Accession ID: MIRT050033 [miRNA, hsa-miR-27a-3p :: ATP7B, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-27aLinkOut: [miRBase ]
Description Homo sapiens miR-27a stem-loop
Comment This miRNA was previously named miR-27 but is renamed here to avoid confusion with the more recently described miR-27b (MIR:MI0000440).
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-27a-3p
Mature Sequence 51| UUCACAGUGGCUAAGUUCCGC |71
Evidence Experimental
Experiments Cloned
Putative hsa-miR-27a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol ATP7B LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms PWD, WC1, WD, WND
Description ATPase, Cu++ transporting, beta polypeptide
Transcript NM_000053    LinkOut: [ RefSeq ]
Other Transcripts NM_001005918   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on ATP7B LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of ATP7B
(miRNA target sites are highlighted)
>ATP7B|NM_000053|3'UTR
   1 TGACTTCAGGCAGGCGGGCCGGGGCAGGGACTTGCCTCCACTCACCACAAGCTGAGCAGGACAGCCAGCAGCAGGATGGG
  81 CTGAGCTAGCCTCCAGCTTTGGGGACTTCCGCTCCCTGGATATGTCCAGTCATCCTGCCCTGCAGCACGCGGCCTTGTCT
 161 GGGTGCAGCTGGGCTTGGCCTGGAGAGGACGGCCCTGCCTGCCTCTTGGCCTCACGGGACCGTCAGCATGGGCTTTGTCT
 241 TGGACTCTAGTCCTTGGCTGGACTGTAGAAGGTGAGAGGCGAGTCACCCTCCTCACAGACCTCTGCTTGGAGTATTTAGG
 321 ATGACTGCTGTGAAATGGAGAACAGTTTCATCAGGACCAAAAAACCTCACTGGGCCTTTCCAGAGAACTGCAGACCTCAC
 401 TGTCAGGGTCTTTCTGATGACGCCTGTCTGTGTGCATCATGTTTCTGAGACCACAGTTTACCTCAGGTGTGCCTGTTGCT
 481 TTCTTCCTGCATAGTCTGTTCCTTTCTTCGTACATAGTCTGTTCCTTTTCTCTCCTGTGTGCTTGTCAGTGGGGACCCCT
 561 CGCAACCCTGCCTGTCACCTGGGAGGGTGGGACCAATGTCCTTGTGGTCTTTGCTGCTGCTCTCAGGCGCTTCTCCAATG
 641 CTCTGGAGTGTGCATTTCAGCTTGAACCTGCTTCCTGGCTCACACATCCCCAGCCAGGGAGCTTGCCACACTCTTCTTCA
 721 AGTTGAGGAGAGTTCTTTTTTGCTTAAAGCCCCCTTCTCCATGGAGTGTTGGCTTCTCAATAGAGTGTTGTTGCTGACCA
 801 GCTGGAGTGAGGGCCTCAGAGCCTGACCTGAGAGTCCGTACTCGGCTTCCTGTGGGGTGTAGGTTCTCGCGATTCAGGAC
 881 GTCCTTCCATATCCCTGCCCAGCCTGTGGTGCTTGAAACGTTTGCCCCATGGGAAACGTATGTGTGCAGGAGCCTCCCTG
 961 CACGGCCCAAGGGGCTTCGTTTTCAGTCTTCTGACTGTCACCTCGTGGGGTTCAGTAGAGAATTCATGTGACTAGCGCCT
1041 GGCCTTGTGTGGCTTGGAGGAAATGGTACTGCCCAAATAGGAGGAAAACACAGCCTCCCTGAGCCTGCATTCTGCACGCT
1121 GCCCAGGGGCTTCAGAAAAGGAGTGGCCACAGCACCCCGAAGGGAGCATCTGTTTACCTGGCAGTGGCTCTCAGAGCAGC
1201 AGAACGGGTTCAGTTTTAGACTCTGAAGTTGGTTGTGATTGACAGAACCCTTTGGGAGCAAACTAGTAGAGTTGGATTAA
1281 ATTCTGGGTGAAACCCTTTTCTCCCACACAAAATAGTTTTAGTGATTTTTTTCATTGTCCATTACTTGCCAGGGGCAGTT
1361 TTAGCAGCACTTTTGATAGATTACGTCTAATCCTCCCAACCAACCAGCAGGGTAGCTATTACTGTCCACATTTTACAGGC
1441 AAGGAAACAGGCTCCAAGAGGCTGAGGACTTTGCCCAGGATGACATAGCCAATGGACAAGCAGTGTCTGTCAGCTGTGAA
1521 GGCTTCACTCTTATTGTCCTTCTACCTTGAATAGAAGTTTTCCTGATAAGAATAAACGAGGAAAAGGTCCTTGCCTCCTG
1601 GAAGAACAAATCTACCAGGTGATCTATTCATTGTTTCAACTCAGAATGCACTTGATTCAGGAGGTCATCTGACCTTCACC
1681 TTGGATGGTTAGTTTCACTTTTTACATATAGTTTTTGCAGGGTTTTATTTTATAAAATCCAAGCGCGCTGTTGATTGTGT
1761 TTTCCTTGTTTTCAGCCCCCCCACTCCAGCCCGCAGCACATTTCCGCTGTCCGTCAGTAATTGTGTCCTCTCTTTATGCT
1841 TGCTTGGGGAATGTTGTTTTCTGACTAGGCTGATCATTATCTAAAGAATCTAATTCTGTTGATTTTTAAAACTTTTAGGA
1921 CCATAAACGTTGTGTTCATATATGGACATGGAAATATTTATATAATTTTATAGAAAATAACCTTTTAGATGGTCAAAGTG
2001 TAAGGAGTTTTTTTGTCAGATAATCATTTCTACTTCAAAAACATTTCATGCAATATTAGAATAAAGTTCCTGTCATTCCT
2081 CTAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cgCCU--UGAAUC-----GGUGACACUu 5'
            |||  |:||||     |::|||||| 
