Accession ID: MIRT050169 [miRNA, hsa-miR-26a-5p :: MSH6, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-26a-1LinkOut: [miRBase ]
Synonyms MIR26A, MIRN26A1, MIR26A1
Description Homo sapiens miR-26a-1 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-26a-5p
Mature Sequence 10| UUCAAGUAAUCCAGGAUAGGCU |31
Evidence Experimental
Experiments Cloned
Putative hsa-miR-26a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MSH6 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms GTBP, HNPCC5, HSAP
Description mutS homolog 6 (E. coli)
Transcript NM_000179    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MSH6 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MSH6
(miRNA target sites are highlighted)
>MSH6|NM_000179|3'UTR
   1 ACTGACTACATTGGAAGCTTTGAGTTGACTTCTGACAAAGGTGGTAAATTCAGACAACATTATGATCTAATAAACTTTAT
  81 TTTTTAAAAATGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucggauagGACCUAAUG-AACUu 5'
                  || || ||| |||: 
Target 5' -------aCT-GACTACATTGGa 3'
1 - 15 101.00 -5.99
2
miRNA  3' ucggaUAGGACCU-AA-UGA--ACUU- 5'
               | |:| || || |||  |||  
Target 5' ttggaAGCTTTGAGTTGACTTCTGACA 3'
11 - 37 77.00 -6.65
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-26a-5p :: MSH6    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
417 hsa-miR-26a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000109 HMGA2 high mobility group AT-hook 2 4 5
MIRT000110 HMGA1 high mobility group AT-hook 1 3 5
MIRT000111 CCNE2 cyclin E2 3 1
MIRT000112 CCND2 cyclin D2 4 6
MIRT001021 CDK8 cyclin-dependent kinase 8 2 2
MIRT001022 CDC6 cell division cycle 6 homolog (S. cerevisiae) 2 2
MIRT001039 LIF leukemia inhibitory factor 1 2
MIRT001095 PTEN phosphatase and tensin homolog 3 6
MIRT001771 EZH2 enhancer of zeste homolog 2 (Drosophila) 5 10
MIRT001772 PLAG1 pleiomorphic adenoma gene 1 3 2
MIRT002315 SERBP1 SERPINE1 mRNA binding protein 1 3 3
MIRT002340 SMAD1 SMAD family member 1 3 6
MIRT003212 MAP3K2 mitogen-activated protein kinase kinase kinase 2 3 2
MIRT003213 RB1 retinoblastoma 1 5 2
MIRT003803 SMAD4 SMAD family member 4 3 3
MIRT003968 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 2 2
MIRT004338 CTGF connective tissue growth factor 2 2
MIRT004339 STRADB STE20-related kinase adaptor beta 3 3
MIRT004615 IFNB1 interferon, beta 1, fibroblast 3 2
MIRT004676 GSK3B glycogen synthase kinase 3 beta 6 5
MIRT005587 CPEB2 cytoplasmic polyadenylation element binding protein 2 3 2
MIRT005588 CPEB3 cytoplasmic polyadenylation element binding protein 3 4 2
MIRT005589 CPEB4 cytoplasmic polyadenylation element binding protein 4 3 2
MIRT005751 GDAP1 ganglioside induced differentiation associated protein 1 3 1
MIRT005920 MTDH metadherin 4 2
MIRT006306 CDK6 cyclin-dependent kinase 6 2 1
MIRT006309 CCNE1 cyclin E1 3 2
MIRT006389 ESR1 estrogen receptor 1 1 1
MIRT006711 ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1 2 1
MIRT006712 ARL4C ADP-ribosylation factor-like 4C 2 1
MIRT007177 E2F7 E2F transcription factor 7 1 4
MIRT007347 NOS2 nitric oxide synthase 2, inducible 2 1
MIRT007374 IL6 interleukin 6 (interferon, beta 2) 1 1
MIRT030358 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 1 1
