Accession ID: MIRT047589 [miRNA, hsa-miR-10a-5p :: MTR, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-10aLinkOut: [miRBase ]
Synonyms MIRN10A, hsa-mir-10a, miRNA10A, mir-10a, MIR10A
Description Homo sapiens miR-10a stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-10a-5p
Mature Sequence 22| UACCCUGUAGAUCCGAAUUUGUG |44
Evidence Experimental
Experiments Cloned
Putative hsa-miR-10a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MTR LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms FLJ33168, FLJ43216, FLJ45386, MS, cblG
Description 5-methyltetrahydrofolate-homocysteine methyltransferase
Transcript NM_0002    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MTR LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MTR
(miRNA target sites are highlighted)
>MTR|NM_0002|3'UTR
   1 TAACTTTTTTTTTTTTTTTGCCTTTTTTATTCTTGATGATCCTCAAGGAAATACAACCTAGGGTGCCTTAAAAATAACAA
  81 CAACAAAAAACCTGTGTGCATCTGGCTGACACTTACCTGCTTCTGGTTTTCGAAGACTATTTAGTGGAACCTTGTAGAGG
 161 AGCAGGGTCTTCCTGCAGTGCCTGGAAAACAGGCGCTGTTTTTTTGGGACCTTGCGTGAAGAGCAGTGAGCAGGGTTCCT
 241 GTGGTTTCCCTGGTCCCTCTGAGATGGGGACAGACTGAAGACAGAGGTCGTTTGATTTCAAAGCAAGTCAACCTGCTTTT
 321 TTCTGTTTTTACAGTGGAATCTAGGAGGCCACTTAGTCGTCTTTTTTTCCTCTTAGAAGAAAAGCCTGAAACTGAGTTGA
 401 ATAGAGAAGTGTGACCCTGTGACAAAATGATACTGTGAGAAATGGGGCATTTTAATCTAAGTGGTTATAACAGTGGATTC
 481 TGACGGGGAAGGTGTAGCTCTGTTCTCTTCGGAAGACCTCGTTTTCTAAAGGCTGGACTAAATGGCTGCAGAACTCCCTT
 561 TGGCAAAAGGCATGCGCTCACTGCTTGCTTGTCAGAAACACTGAAGCCATTTGCCCCAGTGTGGTCAAGCAGCCATGCTT
 641 TCTGGGCATTTTCGTCCTCCCATAATTTCATATTTCCGTACCCCTGAGGAAACAAAAAGGAAATGAGGAGAGAAAGTTAC
 721 TGTTAAGGGTGGTTAACATTTTTTTTGTTTTGTTTTGTTTTGGTTTTTTTTTTTTTGAGACAGAGTCTGGCTCTGTCGCC
 801 CAGGCTGGAGTGCAGGGGCGCAATCTCGGCTCATAGCAAGCTCCGCCTCCTGGGTTCATGCCATTCTCCTGCCTCAGCCT
 881 CCAGAGTAGCTGGGACTACAGGTGCCCGCCACCACACCCGGCTAATTTTTTGTGTTTTTACAAAATACAAAAAAGTAGAG
 961 ACAGGATTTCACTGTGTTAGCCAGGATGGTCTTGATCTCCCGACCTCGTGATCTGCCCACCTCAGCCTCCCAAAATGCTG
1041 GGATTACAGGCGTGAGCCACCGAGCCTGGCCGGTTAACATCTTTTAATTGTTTCCAGGATTGAGCAGGTTCTCAGCTGGG
1121 CTCTGATATCCCGTGCGGAGTTGGACAAGTGGGCAGCATAAAGTCACTCATTTCTTACCATTTTATTCCCCTCAATTCTC
1201 AATATATTCAGTAATGAAGAATGGTGCCACCACTCAAGCAACAAGCCTCAAACTCAACCATGTCATCTTTTTCTTGGATG
1281 ATTGCAGTTATTTCAAAAATTTGCATGCAAAATATACACTCATCCTACTTCAAGATGGTGGTGGCAATAGTCAGGAGAAG
1361 GTAACATTGGAGTCCTGGTTTGATTCGAAGGATGAAGACGAAGAAGCAAGGGAGGAACAAATGAAGAACCATCTTTGTTC
1441 ATGAATAGGAATATTCAAGATTATAAAGGTATCAGGTCTCCTAAAATTGATCTATGGATTTAATACCATTTTCAATGGAA
1521 ATTCCAACAGATTTTATTGAATGAAACAAGCAGGTGTTTATATGGAGTAGCAAAGGACTTAAAATTACCAAATGCTTCTA
1601 AATATGAAGGAGAGGTTGGGGACACGCACCCTATGTGATACCAAGTTTTATTGTCAAGACAGTGTCATGGTGCAGAGGTA
1681 GGCATTCTGAGCAGGGGAACAAAATAAGGGCCTAGAAACTCACCCGTGCATATGTTGACCTTTGCAAAATGACCTGGTGA
1761 CATGGCAAGTCAGTGGGGACAGGAAGGACCACTCCCTAAGTAATCCCAGAACAATGGCTATTCATGTGGGAAAAAAAGAA
1841 ATTTTACTTTCTCTCACCTTACCTGGTGATAAGTTCCAAATATGTTAAGGGCTTTAATACAAAAAGCAAAAATTGTCAGT
1921 GTTTGGATGAAAAAAGCCTTAGGGCAGGAAAGAATCTCTTGAGACATAAAGTAGTAATCATAAAGGACAAGATGGTTAAG
2001 TCAATTCTGTTAAAACTCAAGGCTTATATTAAGCAAACACTTGAAGTGAGAAGATGATCCACAACTTGAGAAGACATTTA
2081 TAATACAAATAACTGATGAAGGATTCATAATCACAAATATAGAGAATTCCTATTTAAAAAAATAGAAAAATAGTGAAGAC
2161 TACACAAGAGGAAATAGGGCTTTTAAATAAATAGATGTTCTGTAGCATTGGTCAGGGAAATATGAATTAGGACCACAATG