Target 5' ttGGAGTATTTAGGATGACTGCTGTGAa 3'
307 - 334 145.00 -16.10
2
miRNA  3' cgcCUUGAAUCGGUGACACUu 5'
             | :: |: | :|||||| 
Target 5' gcaGTGTCTGTCAGCTGTGAa 3'
1500 - 1520 130.00 -12.80
3
miRNA  3' cgcCUUGA-AUC---GGUGACACUu 5'
             |||||  ||   :|||||| | 
Target 5' agaGAACTGCAGACCTCACTGTCAg 3'
382 - 406 126.00 -11.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-27a-3p :: ATP7B    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' cgCCTTGAATCGGTGACACTt 5'
            || | |  |||||||||| 
Target 5' aaGGCAGT--GCCACTGTGAa 3'
1 - 19
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
393 hsa-miR-27a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000107 RUNX1 runt-related transcription factor 1 2 2
MIRT001088 FOXO1 forkhead box O1 5 4
MIRT001210 PHB prohibitin 5 4
MIRT001769 ZBTB10 zinc finger and BTB domain containing 10 4 4
MIRT001770 MYT1 myelin transcription factor 1 3 1
MIRT002401 SP4 Sp4 transcription factor 3 2
MIRT002402 SP3 Sp3 transcription factor 3 2
MIRT002403 SP1 Sp1 transcription factor 5 4
MIRT005357 HIPK2 homeodomain interacting protein kinase 2 3 1
MIRT005425 THRB thyroid hormone receptor, beta 3 1
MIRT005511 SPRY2 sprouty homolog 2 (Drosophila) 6 3
MIRT006100 WEE1 WEE1 homolog (S. pombe) 3 2
MIRT006221 APC adenomatous polyposis coli 3 2
MIRT006357 FBXW7 F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase 3 2
MIRT006431 IGF1 insulin-like growth factor 1 (somatomedin C) 3 1
MIRT006521 PAX3 paired box 3 2 1
MIRT006557 MMP13 matrix metallopeptidase 13 (collagenase 3) 1 1
MIRT007005 Mstn myostatin 1 1
MIRT007024 WDR77 WD repeat domain 77 1 1
MIRT007123 ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1 3 2
MIRT007124 PDS5B PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) 1 1
MIRT007313 NFE2L2 nuclear factor (erythroid-derived 2)-like 2 2 2
MIRT007360 EGFR epidermal growth factor receptor 3 2
MIRT028684 GCA grancalcin, EF-hand calcium binding protein 1 1
MIRT028685 FADD Fas (TNFRSF6)-associated via death domain 1 1
MIRT028686 PEX7 peroxisomal biogenesis factor 7 1 1
MIRT028687 TERF2IP telomeric repeat binding factor 2, interacting protein 1 1
MIRT028688 LIMA1 LIM domain and actin binding 1 1 1
MIRT028689 GRWD1 glutamate-rich WD repeat containing 1 1 1
MIRT028690 TIAL1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 1 1
MIRT028691 GNB5 guanine nucleotide binding protein (G protein), beta 5 1 1
MIRT028692 STAU1 staufen, RNA binding protein, homolog 1 (Drosophila) 1 1
MIRT028693 LMNB2 lamin B2 1 2
MIRT028694 RPS6KA5 ribosomal protein S6 kinase, 90kDa, polypeptide 5 1 1
MIRT028695 SETD1B SET domain containing 1B 1 1
MIRT028696 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 2
MIRT028697 ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 1 1
MIRT028698 RPP25L ribonuclease P/MRP 25kDa subunit-like 1 1
MIRT028699 ARL6IP1 ADP-ribosylation factor-like 6 interacting protein 1 1 4
MIRT028700 FIZ1 FLT3-interacting zinc finger 1 1 1
MIRT028701 FAM49B family with sequence similarity 49, member B 1 1
MIRT028702 LYSMD3 LysM, putative peptidoglycan-binding, domain containing 3 1 3
MIRT028703 PJA2 praja ring finger 2, E3 ubiquitin protein ligase 1 1
MIRT028704 ALDH9A1 aldehyde dehydrogenase 9 family, member A1 1 1
MIRT028705 SETD7 SET domain containing (lysine methyltransferase) 7 1 1
