Accession ID: MIRT050304 [miRNA, hsa-miR-25-3p :: HSP90AA1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-25LinkOut: [miRBase ]
Synonyms MIRN25, hsa-mir-25, miR-25, MIR25
Description Homo sapiens miR-25 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-25-3p
Mature Sequence 52| CAUUGCACUUGUCUCGGUCUGA |73
Evidence Experimental
Experiments Cloned
Putative hsa-miR-25-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol HSP90AA1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms HSP86, HSP89A, HSP90A, HSP90N, HSPC1, HSPCA, HSPCAL1, HSPCAL4, HSPN, Hsp89, Hsp90, LAP2
Description heat shock protein 90kDa alpha (cytosolic), class A member 1
Transcript NM_001017963    LinkOut: [ RefSeq ]
Other Transcripts NM_005348   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on HSP90AA1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of HSP90AA1
(miRNA target sites are highlighted)
>HSP90AA1|NM_001017963|3'UTR
   1 TCTCTGGCTGAGGGATGACTTACCTGTTCAGTACTCTACAATTCCTCTGATAATATATTTTCAAGGATGTTTTTCTTTAT
  81 TTTTGTTAATATTAAAAAGTCTGTATGGCATGACAACTACTTTAAGGGGAAGATAAGATTTCTGTCTACTAAGTGATGCT
 161 GTGATACCTTAGGCACTAAAGCAGAGCTAGTAATGCTTTTTGAGTTTCATGTTGGTTTATTTTCACAGATTGGGGTAACG
 241 TGCACTGTAAGACGTATGTAACATGATGTTAACTTTGTGGTCTAAAGTGTTTAGCTGTCAAGCCGGATGCCTAAGTAGAC
 321 CAAATCTTGTTATTGAAGTGTTCTGAGCTGTATCTTGATGTTTAGAAAAGTATTCGTTACATCTTGTAGGATCTACTTTT
 401 TGAACTTTTCATTCCCTGTAGTTGACAATTCTGCATGTACTAGTCCTCTAGAAATAGGTTAAACTGAAGCAACTTGATGG
 481 AAGGATCTCTCCACAGGGCTTGTTTTCCAAAGAAAAGTATTGTTTGGAGGAGCAAAGTTAAAAGCCTACCTAAGCATATC
 561 GTAAAGCTGTTCAAAAATAACTCAGACCCAGTCTTGTGGATGGAAATGTAGTGCTCGAGTCACATTCTGCTTAAAGTTGT
 641 AACAAATACAGATGAGTTAAAAGATATTGTGTGACAGTGTCTTATTTAGGGGGAAAGGGGAGTATCTGGATGACAGTTAG
 721 TGCCAAAATGTAAAACATGAGGCGCTAGCAGGAGATGGTTAAACACTAGCTGCTCCAAGGGTTGACATGGTCTTCCCAGC
 801 ATGTACTCAGCAGGTGTGGGGTGGAGCACACGTAGGCACAGAAAACAGGAATGCAGACAACATGCATCCCCTGCGTCCAT
 881 GAGTTACATGTGTTCTCTTAGTGTCCACGTTGTTTTGATGTTATTCATGGAATACCTTCTGTGTTAAATACAGTCACTTA
 961 ATTCCTTGGCCTTA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' agUCUGGCUCUGUU-CACGUUAc 5'
            |||::|:|::|| ||||| | 
Target 5' acAGATTGGGGTAACGTGCACTg 3'
225 - 247 140.00 -24.00
2
miRNA  3' agUC-UGG--CU-CUGU---UCACG---UUAc 5'
            || |:|  || ||||   |||||   ||| 
Target 5' ggAGTATCTGGATGACAGTTAGTGCCAAAATg 3'
699 - 730 110.00 -12.10
3
miRNA  3' aguCUGGCU--CUGUU-------CACGUUAc 5'
             |:|:||  ||::|       || ||:| 
Target 5' tctGGCTGAGGGATGACTTACCTGTTCAGTa 3'
3 - 33 101.00 -11.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-25-3p :: HSP90AA1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
440 hsa-miR-25-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000983 PRMT5 protein arginine methyltransferase 5 2 1
MIRT001107 CORO1A coronin, actin binding protein, 1A 1 1
MIRT003413 BCL2L11 BCL2-like 11 (apoptosis facilitator) 6 10
MIRT003605 KLF4 Kruppel-like factor 4 (gut) 2 1
MIRT004317 CDKN1C cyclin-dependent kinase inhibitor 1C (p57, Kip2) 4 1
MIRT004329 KAT2B K(lysine) acetyltransferase 2B 3 1
MIRT005417 TP53 tumor protein p53 4 1
MIRT006119 WDR4 WD repeat domain 4 3 1
MIRT006230 CDH1 cadherin 1, type 1, E-cadherin (epithelial) 3 1
MIRT006454 CCL26 chemokine (C-C motif) ligand 26 3 1
MIRT006632 MDM2 Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse) 4 2
MIRT006746 PTEN phosphatase and tensin homolog 1 1
MIRT006919 EZH2 enhancer of zeste homolog 2 (Drosophila) 3 1
MIRT007242 SMAD7 SMAD family member 7 3 2
MIRT030359 TAF6L TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa 1 1
