Accession ID: MIRT048133 [miRNA, hsa-miR-197-3p :: LDHB, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-197LinkOut: [miRBase ]
Synonyms MIRN197, miR-197, miRNA197, MIR197
Description Homo sapiens miR-197 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-197-3p
Mature Sequence 48| UUCACCACCUUCUCCACCCAGC |69
Evidence Experimental
Experiments Cloned
Putative hsa-miR-197-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LDHB LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms LDH-B, LDH-H, LDHBD, TRG-5
Description lactate dehydrogenase B
Transcript NM_001174097    LinkOut: [ RefSeq ]
Other Transcripts NM_002300   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LDHB LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of LDHB
(miRNA target sites are highlighted)
>LDHB|NM_001174097|3'UTR
   1 CTAGTGAGCTCTAGGCTGTAGAAATTTAAAAACTACAATGTGATTAACTCGAGCCTTTAGTTTTCATCCATGTACATGGA
  81 TCACAGTTTGCTTTGATCTTCTTCAATATGTGAATTTGGGCTCACAGAATCAAAGCCTATGCTTGGTTTAATGCTTGCAA
 161 TCTGAGCTCTTGAACAAATAAAATTAACTATTGTAGTGTGC
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cgacccaccucuuccACCacuu 5'
                         |||    
Target 5' tttcatccatgtacaTGGatca 3'
62 - 83 60.00 -6.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-197-3p :: LDHB    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' cgACCCAC-CTCTTCCACCACtt 5'
            ||| || | |:| ||||||  
Target 5' tgTGGCTGTGTGGA-GTGGTGtg 3'
5 - 26
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
391 hsa-miR-197-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000215 TSPAN3 tetraspanin 3 4 2
MIRT000216 ACVR1 activin A receptor, type I 3 1
MIRT003818 PIPOX pipecolic acid oxidase 2 1
MIRT003819 RAD51 RAD51 homolog (S. cerevisiae) 2 1
MIRT003820 PEX13 peroxisomal biogenesis factor 13 2 1
MIRT003821 CPNE6 copine VI (neuronal) 2 1
MIRT003822 HNF4A hepatocyte nuclear factor 4, alpha 2 1
MIRT003823 WDR6 WD repeat domain 6 2 1
MIRT003824 ABCC3 ATP-binding cassette, sub-family C (CFTR/MRP), member 3 2 1
MIRT003825 USO1 USO1 vesicle docking protein homolog (yeast) 2 1
MIRT003826 ZNF302 zinc finger protein 302 2 1
MIRT003827 FBXW7 F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase 2 1
MIRT004146 CHIC2 cysteine-rich hydrophobic domain 2 2 1
MIRT004175 TAF4B TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa 2 1
MIRT004176 RXRB retinoid X receptor, beta 3 2
MIRT004177 HNRNPD heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) 2 1
MIRT004178 MMP23A matrix metallopeptidase 23A (pseudogene) 2 1
MIRT004179 CPSF1 cleavage and polyadenylation specific factor 1, 160kDa 2 1
MIRT004180 DPH1 DPH1 homolog (S. cerevisiae) 2 1
MIRT004181 RAB28 RAB28, member RAS oncogene family 2 1
MIRT004182 DCBLD2 discoidin, CUB and LCCL domain containing 2 2 1
MIRT004183 AGR2 anterior gradient 2 homolog (Xenopus laevis) 2 1
MIRT004184 MED16 mediator complex subunit 16 2 1
MIRT004185 HMGN1 high mobility group nucleosome binding domain 1 2 1
MIRT004186 CLIC1 chloride intracellular channel 1 2 1
MIRT004187 PRKD2 protein kinase D2 2 1
MIRT004188 ISYNA1 inositol-3-phosphate synthase 1 2 1
MIRT004189 KLC1 kinesin light chain 1 2 1
MIRT004190 TSPYL1 TSPY-like 1 2 1
MIRT004191 ATF6B activating transcription factor 6 beta 2 1
MIRT004192 ALMS1 Alstrom syndrome 1 2 1
MIRT004193 RBM4 RNA binding motif protein 4 2 1
MIRT004194 LRP4 low density lipoprotein receptor-related protein 4 3 2