MIRT028706 LITAF lipopolysaccharide-induced TNF factor 1 1
MIRT028707 SUV420H1 suppressor of variegation 4-20 homolog 1 (Drosophila) 1 1
MIRT028708 TMEM30A transmembrane protein 30A 1 1
MIRT028709 RNF182 ring finger protein 182 1 1
MIRT028710 MMS22L MMS22-like, DNA repair protein 1 1
MIRT028711 VPS35 vacuolar protein sorting 35 homolog (S. cerevisiae) 1 1
MIRT028712 PLAG1 pleiomorphic adenoma gene 1 1 1
MIRT028713 SPICE1 spindle and centriole associated protein 1 1 1
MIRT028714 SPATA13 spermatogenesis associated 13 1 3
MIRT028715 USP25 ubiquitin specific peptidase 25 1 1
MIRT028716 LBR lamin B receptor 1 2
MIRT028717 MYO9A myosin IXA 1 1
MIRT028718 ECT2 epithelial cell transforming sequence 2 oncogene 1 1
MIRT028719 GPT2 glutamic pyruvate transaminase (alanine aminotransferase) 2 1 1
MIRT028720 PRR14L proline rich 14-like 1 1
MIRT028721 HOXC6 homeobox C6 1 1
MIRT028722 FOXP4 forkhead box P4 1 2
MIRT028723 C6orf120 chromosome 6 open reading frame 120 1 2
MIRT028724 MBTD1 mbt domain containing 1 1 1
MIRT028725 DPY19L3 dpy-19-like 3 (C. elegans) 1 1
MIRT028726 MKLN1 muskelin 1, intracellular mediator containing kelch motifs 1 1
MIRT028727 FAM69A family with sequence similarity 69, member A 1 1
MIRT028728 RMND5A required for meiotic nuclear division 5 homolog A (S. cerevisiae) 3 2
MIRT028729 AMOTL2 angiomotin like 2 1 1
MIRT028730 ARL4C ADP-ribosylation factor-like 4C 1 1
MIRT028731 DNAJC27 DnaJ (Hsp40) homolog, subfamily C, member 27 1 1
MIRT028732 KCTD14 potassium channel tetramerisation domain containing 14 1 1
MIRT028733 EIF2S2 eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa 1 1
MIRT028734 AFF4 AF4/FMR2 family, member 4 1 2
MIRT028735 MIER3 mesoderm induction early response 1, family member 3 1 2
MIRT028736 FAM217B family with sequence similarity 217, member B 1 4
MIRT028737 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 2
MIRT028738 TMEM170B transmembrane protein 170B 1 1
MIRT028739 GPAM glycerol-3-phosphate acyltransferase, mitochondrial 1 3
MIRT028740 LIFR leukemia inhibitory factor receptor alpha 1 2
MIRT028741 ABHD17C family with sequence similarity 108, member C1 1 2
MIRT028742 INO80D INO80 complex subunit D 1 1
MIRT028743 ZNF800 zinc finger protein 800 1 7
MIRT028744 TP53 tumor protein p53 1 1
MIRT050013 APBB2 amyloid beta (A4) precursor protein-binding, family B, member 2 1 1
MIRT050014 RPS18 ribosomal protein S18 1 1
MIRT050015 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT050016 DUSP5 dual specificity phosphatase 5 1 1
MIRT050017 CEP55 centrosomal protein 55kDa 1 1
MIRT050018 ZNF778 zinc finger protein 778 1 1
MIRT050019 RPL19 ribosomal protein L19 1 1
MIRT050020 IMPA1 inositol(myo)-1(or 4)-monophosphatase 1 1 1
MIRT050021 MYO1C myosin IC 1 1
MIRT050022 BMI1 BMI1 polycomb ring finger oncogene 1 1
MIRT050023 RPTOR regulatory associated protein of MTOR, complex 1 1 1
MIRT050024 LENG1 leukocyte receptor cluster (LRC) member 1 1 1
MIRT050025 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT050026 BRAT1 BRCA1-associated ATM activator 1 1 1
MIRT050027 SEC16A SEC16 homolog A (S. cerevisiae) 1 1
MIRT050028 CUL1 cullin 1 1 1
MIRT050029 ZNF638 zinc finger protein 638 1 1
MIRT050030 THOC3 THO complex 3 1 1
MIRT050031 ATN1 atrophin 1 1 1
MIRT050032 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT050033 ATP7B ATPase, Cu++ transporting, beta polypeptide 1 1