MIRT030360 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT050199 NDNL2 necdin-like 2 1 1
MIRT050200 NDUFAF3 NADH dehydrogenase (ubiquinone) complex I, assembly factor 3 1 1
MIRT050201 TNPO2 transportin 2 1 1
MIRT050202 ANKRD18A ankyrin repeat domain 18A 1 1
MIRT050203 PGRMC1 progesterone receptor membrane component 1 1 1
MIRT050204 RPSA ribosomal protein SA 1 1
MIRT050205 CDK4 cyclin-dependent kinase 4 1 1
MIRT050206 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT050207 TMEM173 transmembrane protein 173 1 1
MIRT050208 NAT1 N-acetyltransferase 1 (arylamine N-acetyltransferase) 1 1
MIRT050209 NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) 1 1
MIRT050210 CCNE2 cyclin E2 1 1
MIRT050211 NDE1 nudE nuclear distribution E homolog 1 (A. nidulans) 1 1
MIRT050212 C2CD5 KIAA0528 1 1
MIRT050213 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT050214 CHRAC1 chromatin accessibility complex 1 1 1
MIRT050215 ACTL6A actin-like 6A 1 1
MIRT050216 EIF5A2 eukaryotic translation initiation factor 5A2 1 1
MIRT050217 CNOT11 chromosome 2 open reading frame 29 1 1
MIRT050218 UBR1 ubiquitin protein ligase E3 component n-recognin 1 1 1
MIRT050219 SMAP1 small ArfGAP 1 1 1
MIRT050220 EP300 E1A binding protein p300 1 1
MIRT050221 ZNF557 zinc finger protein 557 1 1
MIRT050222 SLC4A7 solute carrier family 4, sodium bicarbonate cotransporter, member 7 1 1
MIRT050223 RNASEH2A ribonuclease H2, subunit A 1 1
MIRT050224 ACSS1 acyl-CoA synthetase short-chain family member 1 1 1
MIRT050225 DKK4 dickkopf homolog 4 (Xenopus laevis) 1 1
MIRT050226 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT050227 STAG1 stromal antigen 1 1 1
MIRT050228 BTBD7 BTB (POZ) domain containing 7 1 1
MIRT050229 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT050230 CTSE cathepsin E 1 1
MIRT050231 HIST2H2BF histone cluster 2, H2bf 1 1
MIRT050232 ZNF682 zinc finger protein 682 1 1
MIRT050233 HYAL1 hyaluronoglucosaminidase 1 1 1
MIRT050234 ANKIB1 ankyrin repeat and IBR domain containing 1 1 1
MIRT050235 DDX49 DEAD (Asp-Glu-Ala-Asp) box polypeptide 49 1 1
MIRT050236 ARPC5L actin related protein 2/3 complex, subunit 5-like 1 1
MIRT050237 ARPC3 actin related protein 2/3 complex, subunit 3, 21kDa 1 1
MIRT050238 SMAP2 small ArfGAP2 1 1
MIRT050239 BPTF bromodomain PHD finger transcription factor 1 1
MIRT050240 TUSC3 tumor suppressor candidate 3 1 1
MIRT050241 SRPR signal recognition particle receptor (docking protein) 1 1
MIRT050242 HIST2H2AA3 histone cluster 2, H2aa3 1 1
MIRT050243 ADAMTSL1 ADAMTS-like 1 1 1
MIRT050244 BZW1 basic leucine zipper and W2 domains 1 1 1
MIRT050245 CHCHD10 coiled-coil-helix-coiled-coil-helix domain containing 10 1 1
MIRT050246 EXOC6B exocyst complex component 6B 1 1
MIRT050247 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT050248 RCOR1 REST corepressor 1 1 1
MIRT050249 PEX5 peroxisomal biogenesis factor 5 1 1
MIRT050250 AP3M1 adaptor-related protein complex 3, mu 1 subunit 1 1
MIRT050251 LOXHD1 lipoxygenase homology domains 1 1 1
MIRT050252 TRAPPC2 trafficking protein particle complex 2 1 1
MIRT050253 RPS28 ribosomal protein S28 1 1
MIRT050254 STXBP1 syntaxin binding protein 1 1 1
MIRT050255 DNM1L dynamin 1-like 1 1
MIRT050256 DEAF1 deformed epidermal autoregulatory factor 1 (Drosophila) 1 1
MIRT050257 WDR11 WD repeat domain 11 1 1
MIRT050258 ACP1 acid phosphatase 1, soluble 1 1
MIRT050259 C10orf118 chromosome 10 open reading frame 118 1 1
MIRT050260 TVP23B family with sequence similarity 18, member B1 1 1