MIRT004195 DPYSL3 dihydropyrimidinase-like 3 2 1
MIRT004196 FUS fused in sarcoma 2 1
MIRT004197 HPN hepsin 2 1
MIRT004198 FOXO3 forkhead box O3 2 1
MIRT004199 EHD2 EH-domain containing 2 2 1
MIRT004200 IER3 immediate early response 3 2 1
MIRT004201 SNX1 sorting nexin 1 2 1
MIRT004202 GOLGB1 golgin B1 2 1
MIRT004203 ZNF175 zinc finger protein 175 2 1
MIRT004204 IGF2-AS IGF2 antisense RNA 2 1
MIRT004205 PHF20 PHD finger protein 20 2 1
MIRT004206 CES1 carboxylesterase 1 1 1
MIRT004207 GORASP2 golgi reassembly stacking protein 2, 55kDa 2 1
MIRT004208 CDK10 cyclin-dependent kinase 10 2 1
MIRT004209 RFX1 regulatory factor X, 1 (influences HLA class II expression) 2 1
MIRT004210 GALT galactose-1-phosphate uridylyltransferase 2 1
MIRT004211 CYLD cylindromatosis (turban tumor syndrome) 2 1
MIRT004212 KLF10 Kruppel-like factor 10 2 1
MIRT004213 UMPS uridine monophosphate synthetase 2 1
MIRT004214 ZNF208 zinc finger protein 208 2 1
MIRT004215 NEK4 NIMA (never in mitosis gene a)-related kinase 4 2 1
MIRT004216 THEMIS2 thymocyte selection associated family member 2 2 1
MIRT004217 IL1R1 interleukin 1 receptor, type I 2 1
MIRT004218 PRKAR2A protein kinase, cAMP-dependent, regulatory, type II, alpha 2 1
MIRT004412 TUSC2 tumor suppressor candidate 2 3 2
MIRT007211 NSUN5 NOP2/Sun domain family, member 5 2 1
MIRT048047 ADIPOR1 adiponectin receptor 1 1 1
MIRT048048 GSTO1 glutathione S-transferase omega 1 1 1
MIRT048049 BCR breakpoint cluster region 1 1
MIRT048050 EIF4H eukaryotic translation initiation factor 4H 1 1
MIRT048051 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT048052 STMN3 stathmin-like 3 1 1
MIRT048053 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT048054 PPIA peptidylprolyl isomerase A (cyclophilin A) 1 1
MIRT048055 CBX5 chromobox homolog 5 1 1
MIRT048056 SOD1 superoxide dismutase 1, soluble 1 1
MIRT048057 PLCB3 phospholipase C, beta 3 (phosphatidylinositol-specific) 1 1
MIRT048058 NCL nucleolin 1 1
MIRT048059 ND6 NADH dehydrogenase, subunit 6 (complex I) 1 1
MIRT048060 SPG20 spastic paraplegia 20 (Troyer syndrome) 1 1
MIRT048061 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 1
MIRT048062 H2AFZ H2A histone family, member Z 1 1
MIRT048063 DNLZ DNL-type zinc finger 1 1
MIRT048064 ATP11A ATPase, class VI, type 11A 1 1
MIRT048065 MPP6 membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6) 1 1
MIRT048066 MSI1 musashi homolog 1 (Drosophila) 1 1
MIRT048067 NUS1 nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) 1 1
MIRT048068 DGCR8 DiGeorge syndrome critical region gene 8 1 1
MIRT048069 ACTG1 actin, gamma 1 1 1
MIRT048070 FASN fatty acid synthase 1 1
MIRT048071 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT048072 IARS2 isoleucyl-tRNA synthetase 2, mitochondrial 1 1
MIRT048073 JTB jumping translocation breakpoint 1 1
MIRT048074 OVCH2 ovochymase 2 (gene/pseudogene) 1 1
MIRT048075 HNRNPH1 heterogeneous nuclear ribonucleoprotein H1 (H) 1 1
MIRT048076 CEP152 centrosomal protein 152kDa 1 1
MIRT048077 STRN striatin, calmodulin binding protein 1 1
MIRT048078 STEAP2 STEAP family member 2, metalloreductase 1 1
MIRT048079 PPP2CA protein phosphatase 2, catalytic subunit, alpha isozyme 1 1
MIRT048080 CKS1B CDC28 protein kinase regulatory subunit 1B 1 1
MIRT048081 SETD1B SET domain containing 1B 1 1
MIRT048082 RBM15B RNA binding motif protein 15B 1 1
