Accession ID: MIRT050169 [miRNA, hsa-miR-26a-5p :: MSH6, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-26a-1LinkOut: [miRBase ]
Synonyms MIR26A, MIRN26A1, MIR26A1
Description Homo sapiens miR-26a-1 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-26a-5p
Mature Sequence 10| UUCAAGUAAUCCAGGAUAGGCU |31
Evidence Experimental
Experiments Cloned
Putative hsa-miR-26a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MSH6 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms GTBP, HNPCC5, HSAP
Description mutS homolog 6 (E. coli)
Transcript NM_0001    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MSH6 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MSH6
(miRNA target sites are highlighted)
>MSH6|NM_0001|3'UTR
   1 TAGACTGACTACATTGGAAGCTTTGAGTTGACTTCTGACAAAGGTGGTAAATTCAGACAACATTATGATCTAATAAACTT
  81 TATTTTTTAAAAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
 161 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucggAUAGGACCUAAUG-AACUu 5'
              ||  || || ||| |||: 
Target 5' ----TAGACT-GACTACATTGGa 3'
1 - 18 105.00 -5.99
2
miRNA  3' ucggaUAGGACCU-AA-UGA--ACUU- 5'
               | |:| || || |||  |||  
Target 5' ttggaAGCTTTGAGTTGACTTCTGACA 3'
14 - 40 77.00 -6.65
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-26a-5p :: MSH6    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
181 hsa-miR-26a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000109 HMGA2 high mobility group AT-hook 2 4 3
MIRT000110 HMGA1 high mobility group AT-hook 1 3 3
MIRT000111 CCNE2 cyclin E2 3 1
MIRT000112 CCND2 cyclin D2 3 2
MIRT001021 CDK8 cyclin-dependent kinase 8 2 2
MIRT001022 CDC6 cell division cycle 6 homolog (S. cerevisiae) 2 2
MIRT001039 LIF leukemia inhibitory factor (cholinergic differentiation factor) 1 2
MIRT001095 PTEN phosphatase and tensin homolog 3 5
MIRT001771 EZH2 enhancer of zeste homolog 2 (Drosophila) 5 9
MIRT001772 PLAG1 pleiomorphic adenoma gene 1 3 2
MIRT002315 SERBP1 SERPINE1 mRNA binding protein 1 3 3
MIRT002340 SMAD1 SMAD family member 1 3 5
MIRT003212 MAP3K2 mitogen-activated protein kinase kinase kinase 2 3 2
MIRT003213 RB1 retinoblastoma 1 5 2
MIRT003803 SMAD4 SMAD family member 4 3 3
MIRT003968 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 2 2
MIRT004338 CTGF connective tissue growth factor 2 2
MIRT004339 STRADB STE20-related kinase adaptor beta 2 2
MIRT004615 IFNB1 interferon, beta 1, fibroblast 3 2
MIRT004676 GSK3B glycogen synthase kinase 3 beta 5 2
MIRT005587 CPEB2 cytoplasmic polyadenylation element binding protein 2 3 2
MIRT005588 CPEB3 cytoplasmic polyadenylation element binding protein 3 4 2
MIRT005589 CPEB4 cytoplasmic polyadenylation element binding protein 4 3 2
MIRT005751 GDAP1 ganglioside-induced differentiation-associated protein 1 3 1
MIRT005920 MTDH metadherin 3 1
MIRT006306 CDK6 cyclin-dependent kinase 6 2 1
MIRT006309 CCNE1 cyclin E1 2 1
MIRT006389 ESR1 estrogen receptor 1 1 1
MIRT006711 ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1 2 1
MIRT006712 ARL4C ADP-ribosylation factor-like 4C 2 1
MIRT007177 E2F7 E2F transcription factor 7 1 1
MIRT007347 NOS2 nitric oxide synthase 2, inducible 2 1
MIRT007374 IL6 interleukin 6 (interferon, beta 2) 1 1
MIRT030358 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 1 1
MIRT050053 HIST1H4E histone cluster 1, H4e 1 1
MIRT050054 ZNF814 zinc finger protein 814 1 1
MIRT050055 ZNF233 zinc finger protein 233 1 1
MIRT050056 ABCB7 ATP-binding cassette, sub-family B (MDR/TAP), member 7 1 1
MIRT050057 SCRN1 secernin 1 1 1
MIRT050058 NABP1 oligonucleotide/oligosaccharide-binding fold containing 2A 1 1
MIRT050059 FAM20B family with sequence similarity 20, member B 1 1
MIRT050060 ARCN1 archain 1 1 1
MIRT050061 ANO3 anoctamin 3 1 1
MIRT050062 TFAM transcription factor A, mitochondrial 1 1
MIRT050063 FER fer (fps/fes related) tyrosine kinase 1 1