MIRT050053 HIST1H4E histone cluster 1, H4e 1 1
MIRT050054 ZNF814 zinc finger protein 814 1 1
MIRT050055 ZNF233 zinc finger protein 233 1 1
MIRT050056 ABCB7 ATP-binding cassette, sub-family B (MDR/TAP), member 7 1 1
MIRT050057 SCRN1 secernin 1 1 1
MIRT050058 NABP1 nucleic acid binding protein 1 1 5
MIRT050059 FAM20B family with sequence similarity 20, member B 1 1
MIRT050060 ARCN1 archain 1 1 1
MIRT050061 ANO3 anoctamin 3 1 1
MIRT050062 TFAM transcription factor A, mitochondrial 1 1
MIRT050063 FER fer (fps/fes related) tyrosine kinase 1 1
MIRT050064 HIAT1 hippocampus abundant transcript 1 1 1
MIRT050065 PPP1CC protein phosphatase 1, catalytic subunit, gamma isozyme 1 1
MIRT050066 SLC35B4 solute carrier family 35, member B4 1 1
MIRT050067 RASA1 RAS p21 protein activator (GTPase activating protein) 1 1 1
MIRT050068 COX1 cytochrome c oxidase subunit I 1 1
MIRT050069 MSL3 male-specific lethal 3 homolog (Drosophila) 1 1
MIRT050070 GGA2 golgi-associated, gamma adaptin ear containing, ARF binding protein 2 1 1
MIRT050071 GIT2 G protein-coupled receptor kinase interacting ArfGAP 2 1 1
MIRT050072 DNMT1 DNA (cytosine-5-)-methyltransferase 1 1 1
MIRT050073 MFHAS1 malignant fibrous histiocytoma amplified sequence 1 1 1
MIRT050074 UBA2 ubiquitin-like modifier activating enzyme 2 1 1
MIRT050075 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT050076 MTRF1 mitochondrial translational release factor 1 1 1
MIRT050077 WBSCR16 Williams-Beuren syndrome chromosome region 16 1 1
MIRT050078 NUAK1 NUAK family, SNF1-like kinase, 1 1 1
MIRT050079 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT050080 PNMA2 paraneoplastic Ma antigen 2 1 1
MIRT050081 ACTL8 actin-like 8 1 1
MIRT050082 HSPA8 heat shock 70kDa protein 8 1 1
MIRT050083 DHX15 DEAH (Asp-Glu-Ala-His) box polypeptide 15 1 1
MIRT050084 TCP1 t-complex 1 1 1
MIRT050085 SLC25A5 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5 1 1
MIRT050086 LSM14A LSM14A, SCD6 homolog A (S. cerevisiae) 1 1
MIRT050087 CAMKV CaM kinase-like vesicle-associated 1 1
MIRT050088 ALG10B asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast) 1 1
MIRT050089 TYW1 tRNA-yW synthesizing protein 1 homolog (S. cerevisiae) 1 1
MIRT050090 RPL13A ribosomal protein L13a 1 1
MIRT050091 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT050092 TXLNG taxilin gamma 1 1
MIRT050093 RAB18 RAB18, member RAS oncogene family 1 1
MIRT050094 RPS27A ribosomal protein S27a 1 1
MIRT050095 RPS26 ribosomal protein S26 1 1
MIRT050096 PIKFYVE phosphoinositide kinase, FYVE finger containing 1 1
MIRT050097 TP53INP1 tumor protein p53 inducible nuclear protein 1 1 1
MIRT050098 ZNF703 zinc finger protein 703 1 1
MIRT050099 MTRF1L mitochondrial translational release factor 1-like 1 1
MIRT050100 ZNF506 zinc finger protein 506 1 1
MIRT050101 KCTD5 potassium channel tetramerisation domain containing 5 1 1
MIRT050102 CTC1 CTS telomere maintenance complex component 1 1 1
MIRT050103 TKT transketolase 1 1
MIRT050104 LYST lysosomal trafficking regulator 1 1
MIRT050105 FAM134A family with sequence similarity 134, member A 1 1
MIRT050106 NKX2-5 NK2 homeobox 5 1 1