MIRT048083 MRPS16 mitochondrial ribosomal protein S16 1 1
MIRT048084 ZNF318 zinc finger protein 318 1 1
MIRT048085 MORC3 MORC family CW-type zinc finger 3 1 1
MIRT048086 FOXJ3 forkhead box J3 1 1
MIRT048087 C1orf115 chromosome 1 open reading frame 115 1 1
MIRT048088 PBX2 pre-B-cell leukemia homeobox 2 1 1
MIRT048089 WNK1 WNK lysine deficient protein kinase 1 1 1
MIRT048090 CHTOP chromatin target of PRMT1 1 1
MIRT048091 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT048092 TMX4 thioredoxin-related transmembrane protein 4 1 1
MIRT048093 CPT1A carnitine palmitoyltransferase 1A (liver) 1 1
MIRT048094 METTL4 methyltransferase like 4 1 1
MIRT048095 MCM7 minichromosome maintenance complex component 7 1 1
MIRT048096 RSRC2 arginine/serine-rich coiled-coil 2 1 1
MIRT048097 SUDS3 suppressor of defective silencing 3 homolog (S. cerevisiae) 1 1
MIRT048098 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT048099 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT048100 ACTL9 actin-like 9 1 1
MIRT048101 CCNG1 cyclin G1 1 1
MIRT048102 TCOF1 Treacher Collins-Franceschetti syndrome 1 1 1
MIRT048103 AK3 adenylate kinase 3 1 1
MIRT048104 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT048105 MAML1 mastermind-like 1 (Drosophila) 1 1
MIRT048106 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT048107 MORN2 MORN repeat containing 2 1 1
MIRT048108 ACVR1B activin A receptor, type IB 1 1
MIRT048109 ADAR adenosine deaminase, RNA-specific 1 1
MIRT048110 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT048111 RNFT2 ring finger protein, transmembrane 2 1 1
MIRT048112 MEGF9 multiple EGF-like-domains 9 1 1
MIRT048113 PDZRN3 PDZ domain containing ring finger 3 1 1
MIRT048114 GDF7 growth differentiation factor 7 1 1
MIRT048115 PTBP3 polypyrimidine tract binding protein 3 1 1
MIRT048116 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 1 1
MIRT048117 PLEKHG2 pleckstrin homology domain containing, family G (with RhoGef domain) member 2 1 2
MIRT048118 TRAP1 TNF receptor-associated protein 1 1 1
MIRT048119 RAD23B RAD23 homolog B (S. cerevisiae) 1 1
MIRT048120 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT048121 SH3BP2 SH3-domain binding protein 2 1 1
MIRT048122 RGS16 regulator of G-protein signaling 16 1 1
MIRT048123 ATP1A1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 1 1
MIRT048124 TTC8 tetratricopeptide repeat domain 8 1 1
MIRT048125 HSPA4 heat shock 70kDa protein 4 1 1
MIRT048126 MYH10 myosin, heavy chain 10, non-muscle 1 1
MIRT048127 PALD1 phosphatase domain containing, paladin 1 1 1
MIRT048128 RUVBL1 RuvB-like 1 (E. coli) 1 1
MIRT048129 MED24 mediator complex subunit 24 1 1
MIRT048130 MKRN1 makorin ring finger protein 1 1 1
MIRT048131 ZNF354A zinc finger protein 354A 1 1
MIRT048132 NME2 NME/NM23 nucleoside diphosphate kinase 2 1 1
MIRT048133 LDHB lactate dehydrogenase B 1 1
MIRT048134 DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 1 1
MIRT048135 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 1 1
MIRT048136 CCNA2 cyclin A2 1 1
MIRT048137 E2F4 E2F transcription factor 4, p107/p130-binding 1 1
MIRT048138 TSEN34 tRNA splicing endonuclease 34 homolog (S. cerevisiae) 1 1
MIRT048139 RPL7A ribosomal protein L7a 1 1
MIRT048140 FKBP4 FK506 binding protein 4, 59kDa 1 1
MIRT048141 INTS4 integrator complex subunit 4 1 1
MIRT048142 HSPD1 heat shock 60kDa protein 1 (chaperonin) 1 1
