) 1 1
MIRT726131 CHMP3 charged multivesicular body protein 3 1 1
MIRT726142 VCL vinculin 1 1
MIRT726157 USP3 ubiquitin specific peptidase 3 1 1
MIRT726164 USP31 ubiquitin specific peptidase 31 1 1
MIRT726220 TUBB tubulin, beta class I 1 1
MIRT726237 TRAM1 translocation associated membrane protein 1 1 1
MIRT726278 TMEM69 transmembrane protein 69 1 1
MIRT726286 TMEM55B transmembrane protein 55B 1 1
MIRT726305 TMEM135 transmembrane protein 135 1 1
MIRT726318 TLE4 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) 1 1
MIRT726321 TKTL1 transketolase-like 1 1 1
MIRT726324 TIMM13 translocase of inner mitochondrial membrane 13 homolog (yeast) 1 1
MIRT726338 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726349 TCF3 transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47) 1 1
MIRT726357 TBL1XR1 transducin (beta)-like 1 X-linked receptor 1 1 1
MIRT726359 TBCCD1 TBCC domain containing 1 1 1
MIRT726368 TBC1D20 TBC1 domain family, member 20 1 1
MIRT726371 TBC1D14 TBC1 domain family, member 14 1 1
MIRT726385 TASP1 taspase, threonine aspartase, 1 1 1
MIRT726409 SUPT16H suppressor of Ty 16 homolog (S. cerevisiae) 1 1
MIRT726421 STX17 syntaxin 17 1 1
MIRT726454 SRPK1 SRSF protein kinase 1 1 1
MIRT726461 SPTLC1 serine palmitoyltransferase, long chain base subunit 1 1 1
MIRT726505 SLC9A1 solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1 1 1
MIRT726509 SLC7A5 solute carrier family 7 (amino acid transporter light chain, L system), member 5 1 1
MIRT726544 SLC25A29 solute carrier family 25 (mitochondrial carnitine/acylcarnitine carrier), member 29 1 1
MIRT726547 SLC25A22 solute carrier family 25 (mitochondrial carrier: glutamate), member 22 1 1
MIRT726676 RPS6KA3 ribosomal protein S6 kinase, 90kDa, polypeptide 3 1 1
MIRT726681 RPS5 ribosomal protein S5 1 1
MIRT726683 RPL36 ribosomal protein L36 1 1
MIRT726713 RNPS1 RNA binding protein S1, serine-rich domain 1 1
MIRT726716 RNMT RNA (guanine-7-) methyltransferase 1 1
MIRT726719 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726757 RFWD2 ring finger and WD repeat domain 2, E3 ubiquitin protein ligase 1 1
MIRT726763 REXO1 REX1, RNA exonuclease 1 homolog (S. cerevisiae) 1 1
MIRT726772 RELT RELT tumor necrosis factor receptor 1 1
MIRT726788 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726810 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726825 RAB11FIP2 RAB11 family interacting protein 2 (class I) 1 1
MIRT726854 PSMB5 proteasome (prosome, macropain) subunit, beta type, 5 1 1
MIRT726873 PPP6C protein phosphatase 6, catalytic subunit 1 1
MIRT726901 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726909 POLE4 polymerase (DNA-directed), epsilon 4, accessory subunit 1 1
MIRT726975 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727022 PANK1 pantothenate kinase 1 1 1
MIRT727027 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727039 OTUB1 OTU domain, ubiquitin aldehyde binding 1 1 1
MIRT727067 NR2C2 nuclear receptor subfamily 2, group C, member 2 1 1
MIRT727095 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727136 MTMR4 myotubularin related protein 4 1 1
MIRT727153 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727177 MLXIP MLX interacting protein 1 1
MIRT727197 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727222 MED11 mediator complex subunit 11 1 1
MIRT727229 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727261 LYRM5 LYR motif containing 5 1 1
MIRT727267 LRRC57 leucine rich repeat containing 57 1 1
MIRT727270 LRPPRC leucine-rich pentatricopeptide repeat containing 1 1
MIRT727298 LITAF lipopolysaccharide-induced TNF factor 1 1
MIRT727348 KLC2 kinesin light chain 2 1 1
MIRT727378 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727386 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT727425 IRAK1BP1 interleukin-1 receptor-associated kinase 1 binding protein 1 1 1
MIRT727482 HYOU1 hypoxia up-regulated 1 1 1
MIRT727522 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727584 GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727604 GANAB glucosidase, alpha; neutral AB 1 1
MIRT727618 GABARAP GABA(A) receptor-associated protein 1 1
MIRT727648 FRYL FRY-like 1 1
MIRT727700 FAM73A family with sequence similarity 73, member A 1 1
MIRT727718 AMER1 family with sequence similarity 123B 1 1
MIRT727813 EDC3 enhancer of mRNA decapping 3 homolog (S. cerevisiae) 1 1
MIRT727855 DSCR3 Down syndrome critical region gene 3 1 1
MIRT727859 DPP8 dipeptidyl-peptidase 8 1 1
MIRT727865 DNAJC9 DnaJ (Hsp40) homolog, subfamily C, member 9 1 1
MIRT727877 DICER1 dicer 1, ribonuclease type III 1 1
MIRT727909 CYLD cylindromatosis (turban tumor syndrome) 1 1
MIRT727912 CYB561A3 cytochrome b, ascorbate dependent 3 1 1
MIRT727916 CUL2 cullin 2 1 1
MIRT727923 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT727937 CREG1 cellular repressor of E1A-stimulated genes 1 1 1
MIRT727952 CPNE1 copine I 1 1
MIRT727998 RHOV ras homolog family member V 1 1
MIRT728005 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728018 CDC27 cell division cycle 27 homolog (S. cerevisiae) 1 1
MIRT728046 CBFA2T3 core-binding factor, runt domain, alpha subunit 2; translocated to, 3 1 1
MIRT728090 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728100 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728128 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728131 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728171 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 1
MIRT728195 BSG basigin (Ok blood group) 1 1
MIRT728264 ATP13A3 ATPase type 13A3 1 1
MIRT728289 ASXL1 additional sex combs like 1 (Drosophila) 1 1
MIRT728329 AP3M1 adaptor-related protein complex 3, mu 1 subunit 1 1
MIRT728382 AFF4 AF4/FMR2 family, member 4 1 1
MIRT728399 ACOX1 acyl-CoA oxidase 1, palmitoyl 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*