Accession ID: MIRT047124 [miRNA, hsa-miR-183-5p :: HSP90AA1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-183LinkOut: [miRBase ]
Synonyms MIRN183, miR-183, miRNA183, MIR183
Description Homo sapiens miR-183 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-183-5p
Mature Sequence 27| UAUGGCACUGGUAGAAUUCACU |48
Evidence Experimental
Experiments Cloned
Putative hsa-miR-183-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol HSP90AA1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms FLJ31884, HSP86, HSP89A, HSP90A, HSP90N, HSPC1, HSPCA, HSPCAL1, HSPCAL4, HSPN, Hsp89, Hsp90, LAP2
Description heat shock protein 90kDa alpha (cytosolic), class A member 1
Transcript NM_0010179    LinkOut: [ RefSeq ]
Other Transcripts NM_0053   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on HSP90AA1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of HSP90AA1
(miRNA target sites are highlighted)
>HSP90AA1|NM_0010179|3'UTR
   1 TAATCTCTGGCTGAGGGATGACTTACCTGTTCAGTACTCTACAATTCCTCTGATAATATATTTTCAAGGATGTTTTTCTT
  81 TATTTTTGTTAATATTAAAAAGTCTGTATGGCATGACAACTACTTTAAGGGGAAGATAAGATTTCTGTCTACTAAGTGAT
 161 GCTGTGATACCTTAGGCACTAAAGCAGAGCTAGTAATGCTTTTTGAGTTTCATGTTGGTTTATTTTCACAGATTGGGGTA
 241 ACGTGCACTGTAAGACGTATGTAACATGATGTTAACTTTGTGGTCTAAAGTGTTTAGCTGTCAAGCCGGATGCCTAAGTA
 321 GACCAAATCTTGTTATTGAAGTGTTCTGAGCTGTATCTTGATGTTTAGAAAAGTATTCGTTACATCTTGTAGGATCTACT
 401 TTTTGAACTTTTCATTCCCTGTAGTTGACAATTCTGCATGTACTAGTCCTCTAGAAATAGGTTAAACTGAAGCAACTTGA
 481 TGGAAGGATCTCTCCACAGGGCTTGTTTTCCAAAGAAAAGTATTGTTTGGAGGAGCAAAGTTAAAAGCCTACCTAAGCAT
 561 ATCGTAAAGCTGTTCAAAAATAACTCAGACCCAGTCTTGTGGATGGAAATGTAGTGCTCGAGTCACATTCTGCTTAAAGT
 641 TGTAACAAATACAGATGAGTTAAAAGATATTGTGTGACAGTGTCTTATTTAGGGGGAAAGGGGAGTATCTGGATGACAGT
 721 TAGTGCCAAAATGTAAAACATGAGGCGCTAGCAGGAGATGGTTAAACACTAGCTGCTCCAAGGGTTGACATGGTCTTCCC
 801 AGCATGTACTCAGCAGGTGTGGGGTGGAGCACACGTAGGCACAGAAAACAGGAATGCAGACAACATGCATCCCCTGCGTC
 881 CATGAGTTACATGTGTTCTCTTAGTGTCCACGTTGTTTTGATGTTATTCATGGAATACCTTCTGTGTTAAATACAGTCAC
 961 TTAATTCCTTGGCCTTAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucACUUA-AGAUGGUCACGGUau 5'
            ||:||  | :::|||||||  
Target 5' tcTGGATGACAGTTAGTGCCAaa 3'
708 - 730 140.00 -13.30
2
miRNA  3' ucACUUAAGAUGGUCAC-GGUau 5'
            || :|||| ::|||| |||  
Target 5' caTGTGTTCTCTTAGTGTCCAcg 3'
890 - 912 120.00 -13.20
3
miRNA  3' ucaCU-UAAGAUG--GUCACGGUAu 5'
             || ||| |::  |||||:| | 
Target 5' aaaGATATTGTGTGACAGTGTCTTa 3'
663 - 687 113.00 -9.70
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-183-5p :: HSP90AA1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
198 hsa-miR-183-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003298 FOXO1 forkhead box O1 3 1
MIRT004015 ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) 3 1
MIRT004016 KIF2A kinesin heavy chain member 2A 3 1
MIRT004349 EZR ezrin 2 2
MIRT004673 BTRC beta-transducin repeat containing 3 1
MIRT004741 SRSF2 splicing factor, arginine/serine-rich 2 4 2
MIRT005547 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 4 1
MIRT005725 PDCD6 programmed cell death 6 1 1
MIRT005726 DAP death-associated protein 1 1
MIRT005870 AKAP12 A kinase (PRKA) anchor protein 12 4 1
MIRT006540 EGR1 early growth response 1 1 1
MIRT007339 IDH2 isocitrate dehydrogenase 2 (NADP+), mitochondrial 2 1
MIRT024988 KRTAP3-2 keratin associated protein 3-2 1 1
MIRT024989 RUNX1T1 runt-related transcription factor 1; translocated to, 1 (cyclin D-related) 1 1
MIRT024990 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 18kDa 1 1
MIRT024991 RTN4 reticulon 4 1 1