MIRT048143 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT048144 TRAPPC1 trafficking protein particle complex 1 1 1
MIRT048145 RPL13A ribosomal protein L13a 1 1
MIRT048146 RPL22 ribosomal protein L22 1 1
MIRT048147 COL4A6 collagen, type IV, alpha 6 1 1
MIRT048148 NOA1 nitric oxide associated 1 1 1
MIRT048149 VDAC1 voltage-dependent anion channel 1 1 1
MIRT054556 IL18 interleukin 18 (interferon-gamma-inducing factor) 2 1
MIRT054634 CD82 CD82 molecule 3 1
MIRT347172 SLC35E1 solute carrier family 35, member E1 1 1
MIRT438409 BMF Bcl2 modifying factor 2 1
MIRT438410 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 3 4
MIRT438747 MTHFD1 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase 3 1
MIRT443945 LRIT3 leucine-rich repeat, immunoglobulin-like and transmembrane domains 3 1 1
MIRT459161 HSPA6 heat shock 70kDa protein 6 (HSP70B') 1 10
MIRT462979 ZNF784 zinc finger protein 784 1 3
MIRT493839 FOXN3 forkhead box N3 1 2
MIRT495178 SOX11 SRY (sex determining region Y)-box 11 1 3
MIRT495259 MYOZ3 myozenin 3 1 1
MIRT495467 ALDOA aldolase A, fructose-bisphosphate 1 1
MIRT496725 NKD2 naked cuticle homolog 2 (Drosophila) 1 1
MIRT497174 ZBTB40 zinc finger and BTB domain containing 40 1 1
MIRT498666 SOD2 superoxide dismutase 2, mitochondrial 1 2
MIRT499753 CIRH1A cirrhosis, autosomal recessive 1A (cirhin) 1 5
MIRT503974 SSC5D scavenger receptor cysteine rich domain containing (5 domains) 1 3
MIRT505373 TMEM154 transmembrane protein 154 1 2
MIRT510583 UBA2 ubiquitin-like modifier activating enzyme 2 1 1
MIRT514193 PGPEP1 pyroglutamyl-peptidase I 1 1
MIRT514390 CLUAP1 clusterin associated protein 1 1 1
MIRT514517 SHISA9 shisa homolog 9 (Xenopus laevis) 1 1
MIRT514777 RBM4B RNA binding motif protein 4B 1 1
MIRT514855 PTPLAD2 protein tyrosine phosphatase-like A domain containing 2 1 2
MIRT515113 LMOD3 leiomodin 3 (fetal) 1 1
MIRT515230 CEP19 centrosomal protein 19kDa 1 1
MIRT515266 CSNK1E casein kinase 1, epsilon 1 1
MIRT515339 CXorf36 chromosome X open reading frame 36 1 1
MIRT515588 FBXL13 F-box and leucine-rich repeat protein 13 1 2
MIRT515899 AGTPBP1 ATP/GTP binding protein 1 1 1
MIRT515946 C9orf156 chromosome 9 open reading frame 156 1 1
MIRT515999 GPN2 GPN-loop GTPase 2 1 1
MIRT516230 RAB3B RAB3B, member RAS oncogene family 1 2
MIRT516282 DBT dihydrolipoamide branched chain transacylase E2 1 1
MIRT516740 GSTK1 glutathione S-transferase kappa 1 1 1
MIRT517202 OTUD6A OTU domain containing 6A 1 1
MIRT517673 TRIM72 tripartite motif containing 72 1 1
MIRT517959 ZMIZ2 zinc finger, MIZ-type containing 2 1 2
MIRT518166 FGB fibrinogen beta chain 1 1
MIRT518546 ABCA6 ATP-binding cassette, sub-family A (ABC1), member 6 1 1
MIRT518573 ATP8B1 ATPase, aminophospholipid transporter, class I, type 8B, member 1 1 1
MIRT519079 ZFR2 zinc finger RNA binding protein 2 1 1
MIRT519090 SLC4A1 solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group) 1 1
MIRT519104 ALG1 asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT519394 DNASE2 deoxyribonuclease II, lysosomal 1 2
MIRT519442 GLA galactosidase, alpha 1 1
MIRT519481 PNPLA3 patatin-like phospholipase domain containing 3 1 1
MIRT519706 ZNF584 zinc finger protein 584 1 2
MIRT520456 TRPV2 transient receptor potential cation channel, subfamily V, member 2 1 2
MIRT521246 SAMD8 sterile alpha motif domain containing 8 1 1
MIRT521402 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 1 1