MIRT050107 AURKAIP1 aurora kinase A interacting protein 1 1 1
MIRT050108 ATP1A1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 1 1
MIRT050109 COASY CoA synthase 1 1
MIRT050110 CTR9 Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT050111 COX3 cytochrome c oxidase III 1 1
MIRT050112 ELOVL6 ELOVL fatty acid elongase 6 1 1
MIRT050113 PIGT phosphatidylinositol glycan anchor biosynthesis, class T 1 1
MIRT050114 TMCC3 transmembrane and coiled-coil domain family 3 1 1
MIRT050115 ARHGEF1 Rho guanine nucleotide exchange factor (GEF) 1 1 1
MIRT050116 SHC2 SHC (Src homology 2 domain containing) transforming protein 2 1 1
MIRT050117 PSMA3 proteasome (prosome, macropain) subunit, alpha type, 3 1 1
MIRT050118 PTTG1 pituitary tumor-transforming 1 1 1
MIRT050119 RPS24 ribosomal protein S24 1 1
MIRT050120 SPTBN1 spectrin, beta, non-erythrocytic 1 1 1
MIRT050121 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT050122 BTBD3 BTB (POZ) domain containing 3 1 1
MIRT050123 AHR aryl hydrocarbon receptor 1 1
MIRT050124 EEF1B2 eukaryotic translation elongation factor 1 beta 2 1 1
MIRT050125 MRPL51 mitochondrial ribosomal protein L51 1 1
MIRT050126 SETD2 SET domain containing 2 1 1
MIRT050127 LRP6 low density lipoprotein receptor-related protein 6 1 1
MIRT050128 RHOBTB1 Rho-related BTB domain containing 1 1 1
MIRT050129 HIST1H4J histone cluster 1, H4j 1 1
MIRT050130 MYO10 myosin X 1 1
MIRT050131 ATP7B ATPase, Cu++ transporting, beta polypeptide 1 1
MIRT050132 CSRP2BP CSRP2 binding protein 1 1
MIRT050133 RBM39 RNA binding motif protein 39 1 1
MIRT050134 C14orf37 chromosome 14 open reading frame 37 1 2
MIRT050135 SFMBT1 Scm-like with four mbt domains 1 1 1
MIRT050136 KIAA1704 KIAA1704 1 1
MIRT050137 ABCB9 ATP-binding cassette, sub-family B (MDR/TAP), member 9 1 1
MIRT050138 ADM adrenomedullin 1 6
MIRT050139 USP7 ubiquitin specific peptidase 7 (herpes virus-associated) 1 1
MIRT050140 TTN titin 1 1
MIRT050141 HNRNPU heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A) 1 1
MIRT050142 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 1
MIRT050143 CEPT1 choline/ethanolamine phosphotransferase 1 1 1
MIRT050144 HOXC8 homeobox C8 1 1
MIRT050145 CTBP1 C-terminal binding protein 1 1 1
MIRT050146 SET SET nuclear oncogene 1 1
MIRT050147 MCM3AP minichromosome maintenance complex component 3 associated protein 1 1
MIRT050148 TPGS2 tubulin polyglutamylase complex subunit 2 1 1
MIRT050149 CA2 carbonic anhydrase II 1 1
MIRT050150 PCYT1A phosphate cytidylyltransferase 1, choline, alpha 1 1
MIRT050151 ACTN4 actinin, alpha 4 1 1
MIRT050152 EPG5 ectopic P-granules autophagy protein 5 homolog (C. elegans) 1 1
MIRT050153 OLA1 Obg-like ATPase 1 1 1
MIRT050154 RRM2 ribonucleotide reductase M2 1 1
MIRT050155 BBX bobby sox homolog (Drosophila) 1 1
MIRT050156 NUP205 nucleoporin 205kDa 1 1
MIRT050157 C6orf47 chromosome 6 open reading frame 47 1 1
MIRT050158 CFLAR CASP8 and FADD-like apoptosis regulator 1 1
MIRT050159 SEC31A SEC31 homolog A (S. cerevisiae) 1 1
MIRT050160 GLG1 golgi glycoprotein 1 1 1
MIRT050161 TBC1D16 TBC1 domain family, member 16 1 1
MIRT050162 BTBD9 BTB (POZ) domain containing 9 1 1
MIRT050163 RND2 Rho family GTPase 2 1 1