2241 AGATTCCATTTTATATCCATAAGATTTGCAAAGGTTGGGTCTGACAGTACCAGTTGTTAGATCTGTAGGGACTTGTACAA
2321 CATTGTGGATGTGTAAACAGGCACCACTGCTTTAAAAAACAATTATCCCTTACAGACTTGAACATTTGCAGACGTTATGA
2401 TCTTGCTTCCAACTCCCACCTGTATGTCCAGCAAACTCTTGCATGTGGCCACTAGGAGGAATGTGTAAGAATGTTCATAG
2481 TTACATATTTATAATAGTTAATAACTGGAAAAAGTGAAATGTATGTCTGTCTACAGGAAAATAGGTGAATAATTAGATAT
2561 ATATATTCATTCTACGGGATATTATTCAGTAGTGGAAATGAGTGAACTACAGCTATACCTCACAATAAGAATGAATCTCA
2641 GAAAATATTAAGGAAAAAAGCAAGTTTGAAGAGACCACATGGGGCGTACTATTTTTATTGAGCCCAAAAACAAGCAAAAC
2721 CAAAGAATATGTAGTCTAAGCATACGTATACAATAAAACTATGCTATTAAAAAAAAAGAAGGTAACTGATAAACCAAAAT
2801 TGAGCATAGTAATTACCCACAGAAGGAGGAAGTGGAAGGGACAGGAGCACATAGGTAGATGCCAAGTTATGCAGCTGTTC
2881 TGGTTCCTCCTGGTAGGCTTACAAGTGTTTACTATATGCTATTAATACATTATACTTTATAACTAATAGATAACAGTTTT
2961 TTACATATTAAATATGTTCTACTTAAATATATTATAAAAAATAAAGGCAAAGTGGAATGATAACCTAAAATCTGGTATGG
3041 TGATTTTGTAGGTAATGTTTGTATATGTCAAATACAGTTTTTAAGGAAAGGAAGAACATCTTAGGGTAAACAGCAGCTAG
3121 AAAGGTGAGGGGCAGGAGAGTGGTGCATCCTTGCTGCTGCCAGCAGTGCCCAGATACCAGGCTTTGGGGAATGAGTGGAT
3201 GGCTGGACCATTTGCTAAGACAGAGGCCAGGGGATGGGAGAAATGATGAGTTTTGGAAAGATTCGATGTGACTAGACTGA
3281 ATATAGGCAGTTGGATACTAGACTTTGGAATTTAAAAAGAATGTCTGGAGTTAGAATTGAGAGACTTGAACGTGGAGATG
3361 GAGGTCAGGCTGCAGTGCGATGGGATCATCTATGGAGCATATGAGGAGAAGAGAATCTGGAGGAGGAGGAGGGGGAGCCA
3441 GCAGGGGAGCAGCTGTGGGTTGGAGGAAGCCAGGAGGGAGAGTGCAATGCCGAGAAAGCAATGAAGAGCGTTTCGAAGCA
3521 TGCCAGCAGAACCCAATGCTGCAAAGAGGCCTGGGAATGGGATTGCTGAGGGCCCTTCTCACAGTGAGCCCCTCAAGAGC
3601 AGCGTCAGGGGATTGTGGGGACTGTTGGCACACAGCTGGCTTTGCTAGGTTGAAGACAATGGGAGGTGTGGAAGACTTGT
3681 TGACTCATTTAAAGAAGATTGGAGGGAAAGGTAGGATTGAGAGTGTTTCAGACAGAAAAAGGATTATATGCTGAGGGTAA
3761 AGCACAAGTACAGAGGGTTGCAGATAGTGCAGAAGTCTTTAAAAACAATTATTTTAACCCAACTTCCAGGGAGACTGAAT
3841 TTCTTCTGCCAGTCAGTAACACCATCAACCTGGGAGTTGCCCCTGACCCCTCCAGTCTTAGCTCCTGCTCCTGTAACAAA
3921 ATACCACAAACTGGTTAGCTTATAGAGAACAGATGTTTATTTCTTACAGTTCAGGAGTCTGGAAGTCCAAGATCATGGTG
4001 CCATCATGGCCGAGTTCTGGTGAGGGCCCTCTTCTGGGATGCAGCGGCCAGCTTCTCATGTTCTCACAGTGGGTGGAGGG
4081 TAAGCTTGCTCTCTGGCCTCCTCTTAAAAAGGCACTAATCCCATTCATGAGGGCTCCACCTTCATGACCTAATTACCTCC
4161 CAAAGATGCCATCTCCAAACACCATCATTCTGGGGATTCCATTTCAACATGATTTGGGGGATACATCAGACCATAACACT
4241 TTTCTTTTTCTCAACCTTCACATCCAGTTGGTTCTCAAGCCCTGGCGATTTTACGCGCTAGATAGGTCTTAAGTTCATCT
4321 CTACGCCTGCCCTGGTTAAGGTTCTCATCATTTCTCCTCTGGATTCATCTGCAACACAGGCTGCCGGGTTGGTTCCCACC
4401 TCCTAGAGCTGGAAGAGTGGGCTCTCTGATTCTTTACACCCCCGCCTCAATCCTCCTGCTGCCTGAATAACCATCTCCCC
4481 GTGACCTAGGATATATCCCAGCCCCTTAGAGGCATGCAAAGCCTTCCATGTCTGACCCTGCCTCATGTCTTGGAAGCCCT
4561 AGACTGCTGCTGTACCCTGAAGGAGGTACCTGCTCACATTGGCCCCTCTGTCTGGAATAACCCCACCCCGGTTCCACCCA
4641 AGTCAGGAAAGCTTCCCAACCCCTCCCTCCCACCACCCCAAAGCTAAGTGAAGTGACCCCTCTTCTTGCCTCTGTAACAC
4721 CGCCATGCACATTTCATACAGCCCTTGCTGAAACTTCATCTAGTTCTCTGTTAGACTTAACATTCCCTAAGGGCAGGTTT
4801 GGAACCTTACTCATCTTTATATGGCGTCTAAAATAGTGCTTGCTTTATGATAGGTGCTCAGTAAAGGTTGTCTTGAATTG
4881 AGCAGATCCTCTAGGGACAGGAGTTGGATGGAGAGCAGACTGTAAAGCCTCATGAGGGCAGGGGCCCTGCCTCTTCCTGA
4961 GCTCAGGATACCCAGAGCCTAGCTCAGTGCCTGCCATGAAATTGTTCACTCCATCAAGCCTTGTTAAATGAGTTCGGGGC
5041 GGGGGGAGCATGATGGTTTTCTCTCTCTCAGAAAGAAAGCGCTGTATCAAAGCCCTAGCACCCTCTCTACACCCACCTTC
5121 AGTATTTCATATTAGATGCGGCCCAAGTGATACTTTCTTTACCGTCCCGTGAAGACAGCATATTGGCAGCCCTGCAAAAA