MIRT024992 CEPT1 choline/ethanolamine phosphotransferase 1 1 1
MIRT024993 RBM34 RNA binding motif protein 34 1 1
MIRT024994 C10orf2 chromosome 10 open reading frame 2 1 1
MIRT024995 CCND1 cyclin D1 1 1
MIRT024996 TNRC18 trinucleotide repeat containing 18 1 1
MIRT024997 OTUD4 OTU domain containing 4 1 1
MIRT024998 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT024999 LAPTM4B lysosomal protein transmembrane 4 beta 1 1
MIRT025000 ABCF1 ATP-binding cassette, sub-family F (GCN20), member 1 1 1
MIRT025001 GAS1 growth arrest-specific 1 1 1
MIRT025002 HNRNPL heterogeneous nuclear ribonucleoprotein L 1 1
MIRT025003 HLA-A major histocompatibility complex, class I, A 1 1
MIRT025004 NUB1 negative regulator of ubiquitin-like proteins 1 1 1
MIRT025005 PPP3R1 protein phosphatase 3, regulatory subunit B, alpha 1 1
MIRT025006 UBP1 upstream binding protein 1 (LBP-1a) 1 1
MIRT025007 GCC1 GRIP and coiled-coil domain containing 1 1 1
MIRT025008 HOXA5 homeobox A5 1 1
MIRT025009 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT025010 PSEN1 presenilin 1 1 1
MIRT025011 PEAK1 NKF3 kinase family member 1 1
MIRT025012 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT025013 SERTAD2 SERTA domain containing 2 1 1
MIRT025014 TXNIP thioredoxin interacting protein 1 1
MIRT025015 API5 apoptosis inhibitor 5 1 1
MIRT025016 SERTAD4 SERTA domain containing 4 1 1
MIRT025017 RNF41 ring finger protein 41 1 1
MIRT025018 GLUL glutamate-ammonia ligase 1 1
MIRT025019 FAM104A family with sequence similarity 104, member A 1 1
MIRT025020 CCT3 chaperonin containing TCP1, subunit 3 (gamma) 1 1
MIRT025021 ZC3H4 zinc finger CCCH-type containing 4 1 1
MIRT025022 STK33 serine/threonine kinase 33 1 1
MIRT025023 SMEK1 SMEK homolog 1, suppressor of mek1 (Dictyostelium) 1 1
MIRT025024 ARFGAP2 ADP-ribosylation factor GTPase activating protein 2 1 1
MIRT025025 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT025026 NOTCH2 Notch homolog 2 (Drosophila) 1 1
MIRT025027 BCL11B B-cell CLL/lymphoma 11B (zinc finger protein) 1 1
MIRT025028 SENP1 SUMO1/sentrin specific peptidase 1 1 1
MIRT025029 KLHL24 kelch-like 24 (Drosophila) 1 1
MIRT025030 CTDSPL CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like 1 1
MIRT025031 REV3L REV3-like, catalytic subunit of DNA polymerase zeta (yeast) 1 1
MIRT025032 RCN2 reticulocalbin 2, EF-hand calcium binding domain 1 1
MIRT047031 TTF2 transcription termination factor, RNA polymerase II 1 1
MIRT047032 FAM188A family with sequence similarity 188, member A 1 1
MIRT047033 ABHD17C family with sequence similarity 108, member C1 1 1
MIRT047034 PDE8A phosphodiesterase 8A 1 1
MIRT047035 AAMP angio-associated, migratory cell protein 1 1
MIRT047036 PHF14 PHD finger protein 14 1 1
MIRT047037 AUH AU RNA binding protein/enoyl-CoA hydratase 1 1
MIRT047038 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT047039 UBE2Z ubiquitin-conjugating enzyme E2Z 1 1
MIRT047040 STIP1 stress-induced-phosphoprotein 1 1 1
MIRT047041 IZUMO2 chromosome 19 open reading frame 41 1 1
MIRT047042 CNOT6 CCR4-NOT transcription complex, subunit 6 1 1
MIRT047043 NHSL2 NHS-like 2 1 1
MIRT047044 OPN3 opsin 3 1 1
MIRT047045 DGAT1 diacylglycerol O-acyltransferase homolog 1 (mouse) 1 1
MIRT047046 RPL23 ribosomal protein L23 1 1
MIRT047047 TRIT1 tRNA isopentenyltransferase 1 1 1
MIRT047048 FAM110B family with sequence similarity 110, member B 1 1
MIRT047049 BAG4 BCL2-associated athanogene 4 1 1
MIRT047050 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 1 1
MIRT047051 USP8 ubiquitin specific peptidase 8 1 1