MIRT050034 FAM21C family with sequence similarity 21, member C 1 1
MIRT050035 RPS24 ribosomal protein S24 1 1
MIRT050036 NME2 NME/NM23 nucleoside diphosphate kinase 2 1 1
MIRT050037 SUN2 Sad1 and UNC84 domain containing 2 1 1
MIRT052939 SEMA6A sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A 3 1
MIRT053148 MET met proto-oncogene (hepatocyte growth factor receptor) 3 1
MIRT053476 CCND1 cyclin D1 3 1
MIRT054064 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 4 1
MIRT054414 SLC7A11 solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11 2 1
MIRT054442 MAP2K4 mitogen-activated protein kinase kinase 4 2 1
MIRT054499 PPARG peroxisome proliferator-activated receptor gamma 3 1
MIRT054696 HOXA10 homeobox A10 4 4
MIRT054738 LDLR low density lipoprotein receptor 3 2
MIRT054829 PSAP prosaposin 4 1
MIRT054893 GATA2 GATA binding protein 2 1 1
MIRT056717 UBE2D1 ubiquitin-conjugating enzyme E2D 1 1 3
MIRT057004 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT059144 TXNIP thioredoxin interacting protein 1 1
MIRT065415 TMBIM6 transmembrane BAX inhibitor motif containing 6 1 3
MIRT071711 CCNK cyclin K 1 2
MIRT076088 ADORA2B adenosine A2b receptor 1 1
MIRT078212 DYNLL2 dynein, light chain, LC8-type 2 1 1
MIRT090242 ZNF148 zinc finger protein 148 1 1
MIRT093744 ADD1 adducin 1 (alpha) 1 1
MIRT097054 TNPO1 transportin 1 1 2
MIRT100887 CD2AP CD2-associated protein 1 2
MIRT104478 PEG10 paternally expressed 10 1 3
MIRT116571 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT120694 NR1D2 nuclear receptor subfamily 1, group D, member 2 1 1
MIRT128943 KMT2A myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 1 1
MIRT132931 WNK1 WNK lysine deficient protein kinase 1 3 2
MIRT134636 PNRC2 proline-rich nuclear receptor coactivator 2 1 1
MIRT148810 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT149461 CARM1 coactivator-associated arginine methyltransferase 1 1 1
MIRT155411 CCNT2 cyclin T2 1 1
MIRT155576 TTC3 tetratricopeptide repeat domain 3 1 1
MIRT156094 AGPAT3 1-acylglycerol-3-phosphate O-acyltransferase 3 1 1
MIRT156318 PDK1 pyruvate dehydrogenase kinase, isozyme 1 1 1
MIRT157097 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 1 1
MIRT157709 CAB39 calcium binding protein 39 1 1
MIRT159507 DYNC2LI1 dynein, cytoplasmic 2, light intermediate chain 1 1 2
MIRT164842 DCUN1D4 DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae) 1 1
MIRT172340 LONRF1 LON peptidase N-terminal domain and ring finger 1 1 1
MIRT177532 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 2
MIRT178136 PPIF peptidylprolyl isomerase F 1 1
MIRT181413 EFHD2 EF-hand domain family, member D2 1 1
MIRT186277 PITHD1 PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1 1 3
MIRT190175 AKIRIN1 akirin 1 1 4
MIRT190741 FOXJ3 forkhead box J3 1 1
MIRT196434 TAOK1 TAO kinase 1 1 1
MIRT197755 MED13 mediator complex subunit 13 1 1
MIRT238582 NLN neurolysin (metallopeptidase M3 family) 1 1
MIRT238649 JMY junction mediating and regulatory protein, p53 cofactor 1 1
MIRT241579 TROVE2 TROVE domain family, member 2 1 1
MIRT247902 KIAA1551 KIAA1551 1 1
MIRT251545 DCAF7 DDB1 and CUL4 associated factor 7 1 3
MIRT297082 RGPD4 RANBP2-like and GRIP domain containing 4 1 1
MIRT303302 SNRNP27 small nuclear ribonucleoprotein 27kDa (U4/U6.U5) 1 1