MIRT050164 TUBG1 tubulin, gamma 1 1 1
MIRT050165 AHRR aryl-hydrocarbon receptor repressor 1 1
MIRT050166 CNTD2 cyclin N-terminal domain containing 2 1 1
MIRT050167 UBE2A ubiquitin-conjugating enzyme E2A 1 1
MIRT050168 CCDC43 coiled-coil domain containing 43 1 1
MIRT050169 MSH6 mutS homolog 6 (E. coli) 1 1
MIRT050170 HIST4H4 histone cluster 4, H4 1 1
MIRT050171 C17orf51 chromosome 17 open reading frame 51 1 1
MIRT050172 SLC25A30 solute carrier family 25, member 30 1 1
MIRT050173 USB1 U6 snRNA biogenesis 1 1 1
MIRT050174 MYH10 myosin, heavy chain 10, non-muscle 1 1
MIRT050175 LINS lines homolog (Drosophila) 1 1
MIRT050176 UBR4 ubiquitin protein ligase E3 component n-recognin 4 1 2
MIRT050177 ZNF207 zinc finger protein 207 1 1
MIRT050178 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 1
MIRT050179 TXNL1 thioredoxin-like 1 1 1
MIRT050180 FOXO3 forkhead box O3 1 1
MIRT050181 COPB1 coatomer protein complex, subunit beta 1 1 1
MIRT050182 FASN fatty acid synthase 1 1
MIRT050183 SARS seryl-tRNA synthetase 1 1
MIRT050184 DDB1 damage-specific DNA binding protein 1, 127kDa 1 1
MIRT050185 PPIA peptidylprolyl isomerase A (cyclophilin A) 1 1
MIRT050186 SLC35A4 solute carrier family 35, member A4 1 1
MIRT050187 TXNDC11 thioredoxin domain containing 11 1 1
MIRT050188 HIST2H2AA3 histone cluster 2, H2aa3 1 1
MIRT050189 TRAP1 TNF receptor-associated protein 1 1 1
MIRT050190 SDCBP syndecan binding protein (syntenin) 1 1
MIRT050191 ASCC2 activating signal cointegrator 1 complex subunit 2 1 1
MIRT050192 KDM5C lysine (K)-specific demethylase 5C 1 1
MIRT050193 DST dystonin 1 1
MIRT050194 CLIC4 chloride intracellular channel 4 1 1
MIRT050195 WWP2 WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT050196 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT050197 RPL13 ribosomal protein L13 1 1
MIRT050198 CNBP CCHC-type zinc finger, nucleic acid binding protein 1 1
MIRT052649 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1
MIRT052903 CHD1 chromodomain helicase DNA binding protein 1 2 1
MIRT053077 CKS2 CDC28 protein kinase regulatory subunit 2 2 2
MIRT053097 PRKCD protein kinase C, delta 3 2
MIRT053251 BAG4 BCL2-associated athanogene 4 2 1
MIRT053574 FGF9 fibroblast growth factor 9 (glia-activating factor) 3 1
MIRT054062 ACVR1 activin A receptor, type I 2 1
MIRT054415 AMACR alpha-methylacyl-CoA racemase 3 1
MIRT054432 ATM ataxia telangiectasia mutated 3 1
MIRT054484 RCBTB1 regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1 3 1
MIRT054645 HGF hepatocyte growth factor (hepapoietin A; scatter factor) 3 1
MIRT054676 LIN28B lin-28 homolog B (C. elegans) 3 1
MIRT054677 ZCCHC11 zinc finger, CCHC domain containing 11 3 1
MIRT060004 VANGL2 vang-like 2 (van gogh, Drosophila) 1 2
MIRT062177 WNK1 WNK lysine deficient protein kinase 1 1 1
MIRT064905 ZBTB18 zinc finger protein 238 1 3
MIRT066809 ZDHHC18 zinc finger, DHHC-type containing 18 1 2
MIRT067540 METAP2 methionyl aminopeptidase 2 1 1
MIRT072092 CHAC1 ChaC, cation transport regulator homolog 1 (E. coli) 1 3
MIRT072125 RTF1 Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT073375 ABHD2 abhydrolase domain containing 2 1 1
