Accession ID: MIRT050033 [miRNA, hsa-miR-27a-3p :: ATP7B, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-27aLinkOut: [miRBase ]
Description Homo sapiens miR-27a stem-loop
Comment This miRNA was previously named miR-27 but is renamed here to avoid confusion with the more recently described miR-27b (MIR:MI0000440).
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-27a-3p
Mature Sequence 51| UUCACAGUGGCUAAGUUCCGC |71
Evidence Experimental
Experiments Cloned
Putative hsa-miR-27a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol ATP7B LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms PWD, WC1, WD, WND
Description ATPase, Cu++ transporting, beta polypeptide
Transcript NM_0000    LinkOut: [ RefSeq ]
Other Transcripts NM_0010059   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on ATP7B LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of ATP7B
(miRNA target sites are highlighted)
>ATP7B|NM_0000|3'UTR
   1 TGATGACTTCAGGCAGGCGGGCCGGGGCAGGGACTTGCCTCCACTCACCACAAGCTGAGCAGGACAGCCAGCAGCAGGAT
  81 GGGCTGAGCTAGCCTCCAGCTTTGGGGACTTCCGCTCCCTGGATATGTCCAGTCATCCTGCCCTGCAGCACGCGGCCTTG
 161 TCTGGGTGCAGCTGGGCTTGGCCTGGAGAGGACGGCCCTGCCTGCCTCTTGGCCTCACGGGACCGTCAGCATGGGCTTTG
 241 TCTTGGACTCTAGTCCTTGGCTGGACTGTAGAAGGTGAGAGGCGAGTCACCCTCCTCACAGACCTCTGCTTGGAGTATTT
 321 AGGATGACTGCTGTGAAATGGAGAACAGTTTCATCAGGACCAAAAAACCTCACTGGGCCTTTCCAGAGAACTGCAGACCT
 401 CACTGTCAGGGTCTTTCTGATGACGCCTGTCTGTGTGCATCATGTTTCTGAGACCACAGTTTACCTCAGGTGTGCCTGTT
 481 GCTTTCTTCCTGCATAGTCTGTTCCTTTCTTCGTACATAGTCTGTTCCTTTTCTCTCCTGTGTGCTTGTCAGTGGGGACC
 561 CCTCGCAACCCTGCCTGTCACCTGGGAGGGTGGGACCAATGTCCTTGTGGTCTTTGCTGCTGCTCTCAGGCGCTTCTCCA
 641 ATGCTCTGGAGTGTGCATTTCAGCTTGAACCTGCTTCCTGGCTCACACATCCCCAGCCAGGGAGCTTGCCACACTCTTCT
 721 TCAAGTTGAGGAGAGTTCTTTTTTGCTTAAAGCCCCCTTCTCCATGGAGTGTTGGCTTCTCAATAGAGTGTTGTTGCTGA
 801 CCAGCTGGAGTGAGGGCCTCAGAGCCTGACCTGAGAGTCCGTACTCGGCTTCCTGTGGGGTGTAGGTTCTCGCGATTCAG
 881 GACGTCCTTCCATATCCCTGCCCAGCCTGTGGTGCTTGAAACGTTTGCCCCATGGGAAACGTATGTGTGCAGGAGCCTCC
 961 CTGCACGGCCCAAGGGGCTTCGTTTTCAGTCTTCTGACTGTCACCTCGTGGGGTTCAGTAGAGAATTCATGTGACTAGCG
1041 CCTGGCCTTGTGTGGCTTGGAGGAAATGGTACTGCCCAAATAGGAGGAAAACACAGCCTCCCTGAGCCTGCATTCTGCAC
1121 GCTGCCCAGGGGCTTCAGAAAAGGAGTGGCCACAGCACCCCGAAGGGAGCATCTGTTTACCTGGCAGTGGCTCTCAGAGC
1201 AGCAGAACGGGTTCAGTTTTAGACTCTGAAGTTGGTTGTGATTGACAGAACCCTTTGGGAGCAAACTAGTAGAGTTGGAT
1281 TAAATTCTGGGTGAAACCCTTTTCTCCCACACAAAATAGTTTTAGTGATTTTTTTCATTGTCCATTACTTGCCAGGGGCA
1361 GTTTTAGCAGCACTTTTGATAGATTACGTCTAATCCTCCCAACCAACCAGCAGGGTAGCTATTACTGTCCACATTTTACA
1441 GGCAAGGAAACAGGCTCCAAGAGGCTGAGGACTTTGCCCAGGATGACATAGCCAATGGACAAGCAGTGTCTGTCAGCTGT
1521 GAAGGCTTCACTCTTATTGTCCTTCTACCTTGAATAGAAGTTTTCCTGATAAGAATAAACGAGGAAAAGGTCCTTGCCTC
1601 CTGGAAGAACAAATCTACCAGGTGATCTATTCATTGTTTCAACTCAGAATGCACTTGATTCAGGAGGTCATCTGACCTTC
1681 ACCTTGGATGGTTAGTTTCACTTTTTACATATAGTTTTTGCAGGGTTTTATTTTATAAAATCCAAGCGCGCTGTTGATTG
1761 TGTTTTCCTTGTTTTCAGCCCCCCCACTCCAGCCCGCAGCACATTTCCGCTGTCCGTCAGTAATTGTGTCCTCTCTTTAT
1841 GCTTGCTTGGGGAATGTTGTTTTCTGACTAGGCTGATCATTATCTAAAGAATCTAATTCTGTTGATTTTTAAAACTTTTA
1921 GGACCATAAACGTTGTGTTCATATATGGACATGGAAATATTTATATAATTTTATAGAAAATAACCTTTTAGATGGTCAAA
2001 GTGTAAGGAGTTTTTTTGTCAGATAATCATTTCTACTTCAAAAACATTTCATGCAATATTAGAATAAAGTTCCTGTCATT
2081 CCTCTAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cgCCU--UGAAUC-----GGUGACACUu 5'
            |||  |:||||     |::|||||| 
Target 5' ttGGAGTATTTAGGATGACTGCTGTGAa 3'
310 - 337 145.00 -16.10
2
miRNA  3' cgcCUUGAAUCGGUGACACUu 5'