5201 CAAAACAAAACAAAACCCTCAGTTCATGGCATACTTGCTATAAATCAGCTATGTGTATTGTCAAATTGTAGAACTGAAAG
5281 TATATTCTGATTCGGTGTGTGTATAAGGAAATATACACCAGTATATGCATTAAAACGTCAAGAAGAGCTGGGCACAGTGT
5361 CACATGCCTGTAAACCCAGCTATTCAGGAGGCTGAGGTGGGAGGATCGGTTGAGGCCAGGAGTTTGAGGCTGCAGTGAGC
5441 TATGATTGCACAGCTGCACTCCAGCCTGTGCTGAGACCTCATCTCTTAAAAAATAAAAAATAAAAAGTCTAAGAGGATAC
5521 ACAGAAATTTTTAAGTGGTTACCTCCACGGAATGGGATTAGGGGATCAGAGGTGAGGGAACTCATGGTTTGGCTATTTCT
5601 CGTTCTTTCTGCACTGTTTCAAATTTTTACAAGTGTATGTTATTGTACTTTTAAAAAGATTAGCTTGGCAACAAGTCTAG
5681 CCTGAAATGGGTGCTATTTTGACTAGTCTGAGTGAAAAGTGAGGATTTAAATGAAGTAACCCCTAAACTCAGCCAGTCCC
5761 ATGTTTTTTTAACACTTGGAATATCTAATTCCATTTACACTGCATTCTTCAAATGTAATTTTCAAAGATGCCTTTTGCCT
5841 CATCCCTTGCTTTTAAGTATTATTATAGACTTTTGGAGACTCACGAAACAAGCAATCCCTAAATTCTCGCCCAGGAAAGT
5921 ATCTTGGATTAAATGGTTTTTGAGAACCTTGAGAGTGTATATTCTATGAAATGGAAGAAACAAGAACTAGACAGAGTCAC
6001 AAATGCTGTTGATCACAGACAATCTCTGCCATCCATAAGGTAAATGTAATACATCTGGCGACCTGCTGAGTGTGAACTTG
6081 CAGCAGGTGAGGAAGGAACTCTGAACTCTCACAATCTTGTTTCTTCATTTCCCAGAGAGAAACTCGGCAAAGAGAAAAAG
6161 GACATTTCCCTCCAGGTTATCTGAAAGAATTTCAATGCTTACCTTTAATCATGTGACATTGTTTATCTTGGATTAAAAGA
6241 AAAGAAAATGTATTTATTTTGTGCATATTTTCAATAAAATATATAAAATCGAGTTGGTATATAGTGCCAAATACCATTAA
6321 TTAAAAATATTTTAACCTGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUA--AGCCUAGAUGUCC-CAu 5'
             ||||  | |||| |||||| || 
Target 5' ccaAAATGCTGGGAT-TACAGGCGTg 3'
1030 - 1054 137.00 -16.50
2
miRNA  3' gugUUUAAGC--CUAGAUGUCCCAu 5'
             ||  |:|  ||   :|||||| 
Target 5' tggAACCTTGTAGAGGAGCAGGGTc 3'
145 - 169 130.00 -14.30
3
miRNA  3' gugUUUAAGCCUAGAUGUCCCAu 5'
             ||:  | | |  :|||||| 
Target 5' gtgAAGAGCAG-TGAGCAGGGTt 3'
216 - 237 127.00 -10.00
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-10a-5p :: MTR    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gtgtTTA--AGCCTAGATGTCCCat 5'
              |:|  |: |||||::||||  
Target 5' ----AGTTGTTAGATCTGTAGGGac 3'
1 - 21
2
miRNA  3' gtgTTTAAGCCTAGATGTCCCAT------- 5'
             ::| |:| | | |||  ||:       
Target 5' tagGGACTTGTA-CAACATTGTGGATGTGT 3'
15 - 43
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
297 hsa-miR-10a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001140 HOXA1 homeobox A1 4 2
MIRT003896 USF2 upstream transcription factor 2, c-fos interacting 4 1
MIRT005454 NCOR2 nuclear receptor corepressor 2 3 1
MIRT005509 MAP3K7 mitogen-activated protein kinase kinase kinase 7 5 1
MIRT005510 BTRC beta-transducin repeat containing 5 1
MIRT006536 SRSF1 splicing factor, arginine/serine-rich 1 1 1
MIRT006537 TRA2B transformer 2 beta homolog (Drosophila) 1 1
MIRT006972 EPHA4 EPH receptor A4 4 2
MIRT007021 CHL1 cell adhesion molecule with homology to L1CAM (close homolog of L1) 1 1
MIRT025588 GPR63 G protein-coupled receptor 63 1 1
MIRT025589 BCL2L13 BCL2-like 13 (apoptosis facilitator) 1 1
MIRT025590 CREB5 cAMP responsive element binding protein 5 1 1
MIRT025591 BIRC5 baculoviral IAP repeat-containing 5 1 1
MIRT025592 OMA1 OMA1 homolog, zinc metallopeptidase (S. cerevisiae) 1 1
MIRT025593 IER3IP1 immediate early response 3 interacting protein 1 1 1
MIRT025594 RBM17 RNA binding motif protein 17 1 1
MIRT025595 NR1D2 nuclear receptor subfamily 1, group D, member 2 1 1