MIRT050261 ZDHHC8 zinc finger, DHHC-type containing 8 1 1
MIRT050262 CABIN1 calcineurin binding protein 1 1 1
MIRT050263 ZBTB8OS zinc finger and BTB domain containing 8 opposite strand 1 1
MIRT050264 ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) 1 1
MIRT050265 NHP2 NHP2 ribonucleoprotein homolog (yeast) 1 1
MIRT050266 TUBGCP4 tubulin, gamma complex associated protein 4 1 1
MIRT050267 MARCH6 membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase 1 1
MIRT050268 PDGFRL platelet-derived growth factor receptor-like 1 1
MIRT050269 TRAF3IP1 TNF receptor-associated factor 3 interacting protein 1 1 1
MIRT050270 TUBB tubulin, beta class I 1 1
MIRT050271 RPL7A ribosomal protein L7a 1 1
MIRT050272 PLEKHA5 pleckstrin homology domain containing, family A member 5 1 1
MIRT050273 RPS14 ribosomal protein S14 1 1
MIRT050274 DENND4A DENN/MADD domain containing 4A 1 1
MIRT050275 MLEC malectin 1 1
MIRT050276 DCTN1 dynactin 1 1 1
MIRT050277 FECH ferrochelatase 1 1
MIRT050278 PDXP pyridoxal (pyridoxine, vitamin B6) phosphatase 1 1
MIRT050279 XPC xeroderma pigmentosum, complementation group C 1 1
MIRT050280 NOL12 nucleolar protein 12 1 1
MIRT050281 PELO pelota homolog (Drosophila) 1 1
MIRT050282 SYNPR synaptoporin 1 1
MIRT050283 MBD1 methyl-CpG binding domain protein 1 1 1
MIRT050284 ETFA electron-transfer-flavoprotein, alpha polypeptide 1 1
MIRT050285 PRKAR1A protein kinase, cAMP-dependent, regulatory, type I, alpha 1 1
MIRT050286 SSRP1 structure specific recognition protein 1 1 1
MIRT050287 NOTCH2 notch 2 1 1
MIRT050288 DENND5A DENN/MADD domain containing 5A 1 1
MIRT050289 CEP170B KIAA0284 1 1
MIRT050290 PDK2 pyruvate dehydrogenase kinase, isozyme 2 1 1
MIRT050291 EME2 essential meiotic endonuclease 1 homolog 2 (S. pombe) 1 1
MIRT050292 FNBP1 formin binding protein 1 1 1
MIRT050293 SUPT16H suppressor of Ty 16 homolog (S. cerevisiae) 1 1
MIRT050294 COPS3 COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis) 1 1
MIRT050295 CCDC96 coiled-coil domain containing 96 1 1
MIRT050296 DHX9 DEAH (Asp-Glu-Ala-His) box polypeptide 9 1 1
MIRT050297 YBX1 Y box binding protein 1 1 1
MIRT050298 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT050299 RPL26 ribosomal protein L26 1 1
MIRT050300 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT050301 HMBS hydroxymethylbilane synthase 1 1
MIRT050302 EIF4B eukaryotic translation initiation factor 4B 1 1
MIRT050303 ATN1 atrophin 1 1 1
MIRT050304 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT050305 ITM2B integral membrane protein 2B 1 1
MIRT050306 UBAP2L ubiquitin associated protein 2-like 1 1
MIRT050307 CEP85 centrosomal protein 85kDa 1 1
MIRT050308 ELF4 E74-like factor 4 (ets domain transcription factor) 1 1
MIRT050309 RAPGEF1 Rap guanine nucleotide exchange factor (GEF) 1 1 1
MIRT050310 NRN1 neuritin 1 1 1
MIRT050311 TSHZ3 teashirt zinc finger homeobox 3 1 1
MIRT050312 SCAF4 SR-related CTD-associated factor 4 1 1
MIRT050313 PHB2 prohibitin 2 1 1
MIRT050314 CLSPN claspin 1 1
MIRT050315 SEMA4D sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D 1 1
MIRT050316 RYR2 ryanodine receptor 2 (cardiac) 1 1
MIRT050317 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT050318 EIF5A eukaryotic translation initiation factor 5A 1 1
MIRT050319 TLN1 talin 1 1 1
MIRT050320 CTNNBL1 catenin, beta like 1 1 1
MIRT050321 KIF23 kinesin family member 23 1 1
MIRT050322 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 1
MIRT050323 ARHGAP17 Rho GTPase activating protein 17 1 1
