Accession ID: MIRT048593 [miRNA, hsa-miR-100-5p :: EWSR1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-100LinkOut: [miRBase ]
Synonyms MIRN100, miR-100, MIR100
Description Homo sapiens miR-100 stem-loop
Comment This sequence is localised to chromosome 11 and was named mir-100-11 in reference .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-100-5p
Mature Sequence 13| AACCCGUAGAUCCGAACUUGUG |34
Evidence Experimental
Experiments Cloned
Putative hsa-miR-100-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol EWSR1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms EWS, bK984G1.4
Description Ewing sarcoma breakpoint region 1
Transcript NM_0011632    LinkOut: [ RefSeq ]
Other Transcripts NM_0011632 , NM_0011632 , NM_0052 , NM_0139   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on EWSR1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of EWSR1
(miRNA target sites are highlighted)
>EWSR1|NM_0011632|3'UTR
   1 TAGATGCAGAGACCCCGCAGAGCTGCATTGACTACCAGATTTATTTTTTAAACCAGAAAATGTTTTAAATTTATAATTCC
  81 ATATTTATAATGTTGGCCACAACATTATGATTATTCCTTGTCTGTACTTTAGTATTTTTCACCATTTGTGAAGAAACATT
 161 AAAACAAGTTAAATGGTAGTGTGCGGAGTTTTTTTTTCTTCCTTCTTTTAAAAATGGTTGTTTAAGACTTTAACAATGGG
 241 AACCCCTTGTGAGCATGCTCAGTATCATTGTGGAGAACCAAGAGGGCCTCTTAACTGTAACAATGTTCATGGTTGTGATG
 321 TTTTTTTTTTTTTTTTAAATAAAATTCCAAATGTTTATAAAGAGTCAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-100-5p :: EWSR1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
229 hsa-miR-100-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000382 PLK1 polo-like kinase 1 (Drosophila) 4 3
MIRT003417 EGR2 early growth response 2 3 1
MIRT003418 ID1 inhibitor of DNA binding 1, dominant negative helix-loop-helix protein 3 1
MIRT003419 FGFR3 fibroblast growth factor receptor 3 5 2
MIRT003420 MMP13 matrix metallopeptidase 13 (collagenase 3) 4 1
MIRT005913 ATM ataxia telangiectasia mutated 3 1
MIRT006429 IGF1R insulin-like growth factor 1 receptor 4 3
MIRT006723 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 3 1
MIRT006765 CTDSPL CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like 3 1
MIRT006850 FLT1 fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor) 1 1
MIRT007365 MTOR mechanistic target of rapamycin (serine/threonine kinase) 4 2
MIRT027392 RPTOR regulatory associated protein of MTOR, complex 1 1 1
MIRT048384 FOXN2 forkhead box N2 1 1
MIRT048385 SREK1IP1 SFRS12-interacting protein 1 1 1
MIRT048386 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 1
MIRT048387 RPL5 ribosomal protein L5 1 1
MIRT048388 MAP7D1 MAP7 domain containing 1 1 1
MIRT048389 NOP2 NOP2 nucleolar protein homolog (yeast) 1 1
MIRT048390 CCNG1 cyclin G1 1 1
MIRT048391 SMAD7 SMAD family member 7 1 1
MIRT048392 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT048393 UBE2E3 ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) 1 1
MIRT048394 LIX1L Lix1 homolog (mouse)-like 1 1
MIRT048395 GNA13 guanine nucleotide binding protein (G protein), alpha 13 1 1
MIRT048396 RLIM ring finger protein, LIM domain interacting 1 1
MIRT048397 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT048398 KPNA2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1 1
MIRT048399 HIST2H2AA3 histone cluster 2, H2aa3 1 1
MIRT048400 YTHDC1 YTH domain containing 1 1 1
MIRT048401 ZNF511 zinc finger protein 511 1 1
MIRT048402 BAZ1B bromodomain adjacent to zinc finger domain, 1B 1 1
MIRT048403 UBA2 ubiquitin-like modifier activating enzyme 2 1 1
MIRT048404 FOXP1 forkhead box P1 1 1
MIRT048405 APEX1 APEX nuclease (multifunctional DNA repair enzyme) 1 1 1
MIRT048406 CUL2 cullin 2 1 1
MIRT048407 CCNYL1 cyclin Y-like 1 1 1
MIRT048408 ORC2 origin recognition complex, subunit 2-like (yeast) 1 1
