Accession ID: MIRT046452 [miRNA, hsa-miR-15b-5p :: BRAT1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-15bLinkOut: [miRBase ]
Synonyms MIRN15B, hsa-mir-15b, miR-15b, MIR15B
Description Homo sapiens miR-15b stem-loop
Comment This miRNA sequence was predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-15b-5p
Mature Sequence 20| UAGCAGCACAUCAUGGUUUACA |41
Evidence Experimental
Experiments Cloned
Putative hsa-miR-15b-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-15b-5p :: BRAT1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
172 hsa-miR-15b-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000276 CCNE1 cyclin E1 4 2
MIRT000607 RECK reversion-inducing-cysteine-rich protein with kazal motifs 4 1
MIRT000978 BCL2 B-cell CLL/lymphoma 2 4 2
MIRT003913 CCND1 cyclin D1 3 1
MIRT004274 VEGFA vascular endothelial growth factor A 2 1
MIRT004526 EIF4A1 eukaryotic translation initiation factor 4A1 2 1
MIRT006750 AXIN2 axin 2 1 1
MIRT006914 IFNG interferon, gamma 2 1
MIRT007001 PURA purine-rich element binding protein A 1 1
MIRT023483 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT046381 C5orf15 chromosome 5 open reading frame 15 1 1
MIRT046382 MTMR6 myotubularin related protein 6 1 1
MIRT046383 AP5S1 chromosome 20 open reading frame 29 1 1
MIRT046384 MRPS11 mitochondrial ribosomal protein S11 1 1
MIRT046385 NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) 1 1
MIRT046386 EIF2AK2 eukaryotic translation initiation factor 2-alpha kinase 2 1 1
MIRT046387 CD44 CD44 molecule (Indian blood group) 1 1
MIRT046388 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT046389 HNRNPK heterogeneous nuclear ribonucleoprotein K 1 1
MIRT046390 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT046391 AIG1 androgen-induced 1 1 1
MIRT046392 POU2F1 POU class 2 homeobox 1 1 1
MIRT046393 RAB1B RAB1B, member RAS oncogene family 1 1
MIRT046394 RPS3A ribosomal protein S3A 1 1
MIRT046395 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 1 1
MIRT046396 SYNJ1 synaptojanin 1 1 1
MIRT046397 FAXC chromosome 6 open reading frame 168 1 1
MIRT046398 PLSCR4 phospholipid scramblase 4 1 1
MIRT046399 NUP210 nucleoporin 210kDa 1 1
MIRT046400 URB2 URB2 ribosome biogenesis 2 homolog (S. cerevisiae) 1 1
MIRT046401 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT046402 PXMP2 peroxisomal membrane protein 2, 22kDa 1 1
MIRT046403 RLIM ring finger protein, LIM domain interacting 1 1
MIRT046404 TMC7 transmembrane channel-like 7 1 1
MIRT046405 FAM214A KIAA1370 1 1
MIRT046406 TMEM63B transmembrane protein 63B 1 1
MIRT046407 UACA uveal autoantigen with coiled-coil domains and ankyrin repeats 1 1
MIRT046408 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT046409 RPL27A ribosomal protein L27a 1 1
MIRT046410 WAC WW domain containing adaptor with coiled-coil 1 1
MIRT046411 CHMP7 CHMP family, member 7 1 1
MIRT046412 CDK4 cyclin-dependent kinase 4 1 1
MIRT046413 VDAC2 voltage-dependent anion channel 2 1 1
MIRT046414 PGD phosphogluconate dehydrogenase 1 1
MIRT046415 PIK3C2B phosphoinositide-3-kinase, class 2, beta polypeptide 1 1
MIRT046416 MPHOSPH9 M-phase phosphoprotein 9 1 1
MIRT046417 MPP1 membrane protein, palmitoylated 1, 55kDa 1 1
MIRT046418 MARCKS myristoylated alanine-rich protein kinase C substrate 1 1
MIRT046419 NAB1 NGFI-A binding protein 1 (EGR1 binding protein 1) 1 1
MIRT046420 MESDC2 mesoderm development candidate 2 1 1
MIRT046421 ATP6V0E1 ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 1 1