MIRT025596 BAMBI BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) 1 1
MIRT025597 SNX4 sorting nexin 4 1 1
MIRT025598 SERBP1 SERPINE1 mRNA binding protein 1 1 2
MIRT025599 LHFPL4 lipoma HMGIC fusion partner-like 4 1 1
MIRT025600 NOP16 NOP16 nucleolar protein homolog (yeast) 1 1
MIRT025601 AJUBA jub, ajuba homolog (Xenopus laevis) 1 1
MIRT025602 MAPK8 mitogen-activated protein kinase 8 1 1
MIRT025603 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT025604 TMEM101 transmembrane protein 101 1 2
MIRT025605 YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 1 1
MIRT025606 DUSP3 dual specificity phosphatase 3 1 1
MIRT025607 PANX1 pannexin 1 1 1
MIRT025608 WEE1 WEE1 homolog (S. pombe) 1 1
MIRT025609 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) 1 1
MIRT025610 PDPK1 3-phosphoinositide dependent protein kinase-1 1 1
MIRT025611 CMPK1 cytidine monophosphate (UMP-CMP) kinase 1, cytosolic 1 1
MIRT025612 NDUFB6 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa 1 1
MIRT025613 ARPC5 actin related protein 2/3 complex, subunit 5, 16kDa 1 1
MIRT025614 PUM2 pumilio homolog 2 (Drosophila) 1 1
MIRT025615 GATAD2A GATA zinc finger domain containing 2A 1 1
MIRT025616 ACVR2A activin A receptor, type IIA 1 1
MIRT025617 RBM12B RNA binding motif protein 12B 1 1
MIRT025618 THUMPD1 THUMP domain containing 1 1 2
MIRT025619 BLOC1S5 muted homolog (mouse) 1 1
MIRT025620 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 1 1
MIRT025621 XRN1 5'-3' exoribonuclease 1 1 1
MIRT025622 E2F7 E2F transcription factor 7 1 1
MIRT025623 LCA5 Leber congenital amaurosis 5 1 1
MIRT025624 ELOVL2 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2 1 1
MIRT025625 TFAP2C transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) 1 1
MIRT025626 TRIM2 tripartite motif-containing 2 1 1
MIRT025627 HOXB3 homeobox B3 1 1
MIRT047505 FUS fused in sarcoma 1 1
MIRT047506 LMBR1L limb region 1 homolog (mouse)-like 1 1
MIRT047507 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT047508 SPECC1 cytospin B 1 1
MIRT047509 EXTL3 exostoses (multiple)-like 3 1 1
MIRT047510 POLR2A polymerase (RNA) II (DNA directed) polypeptide A, 220kDa 1 1
MIRT047511 RIOK2 RIO kinase 2 (yeast) 1 1
MIRT047512 C12orf76 chromosome 12 open reading frame 76 1 1
MIRT047513 CCDC151 coiled-coil domain containing 151 1 1
MIRT047514 FAT2 FAT tumor suppressor homolog 2 (Drosophila) 1 1
MIRT047515 TPI1 triosephosphate isomerase 1 1 1
MIRT047516 BTAF1 BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae) 1 1
MIRT047517 MSANTD1 chromosome 4 open reading frame 44 1 1
MIRT047518 PLA2G4A phospholipase A2, group IVA (cytosolic, calcium-dependent) 1 1
MIRT047519 IGSF1 immunoglobulin superfamily, member 1 1 1
MIRT047520 LEMD3 LEM domain containing 3 1 1
MIRT047521 E2F1 E2F transcription factor 1 1 1
MIRT047522 KIF3B kinesin family member 3B 1 1
MIRT047523 GBAS glioblastoma amplified sequence 1 1
MIRT047524 LIMA1 LIM domain and actin binding 1 1 1
MIRT047525 HSPA4 heat shock 70kDa protein 4 1 1
MIRT047526 MRC2 mannose receptor, C type 2 1 1
MIRT047527 TMEM106B transmembrane protein 106B 1 1
MIRT047528 ZFP30 zinc finger protein 30 homolog (mouse) 1 1
MIRT047529 AMPD1 adenosine monophosphate deaminase 1 1 1