MIRT521512 QSOX1 quiescin Q6 sulfhydryl oxidase 1 1 1
MIRT521940 PHC3 polyhomeotic homolog 3 (Drosophila) 1 2
MIRT521958 PHAX phosphorylated adaptor for RNA export 1 3
MIRT522068 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT522106 NUDT3 nudix (nucleoside diphosphate linked moiety X)-type motif 3 1 1
MIRT522368 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT522645 MANEAL mannosidase, endo-alpha-like 1 1
MIRT522711 LRRC58 leucine rich repeat containing 58 1 3
MIRT523503 GMPS guanine monphosphate synthetase 1 2
MIRT524127 DMXL1 Dmx-like 1 1 1
MIRT524197 DDX19B DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B 1 1
MIRT524683 C12orf49 chromosome 12 open reading frame 49 1 2
MIRT526352 LRPAP1 low density lipoprotein receptor-related protein associated protein 1 1 1
MIRT527420 NRL neural retina leucine zipper 1 1
MIRT527754 RRAD Ras-related associated with diabetes 1 1
MIRT529380 SKP1 S-phase kinase-associated protein 1 1 1
MIRT529939 SYNGR1 synaptogyrin 1 1 1
MIRT530199 ALX1 ALX homeobox 1 1 2
MIRT530714 ORMDL3 ORM1-like 3 (S. cerevisiae) 1 1
MIRT530932 TERT telomerase reverse transcriptase 1 2
MIRT530945 CMBL carboxymethylenebutenolidase homolog (Pseudomonas) 1 1
MIRT531296 GPR26 G protein-coupled receptor 26 1 1
MIRT532475 HOXA13 homeobox A13 1 1
MIRT533089 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 1
MIRT533659 TMF1 TATA element modulatory factor 1 1 1
MIRT533976 TADA2A transcriptional adaptor 2A 1 1
MIRT534645 RNF222 ring finger protein 222 1 1
MIRT534746 RAVER2 ribonucleoprotein, PTB-binding 2 1 2
MIRT540167 MB21D1 Mab-21 domain containing 1 1 1
MIRT540527 ZNF417 zinc finger protein 417 1 2
MIRT541720 TFDP2 transcription factor Dp-2 (E2F dimerization partner 2) 1 2
MIRT549546 CLPP ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) 1 1
MIRT551723 PCYT1A phosphate cytidylyltransferase 1, choline, alpha 1 1
MIRT553953 SS18 synovial sarcoma translocation, chromosome 18 1 1
MIRT563536 RBM41 RNA binding motif protein 41 1 1
MIRT569902 HIPK3 homeodomain interacting protein kinase 3 1 1
MIRT573395 DLC1 deleted in liver cancer 1 1 1
MIRT607958 SNX22 sorting nexin 22 1 1
MIRT608093 CRISPLD2 cysteine-rich secretory protein LCCL domain containing 2 1 1
MIRT610980 GNA14 guanine nucleotide binding protein (G protein), alpha 14 1 1
MIRT611133 GGT7 gamma-glutamyltransferase 7 1 1
MIRT617281 GTF2H3 general transcription factor IIH, polypeptide 3, 34kDa 1 1
MIRT617801 ZNF793 zinc finger protein 793 1 1
MIRT618305 GNE glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase 1 1
MIRT618332 ZNF813 zinc finger protein 813 1 1
MIRT618351 CDKL1 cyclin-dependent kinase-like 1 (CDC2-related kinase) 1 1
MIRT618450 SERPINA3 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 1 1
MIRT619157 PPDPF pancreatic progenitor cell differentiation and proliferation factor homolog (zebrafish) 1 1
MIRT619532 ZNF708 zinc finger protein 708 1 1
MIRT619707 C6orf132 chromosome 6 open reading frame 132 1 1
MIRT619851 KIR3DX1 killer cell immunoglobulin-like receptor, three domains, X1 1 1
MIRT619956 CLN8 ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation) 1 1
MIRT620106 HARBI1 harbinger transposase derived 1 1 1
MIRT620787 FAM46B family with sequence similarity 46, member B 1 1
MIRT620830 ZNF551 zinc finger protein 551 1 1
MIRT621315 YIPF4 Yip1 domain family, member 4 1 1