MIRT048409 PANK3 pantothenate kinase 3 1 1
MIRT048410 MAPK1IP1L mitogen-activated protein kinase 1 interacting protein 1-like 1 1
MIRT048411 MRPS33 mitochondrial ribosomal protein S33 1 1
MIRT048412 IARS isoleucyl-tRNA synthetase 1 1
MIRT048413 RHPN2 rhophilin, Rho GTPase binding protein 2 1 1
MIRT048414 CBX3 chromobox homolog 3 (HP1 gamma homolog, Drosophila) 1 1
MIRT048415 NDUFC2 NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa 1 1
MIRT048416 TSC22D1 TSC22 domain family, member 1 1 1
MIRT048417 H3F3A H3 histone, family 3A 1 1
MIRT048418 FBXL15 F-box and leucine-rich repeat protein 15 1 1
MIRT048419 PFN2 profilin 2 1 1
MIRT048420 MKLN1 muskelin 1, intracellular mediator containing kelch motifs 1 1
MIRT048421 MITD1 MIT, microtubule interacting and transport, domain containing 1 1 1
MIRT048422 RPS8 ribosomal protein S8 1 1
MIRT048423 SLC17A8 solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8 1 1
MIRT048424 NSF N-ethylmaleimide-sensitive factor 1 1
MIRT048425 PRRC2C HLA-B associated transcript 2-like 2 1 1
MIRT048426 BCL10 B-cell CLL/lymphoma 10 1 1
MIRT048427 QSER1 glutamine and serine rich 1 1 1
MIRT048428 FAM221A chromosome 7 open reading frame 46 1 1
MIRT048429 RAB33B RAB33B, member RAS oncogene family 1 1
MIRT048430 DCAF6 DDB1 and CUL4 associated factor 6 1 1
MIRT048431 RARS arginyl-tRNA synthetase 1 1
MIRT048432 KATNBL1 chromosome 15 open reading frame 29 1 1
MIRT048433 CYTB cytochrome b 1 1
MIRT048434 ATAT1 chromosome 6 open reading frame 134 1 1
MIRT048435 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT048436 N4BP2 NEDD4 binding protein 2 1 1
MIRT048437 RPL39L ribosomal protein L39-like 1 1
MIRT048438 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 1
MIRT048439 PSMA2 proteasome (prosome, macropain) subunit, alpha type, 2 1 1
MIRT048440 MAP4 microtubule-associated protein 4 1 1
MIRT048441 UBN2 ubinuclein 2 1 1
MIRT048442 TAPBP TAP binding protein (tapasin) 1 1
MIRT048443 EDEM1 ER degradation enhancer, mannosidase alpha-like 1 1 1
MIRT048444 ALG3 asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT048445 FXN frataxin 1 1
MIRT048446 TEX264 testis expressed 264 1 1
MIRT048447 TCP1 t-complex 1 1 1
MIRT048448 NDE1 nudE nuclear distribution gene E homolog 1 (A. nidulans) 1 1
MIRT048449 NFIA nuclear factor I/A 1 1
MIRT048450 RPL36A ribosomal protein L36a 1 1
MIRT048451 GNG5 guanine nucleotide binding protein (G protein), gamma 5 1 1
MIRT048452 RIOK2 RIO kinase 2 (yeast) 1 1
MIRT048453 H2AFV H2A histone family, member V 1 1
MIRT048454 S100A10 S100 calcium binding protein A10 1 1
MIRT048455 ACSL3 acyl-CoA synthetase long-chain family member 3 1 1
MIRT048456 DAZAP2 DAZ associated protein 2 1 1
MIRT048457 PCBP2 poly(rC) binding protein 2 1 1
MIRT048458 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT048459 C21orf91 chromosome 21 open reading frame 91 1 1
MIRT048460 SLMO2 slowmo homolog 2 (Drosophila) 1 1
MIRT048461 PTPN9 protein tyrosine phosphatase, non-receptor type 9 1 1
MIRT048462 AP3M1 adaptor-related protein complex 3, mu 1 subunit 1 1
MIRT048463 DDAH1 dimethylarginine dimethylaminohydrolase 1 1 1
MIRT048464 HSPA14 heat shock 70kDa protein 14 1 1
MIRT048465 RPS27 ribosomal protein S27 1 1
MIRT048466 UNC50 unc-50 homolog (C. elegans) 1 1
MIRT048467 SEPT10 septin 10 1 1
MIRT048468 USP1 ubiquitin specific peptidase 1 1 1
MIRT048469 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT048470 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT048471 XRCC5 X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining) 1 1
MIRT048472 SNRNP27 small nuclear ribonucleoprotein 27kDa (U4/U6.U5) 1 1
MIRT048473 CAPNS1 calpain, small subunit 1 1 1