MIRT075111 C16ORF70 chromosome 16 open reading frame 70 1 3
MIRT080605 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 4
MIRT085205 SLC5A3 solute carrier family 5 (sodium/myo-inositol cotransporter), member 3 1 1
MIRT086007 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087899 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT089450 TET3 tet methylcytosine dioxygenase 3 1 2
MIRT089599 MAT2A methionine adenosyltransferase II, alpha 1 6
MIRT090517 SLC25A36 solute carrier family 25 (pyrimidine nucleotide carrier ), member 36 1 1
MIRT097631 POLR3G polymerase (RNA) III (DNA directed) polypeptide G (32kD) 1 1
MIRT118410 DNMT3B DNA (cytosine-5-)-methyltransferase 3 beta 4 1
MIRT122040 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 1
MIRT127904 C10ORF12 chromosome 10 open reading frame 12 1 1
MIRT133477 EP400 E1A binding protein p400 1 1
MIRT134087 KLHL42 kelch domain containing 5 1 1
MIRT136529 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT137414 RLF rearranged L-myc fusion 1 1
MIRT137577 RCOR1 REST corepressor 1 1 1
MIRT137722 EIF5 eukaryotic translation initiation factor 5 1 1
MIRT147274 KPNA2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1 5
MIRT151691 CHAF1A chromatin assembly factor 1, subunit A (p150) 1 1
MIRT156734 FAM126B family with sequence similarity 126, member B 1 1
MIRT159273 RASGRP3 RAS guanyl releasing protein 3 (calcium and DAG-regulated) 1 1
MIRT166022 SFXN1 sideroflexin 1 1 1
MIRT166592 ZSWIM6 zinc finger, SWIM-type containing 6 1 1
MIRT168865 PIM1 pim-1 oncogene 1 1
MIRT168937 IRF4 interferon regulatory factor 4 1 1
MIRT169515 TTK TTK protein kinase 1 1
MIRT169560 PNRC1 proline-rich nuclear receptor coactivator 1 1 1
MIRT170138 KLHDC10 kelch domain containing 10 1 1
MIRT175075 DCAF10 DDB1 and CUL4 associated factor 10 1 1
MIRT183141 WEE1 WEE1 homolog (S. pombe) 2 1
MIRT187790 ANKRD52 ankyrin repeat domain 52 1 1
MIRT191753 ZNF410 zinc finger protein 410 1 1
MIRT193070 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT193726 USP3 ubiquitin specific peptidase 3 1 1
MIRT203408 DYRK1A dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A 1 1
MIRT206543 RHOQ ras homolog family member Q 1 1
MIRT210981 TET2 tet methylcytosine dioxygenase 2 1 1
MIRT215349 CREBRF CREB3 regulatory factor 1 1
MIRT227685 TBC1D13 TBC1 domain family, member 13 1 1
MIRT243962 MAP1B microtubule-associated protein 1B 1 1
MIRT250410 TNRC6A trinucleotide repeat containing 6A 1 4
MIRT262152 OTUD1 OTU domain containing 1 1 1
MIRT277212 AKIRIN1 akirin 1 1 1
MIRT286389 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 2
MIRT308147 PDE12 phosphodiesterase 12 1 1
MIRT319694 UBN2 ubinuclein 2 1 2
MIRT327077 KLHL15 kelch-like 15 (Drosophila) 1 5
MIRT346489 SSX2IP synovial sarcoma, X breakpoint 2 interacting protein 1 1
MIRT438130 ADAM17 ADAM metallopeptidase domain 17 5 2
MIRT438159 PIK3C2A phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha 1 1
MIRT438209 CHEK1 checkpoint kinase 1 2 1
MIRT438638 TDG thymine-DNA glycosylase 1 1
MIRT438656 PHB prohibitin 3 1
MIRT444707 ZNF772 zinc finger protein 772 1 1
MIRT448615 OTUD4 OTU domain containing 4 1 1