MIRT050324 SLC12A4 solute carrier family 12 (potassium/chloride transporters), member 4 1 1
MIRT050325 PHTF1 putative homeodomain transcription factor 1 1 1
MIRT050326 ANXA11 annexin A11 1 1
MIRT050327 GPR157 G protein-coupled receptor 157 1 1
MIRT050328 CTC1 CTS telomere maintenance complex component 1 1 1
MIRT050329 AIM1 absent in melanoma 1 1 1
MIRT050330 TUBB4B tubulin, beta 4B class IVb 1 1
MIRT050331 VMP1 vacuole membrane protein 1 1 1
MIRT050332 SNTB2 syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) 1 1
MIRT050333 EMD emerin 1 1
MIRT050334 DPH7 WD repeat domain 85 1 1
MIRT050335 PKDCC protein kinase domain containing, cytoplasmic homolog (mouse) 1 1
MIRT050336 ZNF346 zinc finger protein 346 1 1
MIRT050337 PRRC2A proline-rich coiled-coil 2A 1 1
MIRT050338 RNGTT RNA guanylyltransferase and 5'-phosphatase 1 1
MIRT050339 PCDH7 protocadherin 7 1 1
MIRT050340 TMUB1 transmembrane and ubiquitin-like domain containing 1 1 1
MIRT050341 NVL nuclear VCP-like 1 1
MIRT050342 SETD1B SET domain containing 1B 1 1
MIRT050343 HSPA8 heat shock 70kDa protein 8 1 1
MIRT050344 SERTAD3 SERTA domain containing 3 1 3
MIRT050345 TRAP1 TNF receptor-associated protein 1 1 1
MIRT050346 ASS1 argininosuccinate synthase 1 1 1
MIRT050347 MPP6 membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6) 1 1
MIRT050348 ROBO1 roundabout, axon guidance receptor, homolog 1 (Drosophila) 1 1
MIRT050349 NSMAF neutral sphingomyelinase (N-SMase) activation associated factor 1 1
MIRT050350 TSFM Ts translation elongation factor, mitochondrial 1 1
MIRT050351 PSMB4 proteasome (prosome, macropain) subunit, beta type, 4 1 1
MIRT050352 DDX23 DEAD (Asp-Glu-Ala-Asp) box polypeptide 23 1 1
MIRT050353 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT050354 RPS3A ribosomal protein S3A 1 1
MIRT050355 SNPH syntaphilin 1 1
MIRT050356 KCTD15 potassium channel tetramerisation domain containing 15 1 1
MIRT050357 SBNO2 strawberry notch homolog 2 (Drosophila) 1 1
MIRT050358 PARL presenilin associated, rhomboid-like 1 1
MIRT050359 GPBP1 GC-rich promoter binding protein 1 1 1
MIRT050360 KATNB1 katanin p80 (WD repeat containing) subunit B 1 1 1
MIRT050361 EZR ezrin 1 1
MIRT050362 PHKA1 phosphorylase kinase, alpha 1 (muscle) 1 1
MIRT050363 RBM27 RNA binding motif protein 27 1 2
MIRT050364 CLIC1 chloride intracellular channel 1 1 1
MIRT053236 DSC2 desmocollin 2 2 1
MIRT053291 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 3 1
MIRT053577 RECK reversion-inducing-cysteine-rich protein with kazal motifs 3 1
MIRT054118 ANKRD24 ankyrin repeat domain 24 1 1
MIRT054130 ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) 3 1
MIRT054219 TCEAL1 transcription elongation factor A (SII)-like 1 3 1
MIRT054312 LATS2 LATS, large tumor suppressor, homolog 2 (Drosophila) 3 1
MIRT054928 REV3L REV3-like, polymerase (DNA directed), zeta, catalytic subunit 2 2
MIRT055309 DUSP5 dual specificity phosphatase 5 1 4
MIRT055786 PLEKHA1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 1 6
MIRT057109 DDIT4 DNA-damage-inducible transcript 4 1 2
MIRT059659 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT059920 ZDHHC5 zinc finger, DHHC-type containing 5 1 1
MIRT061602 BTG2 BTG family, member 2 1 3
MIRT066473 HMGA2 high mobility group AT-hook 2 1 1
MIRT069383 ZFYVE21 zinc finger, FYVE domain containing 21 1 1
MIRT069968 GEMIN2 gem (nuclear organelle) associated protein 2 1 1
MIRT074761 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 1 1
MIRT076195 GID4 GID complex subunit 4, VID24 homolog (S. cerevisiae) 1 3