MIRT050064 HIAT1 hippocampus abundant transcript 1 1 1
MIRT050065 PPP1CC protein phosphatase 1, catalytic subunit, gamma isozyme 1 1
MIRT050066 SLC35B4 solute carrier family 35, member B4 1 1
MIRT050067 RASA1 RAS p21 protein activator (GTPase activating protein) 1 1 1
MIRT050068 COX1 cytochrome c oxidase subunit I 1 1
MIRT050069 MSL3 male-specific lethal 3 homolog (Drosophila) 1 1
MIRT050070 GGA2 golgi-associated, gamma adaptin ear containing, ARF binding protein 2 1 1
MIRT050071 GIT2 G protein-coupled receptor kinase interacting ArfGAP 2 1 1
MIRT050072 DNMT1 DNA (cytosine-5-)-methyltransferase 1 1 1
MIRT050073 MFHAS1 malignant fibrous histiocytoma amplified sequence 1 1 1
MIRT050074 UBA2 ubiquitin-like modifier activating enzyme 2 1 1
MIRT050075 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT050076 MTRF1 mitochondrial translational release factor 1 1 1
MIRT050077 WBSCR16 Williams-Beuren syndrome chromosome region 16 1 1
MIRT050078 NUAK1 NUAK family, SNF1-like kinase, 1 1 1
MIRT050079 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT050080 PNMA2 paraneoplastic antigen MA2 1 1
MIRT050081 ACTL8 actin-like 8 1 1
MIRT050082 HSPA8 heat shock 70kDa protein 8 1 1
MIRT050083 DHX15 DEAH (Asp-Glu-Ala-His) box polypeptide 15 1 1
MIRT050084 TCP1 t-complex 1 1 1
MIRT050085 SLC25A5 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5 1 1
MIRT050086 LSM14A LSM14A, SCD6 homolog A (S. cerevisiae) 1 1
MIRT050087 CAMKV CaM kinase-like vesicle-associated 1 1
MIRT050088 ALG10B asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast) 1 1
MIRT050089 TYW1 tRNA-yW synthesizing protein 1 homolog (S. cerevisiae) 1 1
MIRT050090 RPL13A ribosomal protein L13a 1 1
MIRT050091 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT050092 TXLNG taxilin gamma 1 1
MIRT050093 RAB18 RAB18, member RAS oncogene family 1 1
MIRT050094 RPS27A ribosomal protein S27a 1 1
MIRT050095 RPS26 ribosomal protein S26 1 1
MIRT050096 PIKFYVE phosphoinositide kinase, FYVE finger containing 1 1
MIRT050097 TP53INP1 tumor protein p53 inducible nuclear protein 1 1 1
MIRT050098 ZNF703 zinc finger protein 703 1 1
MIRT050099 MTRF1L mitochondrial translational release factor 1-like 1 1
MIRT050100 ZNF506 zinc finger protein 506 1 1
MIRT050101 KCTD5 potassium channel tetramerisation domain containing 5 1 1
MIRT050102 CTC1 chromosome 17 open reading frame 68 1 1
MIRT050103 TKT transketolase 1 1
MIRT050104 LYST lysosomal trafficking regulator 1 1
MIRT050105 FAM134A family with sequence similarity 134, member A 1 1
MIRT050106 NKX2-5 NK2 transcription factor related, locus 5 (Drosophila) 1 1
MIRT050107 AURKAIP1 aurora kinase A interacting protein 1 1 1
MIRT050108 ATP1A1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 1 1
MIRT050109 COASY CoA synthase 1 1
MIRT050110 CTR9 Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT050111 COX3 cytochrome c oxidase III 1 1
MIRT050112 ELOVL6 ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) 1 1
MIRT050113 PIGT phosphatidylinositol glycan anchor biosynthesis, class T 1 1
MIRT050114 TMCC3 transmembrane and coiled-coil domain family 3 1 1
MIRT050115 ARHGEF1 Rho guanine nucleotide exchange factor (GEF) 1 1 1
MIRT050116 SHC2 SHC (Src homology 2 domain containing) transforming protein 2 1 1
MIRT050117 PSMA3 proteasome (prosome, macropain) subunit, alpha type, 3 1 1
MIRT050118 PTTG1 pituitary tumor-transforming 1 1 1
MIRT050119 RPS24 ribosomal protein S24 1 1
MIRT050120 SPTBN1 spectrin, beta, non-erythrocytic 1 1 1
MIRT050121 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT050122 BTBD3 BTB (POZ) domain containing 3 1 1
MIRT050123 AHR aryl hydrocarbon receptor 1 1
MIRT050124 EEF1B2 eukaryotic translation elongation factor 1 beta 2 1 1
MIRT050125 MRPL51 mitochondrial ribosomal protein L51 1 1
MIRT050126 SETD2 SET domain containing 2 1 1
MIRT050127 LRP6 low density lipoprotein receptor-related protein 6 1 1