             | :: |: | :|||||| 
Target 5' gcaGTGTCTGTCAGCTGTGAa 3'
1503 - 1523 130.00 -12.80
3
miRNA  3' cgcCUUGA-AUC---GGUGACACUu 5'
             |||||  ||   :|||||| | 
Target 5' agaGAACTGCAGACCTCACTGTCAg 3'
385 - 409 126.00 -11.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-27a-3p :: ATP7B    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' cgCCTTGAATCGGTGACACTt 5'
            || | |  |||||||||| 
Target 5' aaGGCAGT--GCCACTGTGAa 3'
1 - 19
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
109 hsa-miR-27a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000107 RUNX1 runt-related transcription factor 1 1 1
MIRT001088 FOXO1 forkhead box O1 4 3
MIRT001210 PHB prohibitin 5 3
MIRT001769 ZBTB10 zinc finger and BTB domain containing 10 3 2
MIRT001770 MYT1 myelin transcription factor 1 3 1
MIRT002401 SP4 Sp4 transcription factor 3 2
MIRT002402 SP3 Sp3 transcription factor 3 2
MIRT002403 SP1 Sp1 transcription factor 3 2
MIRT005357 HIPK2 homeodomain interacting protein kinase 2 3 1
MIRT005425 THRB thyroid hormone receptor, beta (erythroblastic leukemia viral (v-erb-a) oncogene homolog 2, avian) 3 1
MIRT005511 SPRY2 sprouty homolog 2 (Drosophila) 5 1
MIRT006100 WEE1 WEE1 homolog (S. pombe) 2 1
MIRT006221 APC adenomatous polyposis coli 2 1
MIRT006357 FBXW7 F-box and WD repeat domain containing 7 3 2
MIRT006431 IGF1 insulin-like growth factor 1 (somatomedin C) 3 1
MIRT006521 PAX3 paired box 3 2 1
MIRT006557 MMP13 matrix metallopeptidase 13 (collagenase 3) 1 1
MIRT007005 Mstn myostatin 1 1
MIRT007024 WDR77 WD repeat domain 77 1 1
MIRT007123 ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1 1 1
MIRT007124 PDS5B PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) 1 1
MIRT007313 NFE2L2 nuclear factor (erythroid-derived 2)-like 2 1 1
MIRT007360 EGFR epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) 1 1
MIRT028684 GCA grancalcin, EF-hand calcium binding protein 1 1
MIRT028685 FADD Fas (TNFRSF6)-associated via death domain 1 1
MIRT028686 PEX7 peroxisomal biogenesis factor 7 1 1
MIRT028687 TERF2IP telomeric repeat binding factor 2, interacting protein 1 1
MIRT028688 LIMA1 LIM domain and actin binding 1 1 1
MIRT028689 GRWD1 glutamate-rich WD repeat containing 1 1 1
MIRT028690 TIAL1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 1 1
MIRT028691 GNB5 guanine nucleotide binding protein (G protein), beta 5 1 1
MIRT028692 STAU1 staufen, RNA binding protein, homolog 1 (Drosophila) 1 1
MIRT028693 LMNB2 lamin B2 1 1
MIRT028694 RPS6KA5 ribosomal protein S6 kinase, 90kDa, polypeptide 5 1 1
MIRT028695 SETD1B SET domain containing 1B 1 1
MIRT028696 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT028697 ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 1 1
MIRT028698 RPP25L chromosome 9 open reading frame 23 1 1
MIRT028699 ARL6IP1 ADP-ribosylation factor-like 6 interacting protein 1 1 1
MIRT028700 FIZ1 FLT3-interacting zinc finger 1 1 1
MIRT028701 FAM49B family with sequence similarity 49, member B 1 1
MIRT028702 LYSMD3 LysM, putative peptidoglycan-binding, domain containing 3 1 1
MIRT028703 PJA2 praja ring finger 2 1 1
MIRT028704 ALDH9A1 aldehyde dehydrogenase 9 family, member A1 1 1
MIRT028705 SETD7 SET domain containing (lysine methyltransferase) 7 1 1
MIRT028706 LITAF lipopolysaccharide-induced TNF factor 1 1
MIRT028707 SUV420H1 suppressor of variegation 4-20 homolog 1 (Drosophila) 1 1
MIRT028708 TMEM30A transmembrane protein 30A 1 1