MIRT077509 UBE2Z ubiquitin-conjugating enzyme E2Z 1 2
MIRT077897 TOB1 transducer of ERBB2, 1 1 3
MIRT082244 MED29 mediator complex subunit 29 1 2
MIRT082430 CIC capicua homolog (Drosophila) 1 3
MIRT082468 PPP1R37 protein phosphatase 1, regulatory subunit 37 1 1
MIRT082774 ZNF264 zinc finger protein 264 1 1
MIRT085305 UBXN4 UBX domain protein 4 1 4
MIRT086357 SSFA2 sperm specific antigen 2 1 4
MIRT087451 NF2 neurofibromin 2 (merlin) 1 1
MIRT088861 FOXN2 forkhead box N2 1 6
MIRT092181 ITPR1 inositol 1,4,5-trisphosphate receptor, type 1 1 3
MIRT092323 EDEM1 ER degradation enhancer, mannosidase alpha-like 1 1 3
MIRT093529 GALNT7 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) 1 3
MIRT096931 PAPD7 PAP associated domain containing 7 1 4
MIRT097023 MAP1B microtubule-associated protein 1B 1 2
MIRT099134 MYLIP myosin regulatory light chain interacting protein 1 3
MIRT099901 SOX4 SRY (sex determining region Y)-box 4 1 6
MIRT102286 DNAJB9 DnaJ (Hsp40) homolog, subfamily B, member 9 1 5
MIRT102500 KLHDC10 kelch domain containing 10 1 1
MIRT102887 INSIG1 insulin induced gene 1 1 1
MIRT109180 VMA21 VMA21 vacuolar H+-ATPase homolog (S. cerevisiae) 1 2
MIRT124564 PRRC2B proline-rich coiled-coil 2B 1 1
MIRT135559 SPRYD4 SPRY domain containing 4 1 1
MIRT161121 SLC25A36 solute carrier family 25 (pyrimidine nucleotide carrier ), member 36 1 3
MIRT163985 KIAA1109 KIAA1109 1 2
MIRT164685 RNF4 ring finger protein 4 1 1
MIRT167703 HIVEP1 human immunodeficiency virus type I enhancer binding protein 1 1 4
MIRT178953 USP28 ubiquitin specific peptidase 28 1 1
MIRT185711 ARNTL2 aryl hydrocarbon receptor nuclear translocator-like 2 1 1
MIRT186259 TCEB3 transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A) 1 1
MIRT186532 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 1 2
MIRT186621 COX20 COX20 Cox2 chaperone homolog (S. cerevisiae) 1 4
MIRT189370 TXLNA taxilin alpha 1 2
MIRT197009 EIF1 eukaryotic translation initiation factor 1 1 5
MIRT206433 YIPF4 Yip1 domain family, member 4 1 1
MIRT211223 FGF2 fibroblast growth factor 2 (basic) 1 5
MIRT214525 C5ORF24 chromosome 5 open reading frame 24 1 1
MIRT216029 IL6ST interleukin 6 signal transducer (gp130, oncostatin M receptor) 1 5
MIRT218081 TULP4 tubby like protein 4 1 1
MIRT242415 CCDC113 coiled-coil domain containing 113 1 1
MIRT243158 SOX11 SRY (sex determining region Y)-box 11 1 1
MIRT250939 CDK5R1 cyclin-dependent kinase 5, regulatory subunit 1 (p35) 1 2
MIRT253345 ZNF417 zinc finger protein 417 1 1
MIRT271962 ARF1 ADP-ribosylation factor 1 1 1
MIRT273210 ZNF695 zinc finger protein 695 1 2
MIRT296110 SLC12A5 solute carrier family 12 (potassium/chloride transporter), member 5 1 1
MIRT301706 TEF thyrotrophic embryonic factor 1 1
MIRT316474 ARID1B AT rich interactive domain 1B (SWI1-like) 1 3
MIRT322170 CLN8 ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation) 1 2
MIRT341534 CNIH1 cornichon homolog (Drosophila) 1 3
MIRT356058 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 1 1
MIRT438342 FBXW7 F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase 3 1
MIRT438482 HAND2 heart and neural crest derivatives expressed 2 1 1
MIRT438796 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 1 2
MIRT443582 PPIC peptidylprolyl isomerase C (cyclophilin C) 1 1
MIRT448826 FKBP1A FK506 binding protein 1A, 12kDa 1 2
MIRT451496 FOPNL FGFR1OP N-terminal like 1 1
MIRT453170 CNOT4 CCR4-NOT transcription complex, subunit 4 1 3
MIRT454591 SLC33A1 solute carrier family 33 (acetyl-CoA transporter), member 1 1 2