MIRT047530 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 1 1
MIRT047531 RPL15 ribosomal protein L15 1 1
MIRT047532 AGER advanced glycosylation end product-specific receptor 1 1
MIRT047533 CNTLN centlein, centrosomal protein 1 1
MIRT047534 C21orf59 chromosome 21 open reading frame 59 1 1
MIRT047535 SEPT9 septin 9 1 1
MIRT047536 COL6A2 collagen, type VI, alpha 2 1 1
MIRT047537 MLNR motilin receptor 1 1
MIRT047538 RTKN2 rhotekin 2 1 1
MIRT047539 OAZ1 ornithine decarboxylase antizyme 1 1 1
MIRT047540 CSNK2A1 casein kinase 2, alpha 1 polypeptide 1 1
MIRT047541 AQP12B aquaporin 12B 1 1
MIRT047542 AGBL2 ATP/GTP binding protein-like 2 1 1
MIRT047543 GOLGA8A golgin A8 family, member A 1 1
MIRT047544 CPED1 chromosome 7 open reading frame 58 1 1
MIRT047545 HSPA8 heat shock 70kDa protein 8 1 1
MIRT047546 SLC41A3 solute carrier family 41, member 3 1 1
MIRT047547 KXD1 chromosome 19 open reading frame 50 1 1
MIRT047548 RELN reelin 1 1
MIRT047549 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT047550 PTPRT protein tyrosine phosphatase, receptor type, T 1 1
MIRT047551 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT047552 CYP8B1 cytochrome P450, family 8, subfamily B, polypeptide 1 1 1
MIRT047553 COL4A3 collagen, type IV, alpha 3 (Goodpasture antigen) 1 1
MIRT047554 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT047555 MSL3 male-specific lethal 3 homolog (Drosophila) 1 1
MIRT047556 TTC7A tetratricopeptide repeat domain 7A 1 1
MIRT047557 COX7B cytochrome c oxidase subunit VIIb 1 1
MIRT047558 ZNF318 zinc finger protein 318 1 1
MIRT047559 ACAA1 acetyl-CoA acyltransferase 1 1 1
MIRT047560 IPCEF1 interaction protein for cytohesin exchange factors 1 1 1
MIRT047561 SCAP SREBF chaperone 1 1
MIRT047562 KCTD11 potassium channel tetramerisation domain containing 11 1 1
MIRT047563 RIOK3 RIO kinase 3 (yeast) 1 1
MIRT047564 C5 complement component 5 1 1
MIRT047565 GLB1L3 galactosidase, beta 1-like 3 1 1
MIRT047566 PAPD5 PAP associated domain containing 5 1 1
MIRT047567 RNF123 ring finger protein 123 1 1
MIRT047568 ZNF629 zinc finger protein 629 1 1
MIRT047569 AMMECR1L AMME chromosomal region gene 1-like 1 1
MIRT047570 KLHL6 kelch-like 6 (Drosophila) 1 1
MIRT047571 SYMPK symplekin 1 1
MIRT047572 NCSTN nicastrin 1 1
MIRT047573 GALNT1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) 1 1
MIRT047574 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT047575 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 1 1
MIRT047576 RAB18 RAB18, member RAS oncogene family 1 1
MIRT047577 CUL3 cullin 3 1 1
MIRT047578 MTF2 metal response element binding transcription factor 2 1 1
MIRT047579 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT047580 NUP37 nucleoporin 37kDa 1 1
MIRT047581 GPR98 G protein-coupled receptor 98 1 1
MIRT047582 RUNDC3B RUN domain containing 3B 1 1
MIRT047583 KIF21A kinesin family member 21A 1 1
MIRT047584 FEM1B fem-1 homolog b (C. elegans) 1 1
MIRT047585 RABL6 chromosome 9 open reading frame 86 1 1
MIRT047586 PLA2G4F phospholipase A2, group IVF 1 1
MIRT047587 SNTB2 syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) 1 1
MIRT047588 NUB1 negative regulator of ubiquitin-like proteins 1 1 1