MIRT028709 RNF182 ring finger protein 182 1 1
MIRT028710 MMS22L chromosome 6 open reading frame 167 1 1
MIRT028711 VPS35 vacuolar protein sorting 35 homolog (S. cerevisiae) 1 1
MIRT028712 PLAG1 pleiomorphic adenoma gene 1 1 1
MIRT028713 SPICE1 coiled-coil domain containing 52 1 1
MIRT028714 SPATA13 spermatogenesis associated 13 1 1
MIRT028715 USP25 ubiquitin specific peptidase 25 1 1
MIRT028716 LBR lamin B receptor 1 1
MIRT028717 MYO9A myosin IXA 1 1
MIRT028718 ECT2 epithelial cell transforming sequence 2 oncogene 1 1
MIRT028719 GPT2 glutamic pyruvate transaminase (alanine aminotransferase) 2 1 1
MIRT028720 PRR14L chromosome 22 open reading frame 30 1 1
MIRT028721 HOXC6 homeobox C6 1 1
MIRT028722 FOXP4 forkhead box P4 1 2
MIRT028723 C6orf120 chromosome 6 open reading frame 120 1 1
MIRT028724 MBTD1 mbt domain containing 1 1 1
MIRT028725 DPY19L3 dpy-19-like 3 (C. elegans) 1 1
MIRT028726 MKLN1 muskelin 1, intracellular mediator containing kelch motifs 1 1
MIRT028727 FAM69A family with sequence similarity 69, member A 1 1
MIRT028728 RMND5A required for meiotic nuclear division 5 homolog A (S. cerevisiae) 1 1
MIRT028729 AMOTL2 angiomotin like 2 1 1
MIRT028730 ARL4C ADP-ribosylation factor-like 4C 1 1
MIRT028731 DNAJC27 DnaJ (Hsp40) homolog, subfamily C, member 27 1 1
MIRT028732 KCTD14 potassium channel tetramerisation domain containing 14 1 1
MIRT028733 EIF2S2 eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa 1 1
MIRT028734 AFF4 AF4/FMR2 family, member 4 1 1
MIRT028735 MIER3 mesoderm induction early response 1, family member 3 1 1
MIRT028736 FAM217B chromosome 20 open reading frame 177 1 1
MIRT028737 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT028738 TMEM170B transmembrane protein 170B 1 1
MIRT028739 GPAM glycerol-3-phosphate acyltransferase, mitochondrial 1 1
MIRT028740 LIFR leukemia inhibitory factor receptor alpha 1 1
MIRT028741 ABHD17C family with sequence similarity 108, member C1 1 1
MIRT028742 INO80D INO80 complex subunit D 1 1
MIRT028743 ZNF800 zinc finger protein 800 1 1
MIRT028744 TP53 tumor protein p53 1 1
MIRT050013 APBB2 amyloid beta (A4) precursor protein-binding, family B, member 2 1 1
MIRT050014 RPS18 ribosomal protein S18 1 1
MIRT050015 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT050016 DUSP5 dual specificity phosphatase 5 1 1
MIRT050017 CEP55 centrosomal protein 55kDa 1 1
MIRT050018 ZNF778 zinc finger protein 778 1 1
MIRT050019 RPL19 ribosomal protein L19 1 1
MIRT050020 IMPA1 inositol(myo)-1(or 4)-monophosphatase 1 1 1
MIRT050021 MYO1C myosin IC 1 1
MIRT050022 BMI1 BMI1 polycomb ring finger oncogene 1 1
MIRT050023 RPTOR regulatory associated protein of MTOR, complex 1 1 1
MIRT050024 LENG1 leukocyte receptor cluster (LRC) member 1 1 1
MIRT050025 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT050026 BRAT1 chromosome 7 open reading frame 27 1 1
MIRT050027 SEC16A SEC16 homolog A (S. cerevisiae) 1 1
MIRT050028 CUL1 cullin 1 1 1
MIRT050029 ZNF638 zinc finger protein 638 1 1
MIRT050030 THOC3 THO complex 3 1 1
MIRT050031 ATN1 atrophin 1 1 1
MIRT050032 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT050033 ATP7B ATPase, Cu++ transporting, beta polypeptide 1 1
MIRT050034 FAM21C family with sequence similarity 21, member C 1 1
MIRT050035 RPS24 ribosomal protein S24 1 1
MIRT050036 NME2 non-metastatic cells 2, protein (NM23B) expressed in 1 1
MIRT050037 SUN2 Sad1 and UNC84 domain containing 2 1 1