Accession ID: MIRT050910 [miRNA, hsa-miR-17-5p :: CTSA, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-17LinkOut: [miRBase ]
Synonyms MIR91, MIRN17, MIRN91, hsa-mir-17, miR-17, miR17-3p, miRNA17, MIR17
Description Homo sapiens miR-17 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-17-5p
Mature Sequence 14| CAAAGUGCUUACAGUGCAGGUAG |36
Evidence Experimental
Experiments Cloned
Expression Profile
Putative hsa-miR-17-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CTSA LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms GLB2, GSL, NGBE, PPCA, PPGB
Description cathepsin A
Transcript NM_0011675    LinkOut: [ RefSeq ]
Other Transcripts NM_0011276 , NM_0003   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CTSA LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CTSA
(miRNA target sites are highlighted)
>CTSA|NM_0011675|3'UTR
   1 CAGCCATACTGATGACCACAGCAACCAGCTCCACGGCCTGATGCAGCCCCTCCCAGCCTCTCCCGCTAGGAGAGTCCTCT
  81 TCTAAGCAAAGTGCCCCTGCAGGCCGGGTTCTGCCGCCAGGACTGCCCCCTTCCCAGAGCCCTGTACATCCCAGACTGGG
 161 CCCAGGGTCTCCCATAGACAGCCTGGGGGCAAGTTAGCACTTTATTCCCGCAGCAGTTCCTGAATGGGGTGGCCTGGCCC
 241 CTTCTCTGCTTAAAGAATGCCCTTTATGATGCACTGATTCCATCCCAGGAACCCAACAGAGCTCAGGACAGCCCACAGGG
 321 AGGTGGTGGACGGACTGTAATTGATAGATTGATTATGGAATTAAATTGGGTACAGCTTCAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gaUGGA----CGUGACAUUCGUGAAAc 5'
            :|||    |||  || |||||||| 
Target 5' caGCCTGGGGGCA-AGTTAGCACTTTa 3'
179 - 204 158.00 -14.60
2
miRNA  3' gauGGACGUGAC--AUU-----CGUGAAAc 5'
             ||| | |||  |||     || |||| 
Target 5' gccCCTTCTCTGCTTAAAGAATGCCCTTTa 3'
237 - 266 126.00 -6.90
3
miRNA  3' gauGGACGUGACAUUCGUGAAAc 5'
             ||| | | |  ||| || | 
Target 5' cccCCTTCCCAG--AGCCCTGTa 3'
126 - 146 92.00 -5.29
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-17-5p :: CTSA    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gatggaCGTGACATTCGTGAAAc 5'
                |||  || |||||||| 
Target 5' -----gGCA-AGTTAGCACTTTa 3'
1 - 17
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
320 hsa-miR-17-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000256 ZNFX1 zinc finger, NFX1-type containing 1 3 2
MIRT000257 CCL1 chemokine (C-C motif) ligand 1 2 1
MIRT000258 GPR137B G protein-coupled receptor 137B 2 1
MIRT000259 NABP1 oligonucleotide/oligosaccharide-binding fold containing 2A 2 1
MIRT000261 NPAT nuclear protein, ataxia-telangiectasia locus 2 1
MIRT000263 YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 2 1
MIRT000482 JAK1 Janus kinase 1 3 2
MIRT000499 PTEN phosphatase and tensin homolog 4 5
MIRT000600 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 4 7
MIRT000977 PTPRO protein tyrosine phosphatase, receptor type, O 3 2
MIRT001158 PKD2 polycystic kidney disease 2 (autosomal dominant) 4 1
MIRT001206 BCL2L11 BCL2-like 11 (apoptosis facilitator) 4 8
MIRT002935 E2F1 E2F transcription factor 1 4 5
MIRT003013 MAP3K12 mitogen-activated protein kinase kinase kinase 12 2 3
MIRT003014 BCL2 B-cell CLL/lymphoma 2 2 3
MIRT003015 MEF2D myocyte enhancer factor 2D 2 3
MIRT003741 RUNX1 runt-related transcription factor 1 4 1
MIRT003898 APP amyloid beta (A4) precursor protein 4 3
MIRT004271 VEGFA vascular endothelial growth factor A 2 3