MIRT047052 SLC31A1 solute carrier family 31 (copper transporters), member 1 1 1
MIRT047053 FKBPL FK506 binding protein like 1 1
MIRT047054 COMMD8 COMM domain containing 8 1 1
MIRT047055 UBXN7 UBX domain protein 7 1 1
MIRT047056 GATA6 GATA binding protein 6 1 1
MIRT047057 HNRNPM heterogeneous nuclear ribonucleoprotein M 1 1
MIRT047058 RPAP2 RNA polymerase II associated protein 2 1 1
MIRT047059 ASNS asparagine synthetase (glutamine-hydrolyzing) 1 1
MIRT047060 PPRC1 peroxisome proliferator-activated receptor gamma, coactivator-related 1 1 1
MIRT047061 TMEM245 chromosome 9 open reading frame 5 1 1
MIRT047062 TMEM108 transmembrane protein 108 1 1
MIRT047063 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT047064 KAT2A K(lysine) acetyltransferase 2A 1 1
MIRT047065 RAB5B RAB5B, member RAS oncogene family 1 1
MIRT047066 CR1 complement component (3b/4b) receptor 1 (Knops blood group) 1 1
MIRT047067 CAPNS1 calpain, small subunit 1 1 1
MIRT047068 PTPN9 protein tyrosine phosphatase, non-receptor type 9 1 1
MIRT047069 SLC5A3 solute carrier family 5 (sodium/myo-inositol cotransporter), member 3 1 1
MIRT047070 MKL1 megakaryoblastic leukemia (translocation) 1 1 1
MIRT047071 LYPLA1 lysophospholipase I 1 1
MIRT047072 DMWD dystrophia myotonica, WD repeat containing 1 1
MIRT047073 C18orf25 chromosome 18 open reading frame 25 1 1
MIRT047074 BRPF1 bromodomain and PHD finger containing, 1 1 1
MIRT047075 ITPKB inositol 1,4,5-trisphosphate 3-kinase B 1 1
MIRT047076 TUBB1 tubulin, beta 1 1 1
MIRT047077 GSR glutathione reductase 1 1
MIRT047078 MASTL microtubule associated serine/threonine kinase-like 1 1
MIRT047079 ITGA5 integrin, alpha 5 (fibronectin receptor, alpha polypeptide) 1 1
MIRT047080 FEN1 flap structure-specific endonuclease 1 1 1
MIRT047081 SH3D19 SH3 domain containing 19 1 1
MIRT047082 DOCK1 dedicator of cytokinesis 1 1 1
MIRT047083 NEO1 neogenin homolog 1 (chicken) 1 1
MIRT047084 GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 1 1
MIRT047085 MSH2 mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) 1 1
MIRT047086 ZFHX4 zinc finger homeobox 4 1 1
MIRT047087 UCHL3 ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) 1 1
MIRT047088 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT047089 PLOD2 procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 1 1
MIRT047090 SFSWAP splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot homolog, Drosophila) 1 1
MIRT047091 PTP4A2 protein tyrosine phosphatase type IVA, member 2 1 1
MIRT047092 ARHGDIA Rho GDP dissociation inhibitor (GDI) alpha 1 1
MIRT047093 TRIM37 tripartite motif-containing 37 1 1
MIRT047094 MTUS1 microtubule associated tumor suppressor 1 1 1
MIRT047095 TIMELESS timeless homolog (Drosophila) 1 1
MIRT047096 USP19 ubiquitin specific peptidase 19 1 1
MIRT047097 HCFC1 host cell factor C1 (VP16-accessory protein) 1 1
MIRT047098 GLO1 glyoxalase I 1 1
MIRT047099 PREB prolactin regulatory element binding 1 1
MIRT047100 SHISA2 shisa homolog 2 (Xenopus laevis) 1 1
MIRT047101 TRIM28 tripartite motif-containing 28 1 1
MIRT047102 HYOU1 hypoxia up-regulated 1 1 1
MIRT047103 POLH polymerase (DNA directed), eta 1 1
MIRT047104 TRAF4 TNF receptor-associated factor 4 1 1
MIRT047105 KIF5C kinesin family member 5C 1 1
MIRT047106 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT047107 FAM175B family with sequence similarity 175, member B 1 1
MIRT047108 WNK1 WNK lysine deficient protein kinase 1 1 1
MIRT047109 DTYMK deoxythymidylate kinase (thymidylate kinase) 1 1
MIRT047110 STK40 serine/threonine kinase 40 1 1