MIRT315667 NUS1 nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) 1 4
MIRT320050 EN2 engrailed homeobox 2 1 1
MIRT323787 TGFBR1 transforming growth factor, beta receptor 1 1 1
MIRT352933 C2ORF44 chromosome 2 open reading frame 44 1 1
MIRT353302 ZFP36L2 zinc finger protein 36, C3H type-like 2 1 1
MIRT357683 PAIP2 poly(A) binding protein interacting protein 2 1 1
MIRT382289 CELF2 CUGBP, Elav-like family member 2 1 1
MIRT393591 TP53INP1 tumor protein p53 inducible nuclear protein 1 1 1
MIRT400020 PNKD paroxysmal nonkinesigenic dyskinesia 1 1
MIRT401738 HLA-DRA major histocompatibility complex, class II, DR alpha 1 1
MIRT437359 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma 2 1
MIRT437692 ENDOU endonuclease, polyU-specific 2 1
MIRT437693 BNIP3 BCL2/adenovirus E1B 19kDa interacting protein 3 2 1
MIRT437694 CRISP2 cysteine-rich secretory protein 2 2 1
MIRT437695 LPIN1 lipin 1 2 1
MIRT437696 CCNYL1 cyclin Y-like 1 2 1
MIRT437697 CAB39L calcium binding protein 39-like 2 1
MIRT437698 CPPED1 calcineurin-like phosphoesterase domain containing 1 2 1
MIRT437699 CNN3 calponin 3, acidic 2 1
MIRT437945 IFNG interferon, gamma 4 1
MIRT437946 GRB2 growth factor receptor-bound protein 2 4 1
MIRT437947 SEMA7A semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group) 4 1
MIRT437994 DPYD dihydropyrimidine dehydrogenase 1 1
MIRT438156 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 1 1
MIRT438534 IFNR interferon production regulator 2 1
MIRT442823 CDH6 cadherin 6, type 2, K-cadherin (fetal kidney) 1 1
MIRT448431 TMEM167A transmembrane protein 167A 1 1
MIRT450251 MED30 mediator complex subunit 30 1 1
MIRT451841 TXNDC5 thioredoxin domain containing 5 (endoplasmic reticulum) 1 1
MIRT452126 NDUFC2-KCTD14 NDUFC2-KCTD14 readthrough 1 1
MIRT452198 TMEM68 transmembrane protein 68 1 2
MIRT452778 FAM136A family with sequence similarity 136, member A 1 1
MIRT454226 OSBPL10 oxysterol binding protein-like 10 1 7
MIRT454704 HMGN1 high mobility group nucleosome binding domain 1 1 2
MIRT455381 PLA2G2D phospholipase A2, group IID 1 1
MIRT455817 TRUB2 TruB pseudouridine (psi) synthase homolog 2 (E. coli) 1 3
MIRT456976 MANEA mannosidase, endo-alpha 1 1
MIRT457170 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT457220 AP3D1 adaptor-related protein complex 3, delta 1 subunit 1 1
MIRT458042 TSEN54 tRNA splicing endonuclease 54 homolog (S. cerevisiae) 1 1
MIRT459895 PIGO phosphatidylinositol glycan anchor biosynthesis, class O 1 6
MIRT461309 MRPS27 mitochondrial ribosomal protein S27 1 1
MIRT461487 KIAA1009 KIAA1009 1 1
MIRT463093 ZNF618 zinc finger protein 618 1 1
MIRT463310 ZFP36L1 zinc finger protein 36, C3H type-like 1 1 3
MIRT463322 ZFP1 zinc finger protein 1 homolog (mouse) 1 1
MIRT464028 WASL Wiskott-Aldrich syndrome-like 1 2
MIRT464351 USP46 ubiquitin specific peptidase 46 1 1
MIRT464472 UGCG UDP-glucose ceramide glucosyltransferase 1 2
MIRT465456 TOR2A torsin family 2, member A 1 1
MIRT465811 TMEM91 transmembrane protein 91 1 1
MIRT466198 TMED5 transmembrane emp24 protein transport domain containing 5 1 4
MIRT466394 TGOLN2 trans-golgi network protein 2 1 2
MIRT466403 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT466623 TARDBP TAR DNA binding protein 1 1
MIRT467063 SRSF1 serine/arginine-rich splicing factor 1 1 2
MIRT468260 SFXN4 sideroflexin 4 1 1