MIRT004359 MAPK9 mitogen-activated protein kinase 9 4 4
MIRT004525 DNAJC27 DnaJ (Hsp40) homolog, subfamily C, member 27 2 1
MIRT004529 FBXO31 F-box protein 31 2 1
MIRT004591 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 5 2
MIRT004681 TNFSF12 tumor necrosis factor (ligand) superfamily, member 12 1 1
MIRT004710 MUC17 mucin 17, cell surface associated 3 1
MIRT004935 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 4 2
MIRT005287 CCND1 cyclin D1 4 4
MIRT005288 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 3 3
MIRT005408 NCOA3 nuclear receptor coactivator 3 4 3
MIRT005626 THBS1 thrombospondin 1 3 2
MIRT005629 SMAD4 SMAD family member 4 3 2
MIRT005708 ICAM1 intercellular adhesion molecule 1 1 1
MIRT005711 SELE selectin E 1 1
MIRT005848 CCND2 cyclin D2 2 2
MIRT005849 E2F3 E2F transcription factor 3 1 1
MIRT005850 RB1 retinoblastoma 1 1 1
MIRT005851 RBL1 retinoblastoma-like 1 (p107) 2 2
MIRT005852 RBL2 retinoblastoma-like 2 (p130) 1 1
MIRT005853 WEE1 WEE1 homolog (S. pombe) 2 2
MIRT006611 Tgfbr2 transforming growth factor, beta receptor II 3 1
MIRT006689 RND3 Rho family GTPase 3 3 1
MIRT006796 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 3 1
MIRT007321 TCF3 transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47) 1 1
MIRT031361 S1PR1 sphingosine-1-phosphate receptor 1 1 1
MIRT031362 TCEAL1 transcription elongation factor A (SII)-like 1 1 1
MIRT031363 PRKD1 protein kinase D1 1 2
MIRT031364 GAB1 GRB2-associated binding protein 1 1 2
MIRT031365 VIM vimentin 1 1
MIRT031366 IL8 interleukin 8 1 1
MIRT031367 TSG101 tumor susceptibility gene 101 1 1
MIRT031368 TNFSF13 tumor necrosis factor (ligand) superfamily, member 13 1 1
MIRT031369 HSPB2 heat shock 27kDa protein 2 1 1
MIRT031370 MMP2 matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase) 1 1
MIRT031371 HBP1 HMG-box transcription factor 1 1 1
MIRT035530 SIRPA signal-regulatory protein alpha 1 1
MIRT050791 MOB1B MOB1, Mps One Binder kinase activator-like 1A (yeast) 1 1
MIRT050792 FBXO28 F-box protein 28 1 1
MIRT050793 TJP1 tight junction protein 1 (zona occludens 1) 1 1
MIRT050794 SLC35E2B similar to solute carrier family 35, member E2 1 1
MIRT050795 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT050796 UBE4A ubiquitination factor E4A (UFD2 homolog, yeast) 1 1
MIRT050797 DHX33 DEAH (Asp-Glu-Ala-His) box polypeptide 33 1 1
MIRT050798 RPS27A ribosomal protein S27a 1 1
MIRT050799 HIST1H4C histone cluster 1, H4c 1 1
MIRT050800 GDAP1 ganglioside-induced differentiation-associated protein 1 1 1
MIRT050801 TMEM165 transmembrane protein 165 1 1
MIRT050802 SOX4 SRY (sex determining region Y)-box 4 1 1
MIRT050803 TRIM11 tripartite motif-containing 11 1 1
MIRT050804 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT050805 PIGS phosphatidylinositol glycan anchor biosynthesis, class S 1 1
MIRT050806 ND4 NADH dehydrogenase, subunit 4 (complex I) 1 1
MIRT050807 PPP1R15A protein phosphatase 1, regulatory (inhibitor) subunit 15A 1 1
MIRT050808 USP38 ubiquitin specific peptidase 38 1 1
MIRT050809 RAB23 RAB23, member RAS oncogene family 1 1
MIRT050810 LARP1 La ribonucleoprotein domain family, member 1 1 1
MIRT050811 ZSWIM3 zinc finger, SWIM-type containing 3 1 1