MIRT451358 UQCR11 ubiquinol-cytochrome c reductase, complex III subunit XI 1 1
MIRT457292 ZBTB45 zinc finger and BTB domain containing 45 1 1
MIRT458763 CES2 carboxylesterase 2 1 1
MIRT458855 CD55 CD55 molecule, decay accelerating factor for complement (Cromer blood group) 1 1
MIRT460261 SLC26A2 solute carrier family 26 (sulfate transporter), member 2 1 1
MIRT461702 ZNF426 zinc finger protein 426 1 1
MIRT465730 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT466688 TAF13 TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa 1 2
MIRT468541 SERP1 stress-associated endoplasmic reticulum protein 1 1 1
MIRT468809 SACS spastic ataxia of Charlevoix-Saguenay (sacsin) 1 6
MIRT470198 PSAT1 phosphoserine aminotransferase 1 1 3
MIRT476009 GTF2A1 general transcription factor IIA, 1, 19/37kDa 1 4
MIRT477228 ETF1 eukaryotic translation termination factor 1 1 2
MIRT477752 EDEM3 ER degradation enhancer, mannosidase alpha-like 3 1 1
MIRT478346 DDIT4 DNA-damage-inducible transcript 4 1 1
MIRT478525 CTNS cystinosin, lysosomal cystine transporter 1 1
MIRT480793 BLOC1S2 biogenesis of lysosomal organelles complex-1, subunit 2 1 3
MIRT482242 AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon) 1 1
MIRT486465 MDM2 Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse) 1 5
MIRT487561 LOXL2 lysyl oxidase-like 2 1 1
MIRT498663 ZNF664 zinc finger protein 664 1 4
MIRT499509 RNF6 ring finger protein (C3H2C3 type) 6 1 3
MIRT502456 FRAT2 frequently rearranged in advanced T-cell lymphomas 2 1 3
MIRT502713 CREBZF CREB/ATF bZIP transcription factor 1 3
MIRT502853 CHEK2 checkpoint kinase 2 1 3
MIRT507558 DEPDC1 DEP domain containing 1 1 3
MIRT524742 BRCA1 breast cancer 1, early onset 1 1
MIRT527178 LRRTM4 leucine rich repeat transmembrane neuronal 4 1 1
MIRT527909 B3GALT5 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5 1 1
MIRT532895 ZNF451 zinc finger protein 451 1 1
MIRT533588 TOB1 transducer of ERBB2, 1 1 4
MIRT534368 SETD8 SET domain containing (lysine methyltransferase) 8 1 2
MIRT535060 PPP2R5D protein phosphatase 2, regulatory subunit B', delta 1 2
MIRT536204 MAD2L1 MAD2 mitotic arrest deficient-like 1 (yeast) 1 1
MIRT537233 GALNT3 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3) 1 1
MIRT539774 KIAA0408 KIAA0408 1 3
MIRT540867 ZBTB24 zinc finger and BTB domain containing 24 1 1
MIRT541042 SOGA3 SOGA family member 3 1 3
MIRT541350 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 1
MIRT544949 TUB tubby homolog (mouse) 1 2
MIRT545809 ZNF608 zinc finger protein 608 1 1
MIRT547008 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT551188 EPB41L3 erythrocyte membrane protein band 4.1-like 3 1 1
MIRT551973 TMEM19 transmembrane protein 19 1 1
MIRT552044 ALG1 asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT553325 TSC22D2 TSC22 domain family, member 2 1 1
MIRT554367 SFPQ splicing factor proline/glutamine-rich 1 1
MIRT555741 PDCD10 programmed cell death 10 1 1
MIRT556346 MAN2A1 mannosidase, alpha, class 2A, member 1 1 2
MIRT560389 TMEM254 transmembrane protein 254 1 1
MIRT560465 SMIM9 chromosome X open reading frame 68 1 1
MIRT561122 ATP2B1 ATPase, Ca++ transporting, plasma membrane 1 1 1