MIRT621368 ART4 ADP-ribosyltransferase 4 (Dombrock blood group) 1 1
MIRT621551 ZMYM1 zinc finger, MYM-type 1 1 1
MIRT621885 TAOK1 TAO kinase 1 1 1
MIRT622549 PTPRT protein tyrosine phosphatase, receptor type, T 1 1
MIRT623406 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT623588 IPO9 importin 9 1 1
MIRT624056 EIF4E eukaryotic translation initiation factor 4E 1 1
MIRT624087 DPP8 dipeptidyl-peptidase 8 1 1
MIRT626302 ZNF274 zinc finger protein 274 1 1
MIRT629134 CTCFL CCCTC-binding factor (zinc finger protein)-like 1 1
MIRT630879 COL22A1 collagen, type XXII, alpha 1 1 1
MIRT631090 UQCRB ubiquinol-cytochrome c reductase binding protein 1 1
MIRT631527 MYO6 myosin VI 1 1
MIRT632244 VPS41 vacuolar protein sorting 41 homolog (S. cerevisiae) 1 1
MIRT632775 LZIC leucine zipper and CTNNBIP1 domain containing 1 1
MIRT634063 PLIN3 perilipin 3 1 1
MIRT634243 TIAL1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 1 1
MIRT634663 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT636096 ZDHHC22 zinc finger, DHHC-type containing 22 1 1
MIRT637443 ZNF324B zinc finger protein 324B 1 1
MIRT639236 RANGAP1 Ran GTPase activating protein 1 1 1
MIRT640462 CLEC17A C-type lectin domain family 17, member A 1 1
MIRT640499 ANTXR1 anthrax toxin receptor 1 1 1
MIRT641680 IGFBP5 insulin-like growth factor binding protein 5 1 1
MIRT642262 ZNF677 zinc finger protein 677 1 1
MIRT642308 FPR1 formyl peptide receptor 1 1 1
MIRT643333 MICA MHC class I polypeptide-related sequence A 1 1
MIRT643695 KIAA0586 KIAA0586 1 1
MIRT644637 ICA1L islet cell autoantigen 1,69kDa-like 1 1
MIRT645732 POLR3A polymerase (RNA) III (DNA directed) polypeptide A, 155kDa 1 1
MIRT646966 CYP2W1 cytochrome P450, family 2, subfamily W, polypeptide 1 1 1
MIRT647386 ZNF616 zinc finger protein 616 1 1
MIRT647852 LYPLA1 lysophospholipase I 1 1
MIRT648173 TMEM192 transmembrane protein 192 1 1
MIRT648413 KIAA0146 KIAA0146 1 1
MIRT648593 ZYG11B zyg-11 homolog B (C. elegans) 1 1
MIRT648617 CYB561A3 cytochrome b, ascorbate dependent 3 1 1
MIRT649838 LIPG lipase, endothelial 1 1
MIRT650359 RRP36 ribosomal RNA processing 36 homolog (S. cerevisiae) 1 1
MIRT651148 ZNF384 zinc finger protein 384 1 1
MIRT651784 UTP6 UTP6, small subunit (SSU) processome component, homolog (yeast) 1 1
MIRT651905 UEVLD UEV and lactate/malate dehyrogenase domains 1 1
MIRT651926 UBN2 ubinuclein 2 1 1
MIRT652077 TSPAN14 tetraspanin 14 1 1
MIRT654343 RBM27 RNA binding motif protein 27 1 1
MIRT655841 NGDN neuroguidin, EIF4E binding protein 1 1
MIRT656109 MSRB3 methionine sulfoxide reductase B3 1 1
MIRT656900 KIAA1958 KIAA1958 1 1
MIRT657325 HNRNPR heterogeneous nuclear ribonucleoprotein R 1 1
MIRT657755 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT657955 GAPVD1 GTPase activating protein and VPS9 domains 1 1 1
MIRT658365 FAM63B family with sequence similarity 63, member B 1 1
MIRT659111 DENND6A DENN/MADD domain containing 6A 1 1
MIRT659661 CDC73 cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT661921 MLN motilin 1 1
MIRT663037 GSTM5 glutathione S-transferase mu 5 1 1
MIRT663257 ATP1A2 ATPase, Na+/K+ transporting, alpha 2 polypeptide 1 1
MIRT663584 C10orf32 chromosome 10 open reading frame 32 1 1
MIRT664627 WDPCP WD repeat containing planar cell polarity effector 1 2
MIRT666189 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 1 1
MIRT667019 PDF peptide deformylase (mitochondrial) 1 1