MIRT455797 TAF8 TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa 1 2
MIRT456013 CYP2C19 cytochrome P450, family 2, subfamily C, polypeptide 19 1 1
MIRT456047 KIAA1586 KIAA1586 1 1
MIRT456766 TMEM239 transmembrane protein 239 1 2
MIRT458072 NLRP9 NLR family, pyrin domain containing 9 1 1
MIRT459233 MRPS21 mitochondrial ribosomal protein S21 1 1
MIRT459536 MFF mitochondrial fission factor 1 3
MIRT459762 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 16kDa 1 1
MIRT460239 TNFRSF13C tumor necrosis factor receptor superfamily, member 13C 1 1
MIRT461107 OPA3 optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) 1 1
MIRT462927 ZNRF3 zinc and ring finger 3 1 1
MIRT463479 ZC3HAV1L zinc finger CCCH-type, antiviral 1-like 1 1
MIRT463519 ZBTB8B zinc finger and BTB domain containing 8B 1 2
MIRT465506 TOR1B torsin family 1, member B (torsin B) 1 1
MIRT469521 RBFOX2 RNA binding protein, fox-1 homolog (C. elegans) 2 1 4
MIRT470081 PTGES2 prostaglandin E synthase 2 1 1
MIRT471584 PARD6B par-6 partitioning defective 6 homolog beta (C. elegans) 1 1
MIRT473450 MCOLN2 mucolipin 2 1 4
MIRT475880 H3F3C H3 histone, family 3C 1 5
MIRT475913 H3F3B H3 histone, family 3B (H3.3B) 1 4
MIRT476198 GOLGA8A golgin A8 family, member A 1 5
MIRT476322 GM2A GM2 ganglioside activator 1 1
MIRT476672 FUT11 fucosyltransferase 11 (alpha (1,3) fucosyltransferase) 1 5
MIRT478369 DDI2 DNA-damage inducible 1 homolog 2 (S. cerevisiae) 1 1
MIRT479548 CDC5L CDC5 cell division cycle 5-like (S. pombe) 1 1
MIRT481027 BAZ2B bromodomain adjacent to zinc finger domain, 2B 1 1
MIRT491012 ATF7IP activating transcription factor 7 interacting protein 1 1
MIRT493171 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT494343 CASKIN1 CASK interacting protein 1 1 1
MIRT499090 ZDHHC21 zinc finger, DHHC-type containing 21 1 3
MIRT500031 ABCF2 ATP-binding cassette, sub-family F (GCN20), member 2 1 4
MIRT501297 RRN3 RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae) 1 2
MIRT503127 BCL11B B-cell CLL/lymphoma 11B (zinc finger protein) 1 4
MIRT503304 GTF2A1 general transcription factor IIA, 1, 19/37kDa 1 3
MIRT504331 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504474 EID2B EP300 interacting inhibitor of differentiation 2B 1 1
MIRT504658 RPL9 ribosomal protein L9 1 3
MIRT505330 TMF1 TATA element modulatory factor 1 1 4
MIRT505828 RSBN1 round spermatid basic protein 1 1 4
MIRT506007 PURG purine-rich element binding protein G 1 4
MIRT506305 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 1 3
MIRT506805 KLHL15 kelch-like 15 (Drosophila) 1 3
MIRT507117 GOLGA8B golgin A8 family, member B 1 3
MIRT507356 FAM129A family with sequence similarity 129, member A 1 3
MIRT507587 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 2
MIRT507672 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 2
MIRT507706 CNOT2 CCR4-NOT transcription complex, subunit 2 1 4
MIRT508014 BCAT1 branched chain amino-acid transaminase 1, cytosolic 1 2
MIRT510442 ZIC5 Zic family member 5 1 3
MIRT510543 XKR7 XK, Kell blood group complex subunit-related family, member 7 1 2
MIRT510603 TPPP tubulin polymerization promoting protein 1 3
MIRT511063 NRAS neuroblastoma RAS viral (v-ras) oncogene homolog 1 2
MIRT511859 GOLGA8J golgin A8 family, member J 1 3
MIRT511862 GOLGA8I golgin A8 family, member I 1 3
MIRT512573 CTDSPL CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like 1 1
MIRT512711 ZNF134 zinc finger protein 134 1 3
MIRT513180 MOAP1 modulator of apoptosis 1 1 3
MIRT513784 PAWR PRKC, apoptosis, WT1, regulator 1 3