MIRT562626 ARNTL2 aryl hydrocarbon receptor nuclear translocator-like 2 1 1
MIRT564084 NSA2 NSA2 ribosome biogenesis homolog (S. cerevisiae) 1 1
MIRT564207 SDE2 SDE2 telomere maintenance homolog (S. pombe) 1 1
MIRT565191 TSHZ1 teashirt zinc finger homeobox 1 1 1
MIRT567887 CSTF2 cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa 1 1
MIRT568259 BMP2K BMP2 inducible kinase 1 1
MIRT568505 ARF1 ADP-ribosylation factor 1 1 1
MIRT572178 CDV3 CDV3 homolog (mouse) 1 1
MIRT574711 HAUS8 HAUS augmin-like complex, subunit 8 1 2
MIRT610597 NUS1 nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) 1 1
MIRT614445 WDR92 WD repeat domain 92 1 1
MIRT615442 FAXC failed axon connections homolog (Drosophila) 1 1
MIRT618503 HSPD1 heat shock 60kDa protein 1 (chaperonin) 1 1
MIRT618903 CDK9 cyclin-dependent kinase 9 1 1
MIRT620083 TNFAIP8L1 tumor necrosis factor, alpha-induced protein 8-like 1 1 1
MIRT620286 GLTP glycolipid transfer protein 1 1
MIRT622464 RNF11 ring finger protein 11 1 1
MIRT624644 ASXL3 additional sex combs like 3 (Drosophila) 1 1
MIRT624697 AQR aquarius homolog (mouse) 1 1
MIRT625256 ZNF566 zinc finger protein 566 1 1
MIRT628258 EFCAB14 KIAA0494 1 1
MIRT628872 FAM177A1 family with sequence similarity 177, member A1 1 1
MIRT630720 FPR1 formyl peptide receptor 1 1 1
MIRT631887 SLFN13 schlafen family member 13 1 1
MIRT637716 MYOZ3 myozenin 3 1 1
MIRT639892 SSR3 signal sequence receptor, gamma (translocon-associated protein gamma) 1 1
MIRT642506 ORC6 origin recognition complex, subunit 6 1 1
MIRT644723 SEPT14 septin 14 1 1
MIRT645341 AGTPBP1 ATP/GTP binding protein 1 1 1
MIRT648886 TUBGCP5 tubulin, gamma complex associated protein 5 1 1
MIRT653565 SLC35B3 solute carrier family 35, member B3 1 1
MIRT654878 PP13439 uncharacterized LOC100128046 1 1
MIRT656095 MTA3 metastasis associated 1 family, member 3 1 1
MIRT660204 BMPR1A bone morphogenetic protein receptor, type IA 1 1
MIRT660753 ALDH6A1 aldehyde dehydrogenase 6 family, member A1 1 1
MIRT661379 RHCG Rh family, C glycoprotein 1 1
MIRT662310 ADM2 adrenomedullin 2 1 1
MIRT662628 MCM8 minichromosome maintenance complex component 8 1 1
MIRT663688 ZNF347 zinc finger protein 347 1 1
MIRT665109 FKTN fukutin 1 1
MIRT665262 ZKSCAN1 zinc finger with KRAB and SCAN domains 1 1 1
MIRT666273 SLC31A1 solute carrier family 31 (copper transporters), member 1 1 1
MIRT666646 RBM48 RNA binding motif protein 48 1 1
MIRT667511 LUC7L2 LUC7-like 2 (S. cerevisiae) 1 1
MIRT669228 C7orf55-LUC7L2 C7orf55-LUC7L2 readthrough 1 1
MIRT669271 C1orf50 chromosome 1 open reading frame 50 1 1
MIRT671783 RGS17 regulator of G-protein signaling 17 1 1
MIRT672379 RPL37 ribosomal protein L37 1 1
MIRT673464 KDELR1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 1 1
MIRT673600 HPSE heparanase 1 2
MIRT676269 NWD1 NACHT and WD repeat domain containing 1 1 1
MIRT676514 RNF216 ring finger protein 216 1 1
MIRT676653 LRRC27 leucine rich repeat containing 27 1 1
MIRT677335 PHAX phosphorylated adaptor for RNA export 1 1
MIRT677523 OCIAD2 OCIA domain containing 2 1 1
MIRT677548 C19orf52 chromosome 19 open reading frame 52 1 1
MIRT677724 SSR1 signal sequence receptor, alpha 1 1