MIRT047589 MTR 5-methyltetrahydrofolate-homocysteine methyltransferase 1 1
MIRT047590 DNAJB1 DnaJ (Hsp40) homolog, subfamily B, member 1 1 1
MIRT047591 C11orf63 chromosome 11 open reading frame 63 1 1
MIRT047592 ABCB7 ATP-binding cassette, sub-family B (MDR/TAP), member 7 1 1
MIRT047593 CHRNA5 cholinergic receptor, nicotinic, alpha 5 1 1
MIRT047594 RPS9 ribosomal protein S9 1 1
MIRT047595 DDX42 DEAD (Asp-Glu-Ala-Asp) box polypeptide 42 1 1
MIRT047596 XPO7 exportin 7 1 1
MIRT047597 PYGL phosphorylase, glycogen, liver 1 1
MIRT047598 TGFB3 transforming growth factor, beta 3 1 1
MIRT047599 ARHGAP19 Rho GTPase activating protein 19 1 1
MIRT047600 PHB2 prohibitin 2 1 1
MIRT047601 ALDH1A2 aldehyde dehydrogenase 1 family, member A2 1 1
MIRT047602 SLC3A2 solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 1 1
MIRT047603 POLR2H polymerase (RNA) II (DNA directed) polypeptide H 1 1
MIRT047604 TAF15 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa 1 1
MIRT047605 MOB3C MOB1, Mps One Binder kinase activator-like 2C (yeast) 1 1
MIRT047606 MBD1 methyl-CpG binding domain protein 1 1 1
MIRT047607 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT047608 INTS2 integrator complex subunit 2 1 1
MIRT047609 MYEF2 myelin expression factor 2 1 1
MIRT047610 PANK2 pantothenate kinase 2 1 1
MIRT047611 EMB embigin homolog (mouse) 1 1
MIRT047612 HK1 hexokinase 1 1 1
MIRT047613 UBE2Z ubiquitin-conjugating enzyme E2Z 1 1
MIRT047614 STT3A STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae) 1 1
MIRT047615 HOXA3 homeobox A3 1 1
MIRT047616 NT5DC1 5'-nucleotidase domain containing 1 1 1
MIRT047617 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 1
MIRT047618 APRT adenine phosphoribosyltransferase 1 1
MIRT047619 C2CD2 C2 calcium-dependent domain containing 2 1 1
MIRT047620 SHBG sex hormone-binding globulin 1 1
MIRT047621 PPP1R12A protein phosphatase 1, regulatory (inhibitor) subunit 12A 1 1
MIRT047622 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT047623 BCKDK branched chain ketoacid dehydrogenase kinase 1 1
MIRT047624 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 1 1
MIRT047625 GTF3C2 general transcription factor IIIC, polypeptide 2, beta 110kDa 1 1
MIRT047626 NOP2 NOP2 nucleolar protein homolog (yeast) 1 1
MIRT047627 RPS29 ribosomal protein S29 1 1
MIRT047628 LAMC1 laminin, gamma 1 (formerly LAMB2) 1 1
MIRT047629 GNAL guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type 1 1
MIRT047630 KIAA1147 KIAA1147 1 1
MIRT047631 NACC2 NACC family member 2, BEN and BTB (POZ) domain containing 1 1
MIRT047632 TMEM179B transmembrane protein 179B 1 1
MIRT047633 ARF3 ADP-ribosylation factor 3 1 1
MIRT047634 MCPH1 microcephalin 1 1 1
MIRT047635 ARMCX3 armadillo repeat containing, X-linked 3 1 1
MIRT047636 UBN2 ubinuclein 2 1 1
MIRT047637 ANO6 anoctamin 6 1 1
MIRT047638 NEK7 NIMA (never in mitosis gene a)-related kinase 7 1 1
MIRT047639 EIF4H eukaryotic translation initiation factor 4H 1 1
MIRT047640 MED1 mediator complex subunit 1 1 1
MIRT047641 PTPRG protein tyrosine phosphatase, receptor type, G 1 1
MIRT047642 ERMN ermin, ERM-like protein 1 1
MIRT047643 LYPD6 LY6/PLAUR domain containing 6 1 1
MIRT047644 SLC25A5 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5 1 1