MIRT046422 RPS6 ribosomal protein S6 1 1
MIRT046423 TPD52 tumor protein D52 1 1
MIRT046424 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT046425 LIN28B lin-28 homolog B (C. elegans) 1 1
MIRT046426 TARDBP TAR DNA binding protein 1 1
MIRT046427 PHLDB3 pleckstrin homology-like domain, family B, member 3 1 1
MIRT046428 TNPO3 transportin 3 1 1
MIRT046429 PPTC7 PTC7 protein phosphatase homolog (S. cerevisiae) 1 1
MIRT046430 VPS13A vacuolar protein sorting 13 homolog A (S. cerevisiae) 1 1
MIRT046431 QRICH1 glutamine-rich 1 1 1
MIRT046432 SCCPDH saccharopine dehydrogenase (putative) 1 1
MIRT046433 NDFIP1 Nedd4 family interacting protein 1 1 1
MIRT046434 TCP1 t-complex 1 1 1
MIRT046435 DHFR dihydrofolate reductase 1 1
MIRT046436 DSG2 desmoglein 2 1 1
MIRT046437 EDC4 enhancer of mRNA decapping 4 1 1
MIRT046438 ECHS1 enoyl CoA hydratase, short chain, 1, mitochondrial 1 1
MIRT046439 HNRNPM heterogeneous nuclear ribonucleoprotein M 1 1
MIRT046440 PPIL1 peptidylprolyl isomerase (cyclophilin)-like 1 1 1
MIRT046441 TANGO6 transmembrane and coiled-coil domains 7 1 1
MIRT046442 FOXK1 forkhead box K1 1 1
MIRT046443 KMT2C myeloid/lymphoid or mixed-lineage leukemia 3 1 1
MIRT046444 LSM14A LSM14A, SCD6 homolog A (S. cerevisiae) 1 1
MIRT046445 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT046446 CYBA cytochrome b-245, alpha polypeptide 1 1
MIRT046447 BEX1 brain expressed, X-linked 1 1 1
MIRT046448 CYP51A1 cytochrome P450, family 51, subfamily A, polypeptide 1 1 1
MIRT046449 DNAJC5 DnaJ (Hsp40) homolog, subfamily C, member 5 1 1
MIRT046450 CLCN6 chloride channel 6 1 1
MIRT046451 SEPT2 septin 2 1 1
MIRT046452 BRAT1 chromosome 7 open reading frame 27 1 1
MIRT046453 HSPA8 heat shock 70kDa protein 8 1 1
MIRT046454 TSPAN3 tetraspanin 3 1 1
MIRT046455 CHEK1 CHK1 checkpoint homolog (S. pombe) 1 1
MIRT046456 FADD Fas (TNFRSF6)-associated via death domain 1 1
MIRT046457 ZCCHC14 zinc finger, CCHC domain containing 14 1 1
MIRT046458 ITGA6 integrin, alpha 6 1 1
MIRT046459 DDX5 DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 1 1
MIRT046460 MYCBP2 MYC binding protein 2 1 1
MIRT046461 LRRC41 leucine rich repeat containing 41 1 1
MIRT046462 IFIH1 interferon induced with helicase C domain 1 1 1
MIRT046463 TERF2 telomeric repeat binding factor 2 1 1
MIRT046464 RPLP0 ribosomal protein, large, P0 1 1
MIRT046465 NUP214 nucleoporin 214kDa 1 1
MIRT046466 STT3B STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae) 1 1
MIRT046467 TXLNA taxilin alpha 1 1
MIRT046468 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 1 1
MIRT046469 SFT2D1 SFT2 domain containing 1 1 1
MIRT046470 FBXO30 F-box protein 30 1 1
MIRT046471 JAK1 Janus kinase 1 1 1
MIRT046472 TMEM43 transmembrane protein 43 1 1
MIRT046473 CKAP5 cytoskeleton associated protein 5 1 1
MIRT046474 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 1 1
MIRT046475 DHX30 DEAH (Asp-Glu-Ala-His) box polypeptide 30 1 1
MIRT046476 TGOLN2 trans-golgi network protein 2 1 1
MIRT046477 HNRNPH3 heterogeneous nuclear ribonucleoprotein H3 (2H9) 1 1
MIRT046478 PRPS1 phosphoribosyl pyrophosphate synthetase 1 1 1
MIRT046479 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT046480 UVSSA KIAA1530 1 1
MIRT046481 AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon) 1 1
MIRT046482 INADL InaD-like (Drosophila) 1 1
MIRT046483 ZNF217 zinc finger protein 217 1 1
MIRT046484 GNL3L guanine nucleotide binding protein-like 3 (nucleolar)-like 1 1