MIRT468265 SFXN1 sideroflexin 1 1 1
MIRT468548 SERP1 stress-associated endoplasmic reticulum protein 1 1 1
MIRT468886 RREB1 ras responsive element binding protein 1 1 1
MIRT469594 RAP1B RAP1B, member of RAS oncogene family 1 1
MIRT469831 RAB14 RAB14, member RAS oncogene family 1 2
MIRT470122 PSPC1 paraspeckle component 1 1 2
MIRT470542 COASY CoA synthase 1 1
MIRT471449 PDIA5 protein disulfide isomerase family A, member 5 1 1
MIRT471457 PDHX pyruvate dehydrogenase complex, component X 1 1
MIRT471696 OTUD4 OTU domain containing 4 1 2
MIRT471856 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT471926 NRAS neuroblastoma RAS viral (v-ras) oncogene homolog 1 2
MIRT472083 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT472140 NLK nemo-like kinase 1 1
MIRT472428 NCBP2 nuclear cap binding protein subunit 2, 20kDa 1 1
MIRT472620 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT473035 MRPS14 mitochondrial ribosomal protein S14 1 1
MIRT474142 LIN54 lin-54 homolog (C. elegans) 1 2
MIRT474578 KLHDC3 kelch domain containing 3 1 1
MIRT475076 ITSN2 intersectin 2 1 2
MIRT475084 ITCH itchy E3 ubiquitin protein ligase 1 1
MIRT475418 ICK intestinal cell (MAK-like) kinase 1 1
MIRT475853 HAT1 histone acetyltransferase 1 1 1
MIRT476037 GSE1 Gse1 coiled-coil protein homolog (mouse) 1 2
MIRT476226 GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 1 1
MIRT476728 FOXN2 forkhead box N2 1 2
MIRT476828 FNDC3A fibronectin type III domain containing 3A 1 1
MIRT476852 FHL2 four and a half LIM domains 2 1 2
MIRT476985 FAM73B family with sequence similarity 73, member B 1 1
MIRT477515 ELL2 elongation factor, RNA polymerase II, 2 1 1
MIRT477815 DYRK3 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 1 1
MIRT478427 DAZAP2 DAZ associated protein 2 1 1
MIRT478510 CYP1B1 cytochrome P450, family 1, subfamily B, polypeptide 1 1 1
MIRT478565 CTNND1 catenin (cadherin-associated protein), delta 1 1 1
MIRT478692 CSRP2 cysteine and glycine-rich protein 2 1 2
MIRT479388 CELF1 CUGBP, Elav-like family member 1 1 3
MIRT480280 C8orf4 chromosome 8 open reading frame 4 1 1
MIRT480315 C5orf51 chromosome 5 open reading frame 51 1 1
MIRT480584 BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast) 1 1
MIRT480874 BDNF-AS BDNF antisense RNA 1 1
MIRT481722 APPBP2 amyloid beta precursor protein (cytoplasmic tail) binding protein 2 1 3
MIRT481803 APEX1 APEX nuclease (multifunctional DNA repair enzyme) 1 1 3
MIRT481855 AP1G1 adaptor-related protein complex 1, gamma 1 subunit 1 4
MIRT481918 ANKRD40 ankyrin repeat domain 40 1 1
MIRT482069 ALG9 asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT485066 SUCO SUN domain containing ossification factor 1 2
MIRT485313 NECAP1 NECAP endocytosis associated 1 1 5
MIRT487164 LFNG LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase 1 1
MIRT489616 ZNF384 zinc finger protein 384 1 1
MIRT498026 ZBTB20 zinc finger and BTB domain containing 20 1 1
MIRT498650 AP3B2 adaptor-related protein complex 3, beta 2 subunit 1 3
MIRT499284 TSPYL1 TSPY-like 1 1 2
MIRT500099 SLC46A3 solute carrier family 46, member 3 1 1
MIRT500343 ZNF460 zinc finger protein 460 1 4
MIRT501602 PLAGL2 pleiomorphic adenoma gene-like 2 1 2
MIRT501626 PISD phosphatidylserine decarboxylase 1 1
MIRT501764 NRBP1 nuclear receptor binding protein 1 1 1