MIRT047645 EPB41L2 erythrocyte membrane protein band 4.1-like 2 1 1
MIRT047646 ARFGEF1 ADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited) 1 1
MIRT047647 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT047648 NTMT1 methyltransferase like 11A 1 1
MIRT047649 KLHL23 kelch-like 23 (Drosophila) 1 1
MIRT047650 FGFR1 fibroblast growth factor receptor 1 1 1
MIRT047651 HOXD13 homeobox D13 1 1
MIRT047652 CHFR checkpoint with forkhead and ring finger domains 1 1
MIRT047653 ZNF592 zinc finger protein 592 1 1
MIRT047654 EIF1AD eukaryotic translation initiation factor 1A domain containing 1 1
MIRT047655 RRP1B ribosomal RNA processing 1 homolog B (S. cerevisiae) 1 1
MIRT047656 UHRF1 ubiquitin-like with PHD and ring finger domains 1 1 1
MIRT047657 SORD sorbitol dehydrogenase 1 1
MIRT047658 PPM1G protein phosphatase, Mg2+/Mn2+ dependent, 1G 1 1
MIRT047659 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT047660 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT047661 PRDX2 peroxiredoxin 2 1 1
MIRT047662 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 1
MIRT047663 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT047664 CAB39L calcium binding protein 39-like 1 1
MIRT047665 ATP5F1 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1 1 1
MIRT047666 PARL presenilin associated, rhomboid-like 1 1
MIRT047667 ERLIN1 ER lipid raft associated 1 1 1
MIRT047668 MARS methionyl-tRNA synthetase 1 1
MIRT047669 TRPM7 transient receptor potential cation channel, subfamily M, member 7 1 1
MIRT047670 DLG4 discs, large homolog 4 (Drosophila) 1 1
MIRT047671 WDR74 WD repeat domain 74 1 1
MIRT047672 PWP1 PWP1 homolog (S. cerevisiae) 1 1
MIRT047673 RPRD1A regulation of nuclear pre-mRNA domain containing 1A 1 1
MIRT047674 NAP1L1 nucleosome assembly protein 1-like 1 1 1
MIRT047675 CTNND1 catenin (cadherin-associated protein), delta 1 1 1
MIRT047676 IQCB1 IQ motif containing B1 1 1
MIRT047677 EIF1 eukaryotic translation initiation factor 1 1 1
MIRT047678 CDK19 cyclin-dependent kinase 19 1 1
MIRT047679 LRP3 low density lipoprotein receptor-related protein 3 1 1
MIRT047680 UBE2D2 ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast) 1 1
MIRT047681 GEMIN5 gem (nuclear organelle) associated protein 5 1 1
MIRT047682 GORASP2 golgi reassembly stacking protein 2, 55kDa 1 1
MIRT047683 DDX54 DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 1 1
MIRT047684 CARHSP1 calcium regulated heat stable protein 1, 24kDa 1 1
MIRT047685 FAM168A family with sequence similarity 168, member A 1 1
MIRT047686 SF3B4 splicing factor 3b, subunit 4, 49kDa 1 1
MIRT047687 ATP1A2 ATPase, Na+/K+ transporting, alpha 2 polypeptide 1 1
MIRT047688 PLEKHB2 pleckstrin homology domain containing, family B (evectins) member 2 1 1
MIRT047689 LRFN1 leucine rich repeat and fibronectin type III domain containing 1 1 1
MIRT047690 KIAA0100 KIAA0100 1 1
MIRT047691 DVL1 dishevelled, dsh homolog 1 (Drosophila) 1 1
MIRT047692 NOMO1 NODAL modulator 1 1 1
MIRT047693 MIS12 MIS12, MIND kinetochore complex component, homolog (S. pombe) 1 1
MIRT047694 GLOD4 glyoxalase domain containing 4 1 1
MIRT047695 USP11 ubiquitin specific peptidase 11 1 1
MIRT047696 UBE3C ubiquitin protein ligase E3C 1 1