MIRT046485 VPS35 vacuolar protein sorting 35 homolog (S. cerevisiae) 1 1
MIRT046486 COIL coilin 1 1
MIRT046487 RAE1 RAE1 RNA export 1 homolog (S. pombe) 1 1
MIRT046488 UBE3B ubiquitin protein ligase E3B 1 1
MIRT046489 PPIL2 peptidylprolyl isomerase (cyclophilin)-like 2 1 1
MIRT046490 AP2M1 adaptor-related protein complex 2, mu 1 subunit 1 1
MIRT046491 ZNRF1 zinc and ring finger 1 1 1
MIRT046492 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT046493 SLC39A14 solute carrier family 39 (zinc transporter), member 14 1 1
MIRT046494 CHPF chondroitin polymerizing factor 1 1
MIRT046495 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT046496 NUP160 nucleoporin 160kDa 1 1
MIRT046497 MDH1 malate dehydrogenase 1, NAD (soluble) 1 1
MIRT046498 PPP1CC protein phosphatase 1, catalytic subunit, gamma isozyme 1 1
MIRT046499 SMAD7 SMAD family member 7 1 1
MIRT046500 RANBP10 RAN binding protein 10 1 1
MIRT046501 THRA thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian) 1 1
MIRT046502 APRT adenine phosphoribosyltransferase 1 1
MIRT046503 QARS glutaminyl-tRNA synthetase 1 1
MIRT046504 MLLT4 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 1 1
MIRT046505 STXBP1 syntaxin binding protein 1 1 1
MIRT046506 VOPP1 vesicular, overexpressed in cancer, prosurvival protein 1 1 1
MIRT046507 MCPH1 microcephalin 1 1 1
MIRT046508 HSP90AB1 heat shock protein 90kDa alpha (cytosolic), class B member 1 1 1
MIRT046509 PSMD7 proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 1 1
MIRT046510 SUPT3H suppressor of Ty 3 homolog (S. cerevisiae) 1 1
MIRT046511 DHX37 DEAH (Asp-Glu-Ala-His) box polypeptide 37 1 1
MIRT046512 DENR density-regulated protein 1 1
MIRT046513 FAM115C family with sequence similarity 115, member C 1 1
MIRT046514 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT046515 BAMBI BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) 1 1
MIRT046516 PPP1CB protein phosphatase 1, catalytic subunit, beta isozyme 1 1
MIRT046517 LZTR1 leucine-zipper-like transcription regulator 1 1 1
MIRT046518 TRAPPC1 trafficking protein particle complex 1 1 1
MIRT046519 CPOX coproporphyrinogen oxidase 1 1
MIRT046520 RBM27 RNA binding motif protein 27 1 1
MIRT046521 ARID2 AT rich interactive domain 2 (ARID, RFX-like) 1 1
MIRT046522 ZFAND5 zinc finger, AN1-type domain 5 1 1
MIRT046523 EIF5B eukaryotic translation initiation factor 5B 1 1
MIRT046524 PRDX3 peroxiredoxin 3 1 1
MIRT046525 AIFM2 apoptosis-inducing factor, mitochondrion-associated, 2 1 1
MIRT046526 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT046527 HIST2H3A histone cluster 2, H3a 1 1
MIRT046528 AMMECR1L AMME chromosomal region gene 1-like 1 1
MIRT046529 FGF5 fibroblast growth factor 5 1 1
MIRT046530 XKR9 XK, Kell blood group complex subunit-related family, member 9 1 1
MIRT046531 C1orf43 chromosome 1 open reading frame 43 1 1
MIRT046532 FANCC Fanconi anemia, complementation group C 1 1
MIRT046533 RNF149 ring finger protein 149 1 1
MIRT046534 IFNGR2 interferon gamma receptor 2 (interferon gamma transducer 1) 1 1
MIRT046535 TBRG4 transforming growth factor beta regulator 4 1 1
MIRT046536 AP4S1 adaptor-related protein complex 4, sigma 1 subunit 1 1
MIRT046537 ETNK1 ethanolamine kinase 1 1 1
MIRT046538 BTAF1 BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae) 1 1
MIRT046539 NRIP1 nuclear receptor interacting protein 1 1 1
MIRT046540 RPS3 ribosomal protein S3 1 1
MIRT046541 PTBP1 polypyrimidine tract binding protein 1 1 1
MIRT046542 PPT1 palmitoyl-protein thioesterase 1 1 1