MIRT515102 IRGQ immunity-related GTPase family, Q 1 1
MIRT515484 INCENP inner centromere protein antigens 135/155kDa 1 2
MIRT517419 BMP8A bone morphogenetic protein 8a 1 1
MIRT518757 C1orf35 chromosome 1 open reading frame 35 1 1
MIRT519783 ZNF354B zinc finger protein 354B 1 2
MIRT519868 ZFP62 zinc finger protein 62 homolog (mouse) 1 3
MIRT520513 TRAM2 translocation associated membrane protein 2 1 3
MIRT521066 SLC25A32 solute carrier family 25 (mitochondrial folate carrier) , member 32 1 3
MIRT526915 ZNF772 zinc finger protein 772 1 3
MIRT527137 GULP1 GULP, engulfment adaptor PTB domain containing 1 1 1
MIRT527870 SLC39A14 solute carrier family 39 (zinc transporter), member 14 1 1
MIRT528407 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 1 1
MIRT532959 ZNF24 zinc finger protein 24 1 2
MIRT533019 ZFC3H1 zinc finger, C3H1-type containing 1 2
MIRT533195 WASL Wiskott-Aldrich syndrome-like 1 3
MIRT534190 SLC7A11 solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11 1 1
MIRT534964 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 2
MIRT536395 LCOR ligand dependent nuclear receptor corepressor 1 1
MIRT537047 GRAMD4 GRAM domain containing 4 1 1
MIRT537127 GOLGA3 golgin A3 1 2
MIRT537184 GFPT2 glutamine-fructose-6-phosphate transaminase 2 1 2
MIRT537650 ERGIC2 ERGIC and golgi 2 1 2
MIRT538630 CCSER2 family with sequence similarity 190, member B 1 2
MIRT539232 ANP32E acidic (leucine-rich) nuclear phosphoprotein 32 family, member E 1 3
MIRT540102 NPY4R pancreatic polypeptide receptor 1 1 1
MIRT541000 ZNF460 zinc finger protein 460 1 2
MIRT541471 AURKA aurora kinase A 1 1
MIRT542682 SESN3 sestrin 3 1 1
MIRT542760 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT542865 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT542928 HOXC8 homeobox C8 1 1
MIRT543750 SZRD1 SUZ RNA binding domain containing 1 1 1
MIRT544406 ZSCAN12 zinc finger and SCAN domain containing 12 1 1
MIRT544587 AP5Z1 adaptor-related protein complex 5, zeta 1 subunit 1 2
MIRT544664 MED19 mediator complex subunit 19 1 1
MIRT545254 GTF2E1 general transcription factor IIE, polypeptide 1, alpha 56kDa 1 1
MIRT545263 TRIM36 tripartite motif containing 36 1 2
MIRT545747 UHRF1BP1 UHRF1 binding protein 1 1 1
MIRT545997 WDR81 WD repeat domain 81 1 1
MIRT546040 VPS4B vacuolar protein sorting 4 homolog B (S. cerevisiae) 1 1
MIRT547167 PDZD8 PDZ domain containing 8 1 1
MIRT547276 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT547731 KIF5B kinesin family member 5B 1 1
MIRT548125 GATA6 GATA binding protein 6 1 1
MIRT548205 FNIP1 folliculin interacting protein 1 1 1
MIRT548755 CNNM4 cyclin M4 1 1
MIRT549645 ZNF75A zinc finger protein 75a 1 1
MIRT549687 ZNF598 zinc finger protein 598 1 1
MIRT550200 MRO maestro 1 1
MIRT550343 IPP intracisternal A particle-promoted polypeptide 1 1
MIRT550539 MYZAP myocardial zonula adherens protein 1 1
MIRT550978 TOR4A torsin family 4, member A 1 1
MIRT551224 CIDEC cell death-inducing DFFA-like effector c 1 1
MIRT551358 AGBL5 ATP/GTP binding protein-like 5 1 1
MIRT551574 LETM1 leucine zipper-EF-hand containing transmembrane protein 1 1 1
MIRT552280 RAB3D RAB3D, member RAS oncogene family 1 1
MIRT552664 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 1 1
MIRT553084 UCK2 uridine-cytidine kinase 2 1 1
MIRT553750 TBC1D8 TBC1 domain family, member 8 (with GRAM domain) 1 1
MIRT554033 SPCS3 signal peptidase complex subunit 3 homolog (S. cerevisiae) 1 1
MIRT554102 SMU1 smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans) 1 1