MIRT047697 NT5DC3 5'-nucleotidase domain containing 3 1 1
MIRT047698 SPARC secreted protein, acidic, cysteine-rich (osteonectin) 1 1
MIRT047699 SLC26A2 solute carrier family 26 (sulfate transporter), member 2 1 1
MIRT047700 MED12 mediator complex subunit 12 1 1
MIRT047701 FAM219B chromosome 15 open reading frame 17 1 1
MIRT047702 GOSR2 golgi SNAP receptor complex member 2 1 1
MIRT047703 MEAF6 MYST/Esa1-associated factor 6 1 1
MIRT047704 PIAS3 protein inhibitor of activated STAT, 3 1 1
MIRT047705 ASB1 ankyrin repeat and SOCS box-containing 1 1 1
MIRT047706 COL4A2 collagen, type IV, alpha 2 1 1
MIRT047707 NUP205 nucleoporin 205kDa 1 1
MIRT047708 POLR3A polymerase (RNA) III (DNA directed) polypeptide A, 155kDa 1 1
MIRT047709 ATG3 ATG3 autophagy related 3 homolog (S. cerevisiae) 1 1
MIRT047710 COPA coatomer protein complex, subunit alpha 1 1
MIRT047711 CD59 CD59 molecule, complement regulatory protein 1 1
MIRT047712 TENM3 odz, odd Oz/ten-m homolog 3 (Drosophila) 1 1
MIRT047713 TUBA1A tubulin, alpha 1a 1 1
MIRT047714 LSS lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) 1 1
MIRT047715 FASN fatty acid synthase 1 1
MIRT047716 PSMD13 proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 1 1
MIRT047717 ZNF618 zinc finger protein 618 1 1
MIRT047718 TSPAN33 tetraspanin 33 1 1
MIRT047719 KANK1 KN motif and ankyrin repeat domains 1 1 1
MIRT047720 ADPRHL2 ADP-ribosylhydrolase like 2 1 1
MIRT047721 DPYSL2 dihydropyrimidinase-like 2 1 1
MIRT047722 SUPT6H suppressor of Ty 6 homolog (S. cerevisiae) 1 1
MIRT047723 B3GNT5 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 1 1
MIRT047724 ACTG1 actin, gamma 1 1 1
MIRT047725 PLSCR1 phospholipid scramblase 1 1 1
MIRT047726 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT047727 SFPQ splicing factor proline/glutamine-rich 1 1
MIRT047728 VDAC1 voltage-dependent anion channel 1 1 1
MIRT047729 ADCY9 adenylate cyclase 9 1 1
MIRT047730 OCRL oculocerebrorenal syndrome of Lowe 1 1
MIRT047731 ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 1 1
MIRT047732 SLC25A13 solute carrier family 25, member 13 (citrin) 1 1
MIRT047733 IGSF9B immunoglobulin superfamily, member 9B 1 1
MIRT047734 ESPL1 extra spindle pole bodies homolog 1 (S. cerevisiae) 1 1
MIRT047735 MCU coiled-coil domain containing 109A 1 1
MIRT047736 CDK8 cyclin-dependent kinase 8 1 1
MIRT047737 CEP128 chromosome 14 open reading frame 145 1 1
MIRT047738 TRAPPC12 tetratricopeptide repeat domain 15 1 1
MIRT047739 SYNJ1 synaptojanin 1 1 1
MIRT047740 NOB1 NIN1/RPN12 binding protein 1 homolog (S. cerevisiae) 1 1
MIRT047741 AP5S1 chromosome 20 open reading frame 29 1 1
MIRT047742 RNF213 ring finger protein 213 1 1
MIRT047743 PSMB1 proteasome (prosome, macropain) subunit, beta type, 1 1 1
MIRT047744 BCR breakpoint cluster region 1 1
MIRT047745 PABPC1 poly(A) binding protein, cytoplasmic 1 1 1
MIRT047746 NPTX1 neuronal pentraxin I 1 1
MIRT047747 PRRC2C HLA-B associated transcript 2-like 2 1 1
MIRT047748 PABPC3 poly(A) binding protein, cytoplasmic 3 1 1
MIRT047749 NF2 neurofibromin 2 (merlin) 1 1
MIRT047750 RALBP1 ralA binding protein 1 1 1
MIRT047751 EHD4 EH-domain containing 4 1 1
MIRT047752 RLIM ring finger protein, LIM domain interacting 1 1