MIRT048474 OXCT1 3-oxoacid CoA transferase 1 1 1
MIRT048475 QKI quaking homolog, KH domain RNA binding (mouse) 1 1
MIRT048476 MORF4L2 mortality factor 4 like 2 1 1
MIRT048477 VCP valosin-containing protein 1 1
MIRT048478 H2AFY H2A histone family, member Y 1 1
MIRT048479 ALDH9A1 aldehyde dehydrogenase 9 family, member A1 1 1
MIRT048480 OXA1L oxidase (cytochrome c) assembly 1-like 1 1
MIRT048481 SGTB small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta 1 1
MIRT048482 ANAPC11 anaphase promoting complex subunit 11 1 1
MIRT048483 PSMG2 proteasome (prosome, macropain) assembly chaperone 2 1 1
MIRT048484 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT048485 INSIG1 insulin induced gene 1 1 1
MIRT048486 SNX4 sorting nexin 4 1 1
MIRT048487 ATP1B3 ATPase, Na+/K+ transporting, beta 3 polypeptide 1 1
MIRT048488 SAP30L SAP30-like 1 1
MIRT048489 DPY19L4 dpy-19-like 4 (C. elegans) 1 1
MIRT048490 RPL7A ribosomal protein L7a 1 1
MIRT048491 RPL19 ribosomal protein L19 1 1
MIRT048492 NDUFA9 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa 1 1
MIRT048493 CTDSPL2 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 1 1
MIRT048494 GFOD1 glucose-fructose oxidoreductase domain containing 1 1 1
MIRT048495 GRB2 growth factor receptor-bound protein 2 1 1
MIRT048496 GTF2H1 general transcription factor IIH, polypeptide 1, 62kDa 1 1
MIRT048497 RRM2 ribonucleotide reductase M2 1 1
MIRT048498 ATP6AP1L ATPase, H+ transporting, lysosomal accessory protein 1-like 1 1
MIRT048499 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT048500 SMG1 SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) 1 1
MIRT048501 ITM2B integral membrane protein 2B 1 1
MIRT048502 PSMA5 proteasome (prosome, macropain) subunit, alpha type, 5 1 1
MIRT048503 MAFG v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) 1 1
MIRT048504 DNMT1 DNA (cytosine-5-)-methyltransferase 1 1 1
MIRT048505 UBQLN1 ubiquilin 1 1 1
MIRT048506 CUL1 cullin 1 1 1
MIRT048507 SEPSECS Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase 1 1
MIRT048508 COX5A cytochrome c oxidase subunit Va 1 1
MIRT048509 PCBP1 poly(rC) binding protein 1 1 1
MIRT048510 ARPP19 cAMP-regulated phosphoprotein, 19kDa 1 1
MIRT048511 RPL15 ribosomal protein L15 1 1
MIRT048512 UBB ubiquitin B 1 1
MIRT048513 RPL10A ribosomal protein L10a 1 1
MIRT048514 RPL26 ribosomal protein L26 1 1
MIRT048515 CIRH1A cirrhosis, autosomal recessive 1A (cirhin) 1 1
MIRT048516 LRRC41 leucine rich repeat containing 41 1 1
MIRT048517 APBA3 amyloid beta (A4) precursor protein-binding, family A, member 3 1 1
MIRT048518 HMGN1 high-mobility group nucleosome binding domain 1 1 1
MIRT048519 VPS45 vacuolar protein sorting 45 homolog (S. cerevisiae) 1 1
MIRT048520 TMED4 transmembrane emp24 protein transport domain containing 4 1 1
MIRT048521 WDR4 WD repeat domain 4 1 1
MIRT048522 ACTB actin, beta 1 1
MIRT048523 ORMDL1 ORM1-like 1 (S. cerevisiae) 1 1
MIRT048524 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT048525 EIF5A eukaryotic translation initiation factor 5A 1 1
MIRT048526 EIF5AL1 eukaryotic translation initiation factor 5A-like 1 1 1
MIRT048527 SET SET nuclear oncogene 1 1
MIRT048528 DEAF1 deformed epidermal autoregulatory factor 1 (Drosophila) 1 1
MIRT048529 MED12 mediator complex subunit 12 1 1
MIRT048530 ATP5L ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G 1 1
MIRT048531 TERF2IP telomeric repeat binding factor 2, interacting protein 1 1
MIRT048532 ABLIM1 actin binding LIM protein 1 1 1
MIRT048533 CCZ1B chromosome 7 open reading frame 28B 1 1
MIRT048534 SRD5A3 steroid 5 alpha-reductase 3 1 1
MIRT048535 PRDX1 peroxiredoxin 1 1 1
MIRT048536 NUDCD2 NudC domain containing 2 1 1