MIRT501802 NGFRAP1 nerve growth factor receptor (TNFRSF16) associated protein 1 1 1
MIRT501811 NEURL1B neuralized homolog 1B (Drosophila) 1 1
MIRT502277 H3F3B H3 histone, family 3B (H3.3B) 1 2
MIRT502302 GNG12 guanine nucleotide binding protein (G protein), gamma 12 1 3
MIRT502485 FAM84B family with sequence similarity 84, member B 1 1
MIRT502863 CHEK2 checkpoint kinase 2 1 3
MIRT503090 BTG2 BTG family, member 2 1 1
MIRT503150 ARL5B ADP-ribosylation factor-like 5B 1 3
MIRT503224 ACER2 alkaline ceramidase 2 1 1
MIRT503242 ZFP36 zinc finger protein 36, C3H type, homolog (mouse) 1 2
MIRT507194 FZD9 frizzled family receptor 9 1 3
MIRT511582 HIST2H2AA4 histone cluster 2, H2aa4 1 2
MIRT511593 HIST2H2AA3 histone cluster 2, H2aa3 1 2
MIRT513890 GTF2IRD2 GTF2I repeat domain containing 2 1 2
MIRT523919 EIF5 eukaryotic translation initiation factor 5 1 1
MIRT525427 PROX2 prospero homeobox 2 1 1
MIRT527141 GPATCH11 coiled-coil domain containing 75 1 1
MIRT527356 KRTAP13-2 keratin associated protein 13-2 1 1
MIRT528214 METTL8 methyltransferase like 8 1 1
MIRT530185 TIGD2 tigger transposable element derived 2 1 1
MIRT533007 ZFHX3 zinc finger homeobox 3 1 1
MIRT533110 YIPF4 Yip1 domain family, member 4 1 2
MIRT533583 TOMM40L translocase of outer mitochondrial membrane 40 homolog (yeast)-like 1 1
MIRT534672 RNF152 ring finger protein 152 1 1
MIRT535977 MESDC1 mesoderm development candidate 1 1 1
MIRT538139 DDI2 DNA-damage inducible 1 homolog 2 (S. cerevisiae) 1 1
MIRT539092 ARNTL aryl hydrocarbon receptor nuclear translocator-like 1 2
MIRT555416 PPIC peptidylprolyl isomerase C (cyclophilin C) 1 1
MIRT557017 HOXD11 homeobox D11 1 1
MIRT557041 HOXB3 homeobox B3 1 1
MIRT558181 EIF5A2 eukaryotic translation initiation factor 5A2 1 1
MIRT560385 TMEM254 transmembrane protein 254 1 1
MIRT564818 ZBTB18 zinc finger protein 238 1 1
MIRT565573 SLC7A2 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 1 1
MIRT570043 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570628 MAP1B microtubule-associated protein 1B 1 1
MIRT572020 H3F3C H3 histone, family 3C 1 1
MIRT573427 ALDOA aldolase A, fructose-bisphosphate 1 1
MIRT575295 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT611106 MYO1F myosin IF 1 2
MIRT611935 ZNF106 zinc finger protein 106 homolog (mouse) 1 1
MIRT612576 RBBP5 retinoblastoma binding protein 5 1 1
MIRT617071 SPIB Spi-B transcription factor (Spi-1/PU.1 related) 1 1
MIRT620808 SLC26A2 solute carrier family 26 (sulfate transporter), member 2 1 1
MIRT623673 HRK harakiri, BCL2 interacting protein (contains only BH3 domain) 1 1
MIRT626145 MPRIP myosin phosphatase Rho interacting protein 1 1
MIRT630864 UBXN11 UBX domain protein 11 1 1
MIRT641998 NR2F2 nuclear receptor subfamily 2, group F, member 2 1 1
MIRT645233 KCTD12 potassium channel tetramerisation domain containing 12 1 1
MIRT649699 ZNF175 zinc finger protein 175 1 1
MIRT651505 WNT9B wingless-type MMTV integration site family, member 9B 1 1
MIRT652649 TIMM10 translocase of inner mitochondrial membrane 10 homolog (yeast) 1 1
MIRT653372 SMAD4 SMAD family member 4 1 1
MIRT653455 SLC6A17 solute carrier family 6, member 17 1 1
MIRT660906 ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif, 5 1 1
MIRT664292 HINT1 histidine triad nucleotide binding protein 1 1 1
MIRT666296 SLC25A25 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25 1 1