MIRT050128 RHOBTB1 Rho-related BTB domain containing 1 1 1
MIRT050129 HIST1H4J histone cluster 1, H4j 1 1
MIRT050130 MYO10 myosin X 1 1
MIRT050131 ATP7B ATPase, Cu++ transporting, beta polypeptide 1 1
MIRT050132 CSRP2BP CSRP2 binding protein 1 1
MIRT050133 RBM39 RNA binding motif protein 39 1 1
MIRT050134 C14orf37 chromosome 14 open reading frame 37 1 1
MIRT050135 SFMBT1 Scm-like with four mbt domains 1 1 1
MIRT050136 KIAA1704 KIAA1704 1 1
MIRT050137 ABCB9 ATP-binding cassette, sub-family B (MDR/TAP), member 9 1 1
MIRT050138 ADM adrenomedullin 1 1
MIRT050139 USP7 ubiquitin specific peptidase 7 (herpes virus-associated) 1 1
MIRT050140 TTN titin 1 1
MIRT050141 HNRNPU heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A) 1 1
MIRT050142 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 1
MIRT050143 CEPT1 choline/ethanolamine phosphotransferase 1 1 1
MIRT050144 HOXC8 homeobox C8 1 1
MIRT050145 CTBP1 C-terminal binding protein 1 1 1
MIRT050146 SET SET nuclear oncogene 1 1
MIRT050147 MCM3AP minichromosome maintenance complex component 3 associated protein 1 1
MIRT050148 TPGS2 chromosome 18 open reading frame 10 1 1
MIRT050149 CA2 carbonic anhydrase II 1 1
MIRT050150 PCYT1A phosphate cytidylyltransferase 1, choline, alpha 1 1
MIRT050151 ACTN4 actinin, alpha 4 1 1
MIRT050152 EPG5 KIAA1632 1 1
MIRT050153 OLA1 Obg-like ATPase 1 1 1
MIRT050154 RRM2 ribonucleotide reductase M2 1 1
MIRT050155 BBX bobby sox homolog (Drosophila) 1 1
MIRT050156 NUP205 nucleoporin 205kDa 1 1
MIRT050157 C6orf47 chromosome 6 open reading frame 47 1 1
MIRT050158 CFLAR CASP8 and FADD-like apoptosis regulator 1 1
MIRT050159 SEC31A SEC31 homolog A (S. cerevisiae) 1 1
MIRT050160 GLG1 golgi glycoprotein 1 1 1
MIRT050161 TBC1D16 TBC1 domain family, member 16 1 1
MIRT050162 BTBD9 BTB (POZ) domain containing 9 1 1
MIRT050163 RND2 Rho family GTPase 2 1 1
MIRT050164 TUBG1 tubulin, gamma 1 1 1
MIRT050165 AHRR aryl-hydrocarbon receptor repressor 1 1
MIRT050166 CNTD2 cyclin N-terminal domain containing 2 1 1
MIRT050167 UBE2A ubiquitin-conjugating enzyme E2A (RAD6 homolog) 1 1
MIRT050168 CCDC43 coiled-coil domain containing 43 1 1
MIRT050169 MSH6 mutS homolog 6 (E. coli) 1 1
MIRT050170 HIST4H4 histone cluster 4, H4 1 1
MIRT050171 C17orf51 chromosome 17 open reading frame 51 1 1
MIRT050172 SLC25A30 solute carrier family 25, member 30 1 1
MIRT050173 USB1 chromosome 16 open reading frame 57 1 1
MIRT050174 MYH10 myosin, heavy chain 10, non-muscle 1 1
MIRT050175 LINS lines homolog 1 (Drosophila) 1 1
MIRT050176 UBR4 ubiquitin protein ligase E3 component n-recognin 4 1 1
MIRT050177 ZNF207 zinc finger protein 207 1 1
MIRT050178 OGT O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase) 1 1
MIRT050179 TXNL1 thioredoxin-like 1 1 1
MIRT050180 FOXO3 forkhead box O3 1 1
MIRT050181 COPB1 coatomer protein complex, subunit beta 1 1 1
MIRT050182 FASN fatty acid synthase 1 1
MIRT050183 SARS seryl-tRNA synthetase 1 1
MIRT050184 DDB1 damage-specific DNA binding protein 1, 127kDa 1 1
MIRT050185 PPIA peptidylprolyl isomerase A (cyclophilin A) 1 1
MIRT050186 SLC35A4 solute carrier family 35, member A4 1 1
MIRT050187 TXNDC11 thioredoxin domain containing 11 1 1
MIRT050188 HIST2H2AA3 histone cluster 2, H2aa3 1 1
MIRT050189 TRAP1 TNF receptor-associated protein 1 1 1
MIRT050190 SDCBP syndecan binding protein (syntenin) 1 1
MIRT050191 ASCC2 activating signal cointegrator 1 complex subunit 2 1 1
MIRT050192 KDM5C lysine (K)-specific demethylase 5C 1 1
MIRT050193 DST dystonin 1 1
MIRT050194 CLIC4 chloride intracellular channel 4 1 1
MIRT050195 WWP2 WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT050196 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT050197 RPL13 ribosomal protein L13 1 1
MIRT050198 CNBP CCHC-type zinc finger, nucleic acid binding protein 1 1
MIRT052649 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1