MIRT048537 GTPBP1 GTP binding protein 1 1 1
MIRT048538 ANAPC1 anaphase promoting complex subunit 1 1 1
MIRT048539 NTAN1 N-terminal asparagine amidase 1 1
MIRT048540 PNRC1 proline-rich nuclear receptor coactivator 1 1 1
MIRT048541 CAMKK2 calcium/calmodulin-dependent protein kinase kinase 2, beta 1 1
MIRT048542 DOLK dolichol kinase 1 1
MIRT048543 RPLP1 ribosomal protein, large, P1 1 1
MIRT048544 LIN28B lin-28 homolog B (C. elegans) 1 1
MIRT048545 CDC73 cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT048546 PIKFYVE phosphoinositide kinase, FYVE finger containing 1 1
MIRT048547 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT048548 SAT1 spermidine/spermine N1-acetyltransferase 1 1 1
MIRT048549 PTPLAD1 protein tyrosine phosphatase-like A domain containing 1 1 1
MIRT048550 RAB5C RAB5C, member RAS oncogene family 1 1
MIRT048551 ORC5 origin recognition complex, subunit 5-like (yeast) 1 1
MIRT048552 LDHB lactate dehydrogenase B 1 1
MIRT048553 BECN1 beclin 1, autophagy related 1 1
MIRT048554 KDELR2 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 1 1
MIRT048555 HIST2H4B histone cluster 2, H4b 1 1
MIRT048556 RCN2 reticulocalbin 2, EF-hand calcium binding domain 1 1
MIRT048557 ACTR1B ARP1 actin-related protein 1 homolog B, centractin beta (yeast) 1 1
MIRT048558 CREBBP CREB binding protein 1 1
MIRT048559 NLRP3 NLR family, pyrin domain containing 3 1 1
MIRT048560 MBIP MAP3K12 binding inhibitory protein 1 1 1
MIRT048561 YBX3 cold shock domain protein A 1 1
MIRT048562 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT048563 RPL21 ribosomal protein L21 1 1
MIRT048564 UBXN2B UBX domain protein 2B 1 1
MIRT048565 C9orf66 chromosome 9 open reading frame 66 1 1
MIRT048566 HIST1H4C histone cluster 1, H4c 1 1
MIRT048567 SOGA1 chromosome 20 open reading frame 117 1 1
MIRT048568 RPS15A ribosomal protein S15a 1 1
MIRT048569 HMGB1 high-mobility group box 1 1 1
MIRT048570 RPL7 ribosomal protein L7 1 1
MIRT048571 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT048572 JPH1 junctophilin 1 1 1
MIRT048573 MARC1 MOCO sulphurase C-terminal domain containing 1 1 1
MIRT048574 CUL5 cullin 5 1 1
MIRT048575 DCBLD1 discoidin, CUB and LCCL domain containing 1 1 1
MIRT048576 AGPAT3 1-acylglycerol-3-phosphate O-acyltransferase 3 1 1
MIRT048577 FARSB phenylalanyl-tRNA synthetase, beta subunit 1 1
MIRT048578 NDUFA2 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa 1 1
MIRT048579 RPL10 ribosomal protein L10 1 1
MIRT048580 RPL31 ribosomal protein L31 1 1
MIRT048581 DDX21 DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 1 1
MIRT048582 RPL14 ribosomal protein L14 1 1
MIRT048583 XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6 1 1
MIRT048584 COL4A1 collagen, type IV, alpha 1 1 1
MIRT048585 PATZ1 POZ (BTB) and AT hook containing zinc finger 1 1 1
MIRT048586 RB1 retinoblastoma 1 1 1
MIRT048587 PAPSS1 3'-phosphoadenosine 5'-phosphosulfate synthase 1 1 1
MIRT048588 PAFAH1B1 platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa) 1 1
MIRT048589 RPL7L1 ribosomal protein L7-like 1 1 1
MIRT048590 RPS15 ribosomal protein S15 1 1
MIRT048591 NIP7 nuclear import 7 homolog (S. cerevisiae) 1 1
MIRT048592 CTC1 chromosome 17 open reading frame 68 1 1
MIRT048593 EWSR1 Ewing sarcoma breakpoint region 1 1 1
MIRT048594 MTO1 mitochondrial translation optimization 1 homolog (S. cerevisiae) 1 1
MIRT048595 ATP1A2 ATPase, Na+/K+ transporting, alpha 2 polypeptide 1 1
MIRT048596 COX2 cytochrome c oxidase subunit II 1 1
MIRT048597 KANK1 KN motif and ankyrin repeat domains 1 1 1
MIRT048598 RAD51C RAD51 homolog C (S. cerevisiae) 1 1
MIRT048599 WTIP Wilms tumor 1 interacting protein 1 1
MIRT048600 ODC1 ornithine decarboxylase 1 1 1