MIRT682416 OLR1 oxidized low density lipoprotein (lectin-like) receptor 1 1 1
MIRT686859 SLC25A44 solute carrier family 25, member 44 1 1
MIRT687781 KHSRP KH-type splicing regulatory protein 1 1
MIRT698123 TOPBP1 topoisomerase (DNA) II binding protein 1 1 1
MIRT699017 SOS1 son of sevenless homolog 1 (Drosophila) 1 1
MIRT715443 RGS6 regulator of G-protein signaling 6 1 1
MIRT722066 TP53INP2 tumor protein p53 inducible nuclear protein 2 1 1
MIRT722353 BAG2 BCL2-associated athanogene 2 1 1
MIRT723897 NUDT21 nudix (nucleoside diphosphate linked moiety X)-type motif 21 1 1
MIRT725516 FBXO46 F-box protein 46 1 1
MIRT725577 CFDP1 craniofacial development protein 1 1 1
MIRT726027 ZNF627 zinc finger protein 627 1 1
MIRT726064 ZFX zinc finger protein, X-linked 1 1
MIRT726110 WDFY1 WD repeat and FYVE domain containing 1 1 1
MIRT726185 UBR5 ubiquitin protein ligase E3 component n-recognin 5 1 1
MIRT726198 UBE2G1 ubiquitin-conjugating enzyme E2G 1 1 1
MIRT726233 TRIM23 tripartite motif containing 23 1 1
MIRT726242 TPT1 tumor protein, translationally-controlled 1 1 1
MIRT726271 TMSB10 thymosin beta 10 1 1
MIRT726477 SNX25 sorting nexin 25 1 1
MIRT726493 SMAD2 SMAD family member 2 1 1
MIRT726601 SGMS1 sphingomyelin synthase 1 1 1
MIRT726623 SERTAD3 SERTA domain containing 3 1 1
MIRT726642 SEC24A SEC24 family, member A (S. cerevisiae) 1 1
MIRT726674 RYBP RING1 and YY1 binding protein 1 1
MIRT726722 RNF38 ring finger protein 38 1 1
MIRT726730 RNF139 ring finger protein 139 1 1
MIRT726858 PREX1 phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1 1 1
MIRT726921 PLXND1 plexin D1 1 1
MIRT726949 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT726955 PHC2 polyhomeotic homolog 2 (Drosophila) 1 1
MIRT726957 PGM2L1 phosphoglucomutase 2-like 1 1 1
MIRT727024 PAK2 p21 protein (Cdc42/Rac)-activated kinase 2 1 1
MIRT727057 NUP133 nucleoporin 133kDa 1 1
MIRT727064 NSD1 nuclear receptor binding SET domain protein 1 1 1
MIRT727089 NF1 neurofibromin 1 1 1
MIRT727183 KMT2C myeloid/lymphoid or mixed-lineage leukemia 3 1 1
MIRT727207 MGEA5 meningioma expressed antigen 5 (hyaluronidase) 1 1
MIRT727219 MED14 mediator complex subunit 14 1 1
MIRT727263 LRRC61 leucine rich repeat containing 61 1 1
MIRT727282 LPCAT1 lysophosphatidylcholine acyltransferase 1 1 1
MIRT727469 IER3 immediate early response 3 1 1
MIRT727491 HMGXB4 HMG box domain containing 4 1 1
MIRT727518 GYS1 glycogen synthase 1 (muscle) 1 1
MIRT727574 GLCCI1 glucocorticoid induced transcript 1 1 1
MIRT727596 GCSAM germinal center-associated, signaling and motility 1 1
MIRT727660 FEM1B fem-1 homolog b (C. elegans) 1 1
MIRT727661 FCHSD2 FCH and double SH3 domains 2 1 1
MIRT727686 FARSA phenylalanyl-tRNA synthetase, alpha subunit 1 1
MIRT727779 ELMO1 engulfment and cell motility 1 1 1
MIRT727818 E2F7 E2F transcription factor 7 1 1
MIRT727879 DERL1 derlin 1 1 1
MIRT727960 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT728028 CCNL2 cyclin L2 1 1
MIRT728102 C2CD2L C2CD2-like 1 1
MIRT728124 SZRD1 SUZ RNA binding domain containing 1 1 1
MIRT728251 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9) 1 1
MIRT728386 ADAR adenosine deaminase, RNA-specific 1 1
MIRT728413 ABL2 v-abl Abelson murine leukemia viral oncogene homolog 2 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*