MIRT677800 PNPLA3 patatin-like phospholipase domain containing 3 1 1
MIRT677885 DCP1A DCP1 decapping enzyme homolog A (S. cerevisiae) 1 1
MIRT678104 MICA MHC class I polypeptide-related sequence A 1 1
MIRT678431 PDE4C phosphodiesterase 4C, cAMP-specific 1 1
MIRT678488 ARHGEF39 Rho guanine nucleotide exchange factor (GEF) 39 1 1
MIRT678898 TTLL12 tubulin tyrosine ligase-like family, member 12 1 1
MIRT679296 SSBP2 single-stranded DNA binding protein 2 1 1
MIRT679572 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 1 1
MIRT680003 ZNF860 zinc finger protein 860 1 1
MIRT694963 PLAC8 placenta-specific 8 1 1
MIRT697861 UBE2H ubiquitin-conjugating enzyme E2H 1 1
MIRT698310 TMEM2 transmembrane protein 2 1 1
MIRT701712 MTMR12 myotubularin related protein 12 1 1
MIRT705964 ACBD5 acyl-CoA binding domain containing 5 1 1
MIRT714342 DIP2A DIP2 disco-interacting protein 2 homolog A (Drosophila) 1 1
MIRT715309 POLR2E polymerase (RNA) II (DNA directed) polypeptide E, 25kDa 1 1
MIRT717477 PDE4DIP phosphodiesterase 4D interacting protein 1 1
MIRT719604 PRKX protein kinase, X-linked 1 1
MIRT724483 CSNK1A1 casein kinase 1, alpha 1 1 1
MIRT726021 ZNF680 zinc finger protein 680 1 1
MIRT726041 ZNF254 zinc finger protein 254 1 1
MIRT726096 WNT5A wingless-type MMTV integration site family, member 5A 1 1
MIRT726288 TMEM30A transmembrane protein 30A 1 1
MIRT726312 TMCC1 transmembrane and coiled-coil domain family 1 1 1
MIRT726446 SSH2 slingshot homolog 2 (Drosophila) 1 1
MIRT726486 SMEK1 SMEK homolog 1, suppressor of mek1 (Dictyostelium) 1 1
MIRT726514 SLC7A1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT726535 SLC38A2 solute carrier family 38, member 2 1 1
MIRT726657 SASS6 spindle assembly 6 homolog (C. elegans) 1 1
MIRT726778 REEP4 receptor accessory protein 4 1 1
MIRT726937 PIK3R4 phosphoinositide-3-kinase, regulatory subunit 4 1 1
MIRT726989 PDE4B phosphodiesterase 4B, cAMP-specific 1 1
MIRT727060 NUDT19 nudix (nucleoside diphosphate linked moiety X)-type motif 19 1 1
MIRT727062 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT727485 HSPA13 heat shock protein 70kDa family, member 13 1 1
MIRT727488 HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 1 1
MIRT727508 HECTD3 HECT domain containing E3 ubiquitin protein ligase 3 1 1
MIRT727675 FBXO11 F-box protein 11 1 1
MIRT727780 ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 1 1
MIRT727786 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 1
MIRT727793 EHD1 EH-domain containing 1 1 1
MIRT727863 DNMBP dynamin binding protein 1 1
MIRT727903 DCTN4 dynactin 4 (p62) 1 1
MIRT727941 CPSF2 cleavage and polyadenylation specific factor 2, 100kDa 1 1
MIRT727966 COX5A cytochrome c oxidase subunit Va 1 1
MIRT728000 CHORDC1 cysteine and histidine-rich domain (CHORD) containing 1 1 1
MIRT728203 BID BH3 interacting domain death agonist 1 1
MIRT728213 BCL7B B-cell CLL/lymphoma 7B 1 1
MIRT728306 ARPP19 cAMP-regulated phosphoprotein, 19kDa 1 1
MIRT728331 AP1S3 adaptor-related protein complex 1, sigma 3 subunit 1 1
MIRT728396 ACSL3 acyl-CoA synthetase long-chain family member 3 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*