MIRT554157 SLX4 SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae) 1 1
MIRT554818 REL v-rel reticuloendotheliosis viral oncogene homolog (avian) 1 1
MIRT555525 PMEPA1 prostate transmembrane protein, androgen induced 1 1 1
MIRT555599 PIP5K1C phosphatidylinositol-4-phosphate 5-kinase, type I, gamma 1 1
MIRT555635 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 2
MIRT555681 PGAM4 phosphoglycerate mutase family member 4 1 2
MIRT555828 PAX9 paired box 9 1 1
MIRT555871 PAIP1 poly(A) binding protein interacting protein 1 1 1
MIRT555942 NUP43 nucleoporin 43kDa 1 1
MIRT555996 NFYB nuclear transcription factor Y, beta 1 1
MIRT556430 LONRF3 LON peptidase N-terminal domain and ring finger 3 1 1
MIRT556586 LHFPL2 lipoma HMGIC fusion partner-like 2 1 2
MIRT556804 KIAA1958 KIAA1958 1 1
MIRT558045 EXOC5 exocyst complex component 5 1 1
MIRT558700 CLTA clathrin, light chain A 1 1
MIRT559194 BMPR1A bone morphogenetic protein receptor, type IA 1 2
MIRT559640 AKAP10 A kinase (PRKA) anchor protein 10 1 1
MIRT559709 AEN apoptosis enhancing nuclease 1 1
MIRT560676 SRFBP1 serum response factor binding protein 1 1 1
MIRT560992 GPBP1L1 GC-rich promoter binding protein 1-like 1 1 1
MIRT562173 HOXA13 homeobox A13 1 1
MIRT562278 GNAQ guanine nucleotide binding protein (G protein), q polypeptide 1 1
MIRT563627 ZNF277 zinc finger protein 277 1 1
MIRT563817 FMN1 formin 1 1 1
MIRT564099 TLR3 toll-like receptor 3 1 1
MIRT565323 TMEM41A transmembrane protein 41A 1 1
MIRT565988 RNF44 ring finger protein 44 1 1
MIRT568239 C11orf24 chromosome 11 open reading frame 24 1 1
MIRT568308 BAK1 BCL2-antagonist/killer 1 1 1
MIRT572379 ATOX1 ATX1 antioxidant protein 1 homolog (yeast) 1 1
MIRT574818 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 1
MIRT609215 PELP1 proline, glutamate and leucine rich protein 1 1 1
MIRT629085 FASLG Fas ligand (TNF superfamily, member 6) 1 1
MIRT632127 FKBP9 FK506 binding protein 9, 63 kDa 1 1
MIRT632579 POLQ polymerase (DNA directed), theta 1 1
MIRT634804 ENTHD1 ENTH domain containing 1 1 1
MIRT636556 ESRP1 epithelial splicing regulatory protein 1 1 1
MIRT640980 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT653878 SH2B3 SH2B adaptor protein 3 1 1
MIRT655601 OTUD7B OTU domain containing 7B 1 1
MIRT659767 CCDC171 coiled-coil domain containing 171 1 1
MIRT660747 ALG14 asparagine-linked glycosylation 14 homolog (S. cerevisiae) 1 1
MIRT681040 AAED1 AhpC/TSA antioxidant enzyme domain containing 1 1 1
MIRT682308 RBM28 RNA binding motif protein 28 1 1
MIRT682576 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 1 1
MIRT686220 ZNF267 zinc finger protein 267 1 1
MIRT687212 PLXNA3 plexin A3 1 1
MIRT690633 LAX1 lymphocyte transmembrane adaptor 1 1 1
MIRT692422 AGMAT agmatine ureohydrolase (agmatinase) 1 1
MIRT694440 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 1 1
MIRT700728 PNO1 partner of NOB1 homolog (S. cerevisiae) 1 1
MIRT701552 NARF nuclear prelamin A recognition factor 1 1
MIRT704382 DAND5 DAN domain family, member 5 1 1
MIRT707936 PPP1R3D protein phosphatase 1, regulatory subunit 3D 1 1
MIRT709942 MRPS16 mitochondrial ribosomal protein S16 1 1
MIRT711374 MED7 mediator complex subunit 7 1 1
MIRT712323 PER2 period homolog 2 (Drosophila) 1 1
MIRT714518 SHE Src homology 2 domain containing E 1 1
MIRT715523 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 1 1
MIRT724297 OSMR oncostatin M receptor 1 1
MIRT725361 MUC21 mucin 21, cell surface associated 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*