MIRT669753 ZNF101 zinc finger protein 101 1 2
MIRT669794 GAN gigaxonin 1 1
MIRT670000 GPR156 G protein-coupled receptor 156 1 2
MIRT670455 RSBN1L round spermatid basic protein 1-like 1 1
MIRT670860 IFNAR1 interferon (alpha, beta and omega) receptor 1 1 2
MIRT671057 KIF1B kinesin family member 1B 1 1
MIRT671952 SPPL3 signal peptide peptidase like 3 1 1
MIRT673647 CYCS cytochrome c, somatic 1 1
MIRT674050 ATXN3 ataxin 3 1 1
MIRT674420 IPP intracisternal A particle-promoted polypeptide 1 1
MIRT674431 MIOX myo-inositol oxygenase 1 2
MIRT674442 PURB purine-rich element binding protein B 1 1
MIRT674985 ATP5G1 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9) 1 1
MIRT675042 BACE2 beta-site APP-cleaving enzyme 2 1 2
MIRT675311 C2orf68 chromosome 2 open reading frame 68 1 1
MIRT675465 NUBPL nucleotide binding protein-like 1 1
MIRT675643 TTPAL tocopherol (alpha) transfer protein-like 1 1
MIRT677225 SHE Src homology 2 domain containing E 1 1
MIRT682714 KIAA1456 KIAA1456 1 1
MIRT686726 TANGO2 chromosome 22 open reading frame 25 1 1
MIRT689082 ADNP2 ADNP homeobox 2 1 1
MIRT689613 AKAP6 A kinase (PRKA) anchor protein 6 1 1
MIRT690028 CCDC90B coiled-coil domain containing 90B 1 1
MIRT691720 LARS leucyl-tRNA synthetase 1 1
MIRT692294 CNNM3 cyclin M3 1 1
MIRT693253 HBS1L HBS1-like (S. cerevisiae) 1 1
MIRT693860 IYD iodotyrosine deiodinase 1 1
MIRT693972 ZNF70 zinc finger protein 70 1 1
MIRT695480 TRAT1 T cell receptor associated transmembrane adaptor 1 1 1
MIRT695539 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT695885 CACNG8 calcium channel, voltage-dependent, gamma subunit 8 1 1
MIRT696016 TYRO3 TYRO3 protein tyrosine kinase 1 1
MIRT696282 IER3IP1 immediate early response 3 interacting protein 1 1 1
MIRT696590 ORMDL2 ORM1-like 2 (S. cerevisiae) 1 1
MIRT698135 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT698733 STX12 syntaxin 12 1 1
MIRT698928 SPATA2 spermatogenesis associated 2 1 1
MIRT702565 JARID2 jumonji, AT rich interactive domain 2 1 1
MIRT703012 HEATR5A HEAT repeat containing 5A 1 1
MIRT704555 CNBP CCHC-type zinc finger, nucleic acid binding protein 1 1
MIRT704707 CHEK1 checkpoint kinase 1 1 1
MIRT705115 C4orf29 chromosome 4 open reading frame 29 1 1
MIRT708855 TMSB4X thymosin beta 4, X-linked 1 1
MIRT709062 FGD4 FYVE, RhoGEF and PH domain containing 4 1 1
MIRT709857 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT710096 KPNA5 karyopherin alpha 5 (importin alpha 6) 1 1
MIRT711442 FRMPD3 FERM and PDZ domain containing 3 1 1
MIRT713278 LAIR1 leukocyte-associated immunoglobulin-like receptor 1 1 1
MIRT717079 IDH3B isocitrate dehydrogenase 3 (NAD+) beta 1 1
MIRT717963 ZFAND4 zinc finger, AN1-type domain 4 1 1
MIRT718638 NKPD1 NTPase, KAP family P-loop domain containing 1 1 1
MIRT719193 CASP10 caspase 10, apoptosis-related cysteine peptidase 1 1
MIRT720445 SLC16A5 solute carrier family 16, member 5 (monocarboxylic acid transporter 6) 1 1
MIRT720457 RAB31 RAB31, member RAS oncogene family 1 1
MIRT721079 FTSJ2 FtsJ RNA methyltransferase homolog 2 (E. coli) 1 1
MIRT721416 SEC24A SEC24 family, member A (S. cerevisiae) 1 1
MIRT721859 CENPJ centromere protein J 1 1
MIRT722285 PMPCA peptidase (mitochondrial processing) alpha 1 1
MIRT722938 NHP2L1 NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) 1 1
MIRT724624 CHSY1 chondroitin sulfate synthase 1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*