MIRT047111 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT047112 RPLP0 ribosomal protein, large, P0 1 1
MIRT047113 NIPBL Nipped-B homolog (Drosophila) 1 1
MIRT047114 FOXK2 forkhead box K2 1 1
MIRT047115 LARP1 La ribonucleoprotein domain family, member 1 1 1
MIRT047116 TRO trophinin 1 1
MIRT047117 LARS leucyl-tRNA synthetase 1 1
MIRT047118 ST13 suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) 1 1
MIRT047119 ELAC2 elaC homolog 2 (E. coli) 1 1
MIRT047120 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 1 1
MIRT047121 WDR53 WD repeat domain 53 1 1
MIRT047122 MYBBP1A MYB binding protein (P160) 1a 1 1
MIRT047123 MYCBP2 MYC binding protein 2 1 1
MIRT047124 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT047125 TPRG1L tumor protein p63 regulated 1-like 1 1
MIRT047126 ARHGAP21 Rho GTPase activating protein 21 1 1
MIRT047127 CCNB1 cyclin B1 1 1
MIRT047128 MTF2 metal response element binding transcription factor 2 1 1
MIRT047129 GSPT1 G1 to S phase transition 1 1 1
MIRT047130 UQCRC1 ubiquinol-cytochrome c reductase core protein I 1 1
MIRT047131 SRSF10 splicing factor, arginine/serine-rich 13A 1 1
MIRT047132 RIF1 RAP1 interacting factor homolog (yeast) 1 1
MIRT047133 ZFAT zinc finger and AT hook domain containing 1 1
MIRT047134 PSMD13 proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 1 1
MIRT047135 FAT2 FAT tumor suppressor homolog 2 (Drosophila) 1 1
MIRT047136 CSNK2A1 casein kinase 2, alpha 1 polypeptide 1 1
MIRT047137 HINT1 histidine triad nucleotide binding protein 1 1 1
MIRT047138 HARS histidyl-tRNA synthetase 1 1
MIRT047139 KLHL23 kelch-like 23 (Drosophila) 1 1
MIRT047140 USP22 ubiquitin specific peptidase 22 1 1
MIRT047141 TSR1 TSR1, 20S rRNA accumulation, homolog (S. cerevisiae) 1 1
MIRT047142 RC3H2 ring finger and CCCH-type zinc finger domains 2 1 1
MIRT047143 BTAF1 BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae) 1 1
MIRT047144 ARHGEF5 Rho guanine nucleotide exchange factor (GEF) 5 1 1
MIRT047145 CYB5D2 cytochrome b5 domain containing 2 1 1
MIRT047146 MYO10 myosin X 1 1
MIRT047147 MCM4 minichromosome maintenance complex component 4 1 1
MIRT047148 INSIG1 insulin induced gene 1 1 1
MIRT047149 EIF4A3 eukaryotic translation initiation factor 4A3 1 1
MIRT047150 ITGA8 integrin, alpha 8 1 1
MIRT047151 P4HB prolyl 4-hydroxylase, beta polypeptide 1 1
MIRT047152 CS citrate synthase 1 1
MIRT047153 PTPN11 protein tyrosine phosphatase, non-receptor type 11 1 1
MIRT047154 FNTB farnesyltransferase, CAAX box, beta 1 1
MIRT047155 ABCC10 ATP-binding cassette, sub-family C (CFTR/MRP), member 10 1 1
MIRT047156 GNL3 guanine nucleotide binding protein-like 3 (nucleolar) 1 1
MIRT047157 RALGDS ral guanine nucleotide dissociation stimulator 1 1
MIRT047158 PLEKHM1 pleckstrin homology domain containing, family M (with RUN domain) member 1 1 1
MIRT047159 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 1 1
MIRT047160 WASH3P WAS protein family homolog 3 pseudogene 1 1
MIRT047161 FOXN2 forkhead box N2 1 1
MIRT047162 C5orf24 chromosome 5 open reading frame 24 1 1
MIRT047163 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT047164 C14orf1 chromosome 14 open reading frame 1 1 1
MIRT047165 KDELC2 KDEL (Lys-Asp-Glu-Leu) containing 2 1 1
MIRT047166 HIPK2 homeodomain interacting protein kinase 2 1 1
MIRT047167 KNTC1 kinetochore associated 1 1 1
MIRT047168 THOC2 THO complex 2 1 1
MIRT047169 GUCD1 chromosome 22 open reading frame 13 1 1
MIRT047170 KIAA0430 KIAA0430 1 1
MIRT047171 LENG8 leukocyte receptor cluster (LRC) member 8 1 1