MIRT050812 ADARB1 adenosine deaminase, RNA-specific, B1 (RED1 homolog rat) 1 1
MIRT050813 MEN1 multiple endocrine neoplasia I 1 1
MIRT050814 FAM8A1 family with sequence similarity 8, member A1 1 1
MIRT050815 NPAS2 neuronal PAS domain protein 2 1 1
MIRT050816 ATP6 ATP synthase F0 subunit 6 1 1
MIRT050817 STK11 serine/threonine kinase 11 1 1
MIRT050818 ACOT2 acyl-CoA thioesterase 2 1 1
MIRT050819 ATF3 activating transcription factor 3 1 1
MIRT050820 ASNS asparagine synthetase (glutamine-hydrolyzing) 1 1
MIRT050821 RTTN rotatin 1 1
MIRT050822 ZNF689 zinc finger protein 689 1 1
MIRT050823 HTT huntingtin 1 1
MIRT050824 IMMT inner membrane protein, mitochondrial 1 1
MIRT050825 TBC1D15 TBC1 domain family, member 15 1 1
MIRT050826 PSD3 pleckstrin and Sec7 domain containing 3 1 1
MIRT050827 HIST1H2AM histone cluster 1, H2am 1 1
MIRT050828 HUWE1 HECT, UBA and WWE domain containing 1 1 1
MIRT050829 HIST3H2A histone cluster 3, H2a 1 1
MIRT050830 APEX1 APEX nuclease (multifunctional DNA repair enzyme) 1 1 1
MIRT050831 AZIN1 antizyme inhibitor 1 1 1
MIRT050832 RPS15A ribosomal protein S15a 1 1
MIRT050833 COA1 chromosome 7 open reading frame 44 1 1
MIRT050834 CPE carboxypeptidase E 1 1
MIRT050835 MBNL1 muscleblind-like (Drosophila) 1 1
MIRT050836 IGFBP5 insulin-like growth factor binding protein 5 1 1
MIRT050837 HNRNPU heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A) 1 1
MIRT050838 ND2 MTND2 1 1
MIRT050839 PIK3CA phosphoinositide-3-kinase, catalytic, alpha polypeptide 1 1
MIRT050840 PAIP1 poly(A) binding protein interacting protein 1 1 1
MIRT050841 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT050842 MTRF1L mitochondrial translational release factor 1-like 1 1
MIRT050843 KAT2A K(lysine) acetyltransferase 2A 1 1
MIRT050844 POGK pogo transposable element with KRAB domain 1 1
MIRT050845 OPTN optineurin 1 1
MIRT050846 MYCBP2 MYC binding protein 2 1 1
MIRT050847 SYNDIG1 transmembrane protein 90B 1 1
MIRT050848 UBE2S ubiquitin-conjugating enzyme E2S 1 1
MIRT050849 RYR2 ryanodine receptor 2 (cardiac) 1 1
MIRT050850 HIST2H2AA3 histone cluster 2, H2aa3 1 1
MIRT050851 COPS3 COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis) 1 1
MIRT050852 MGEA5 meningioma expressed antigen 5 (hyaluronidase) 1 1
MIRT050853 PELI1 pellino homolog 1 (Drosophila) 1 1
MIRT050854 CETN2 centrin, EF-hand protein, 2 1 1
MIRT050855 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT050856 RPL37 ribosomal protein L37 1 1
MIRT050857 REEP5 receptor accessory protein 5 1 1
MIRT050858 MRPS6 mitochondrial ribosomal protein S6 1 1
MIRT050859 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT050860 SLC25A3 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 1 1
MIRT050861 MUC21 mucin 21, cell surface associated 1 1
MIRT050862 KDM4A lysine (K)-specific demethylase 4A 1 1
MIRT050863 HIST2H4B histone cluster 2, H4b 1 1
MIRT050864 COX2 cytochrome c oxidase subunit II 1 1
MIRT050865 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT050866 CBL Cas-Br-M (murine) ecotropic retroviral transforming sequence 1 1
MIRT050867 CNEP1R1 transmembrane protein 188 1 1
MIRT050868 NOC2L nucleolar complex associated 2 homolog (S. cerevisiae) 1 1
MIRT050869 CANX calnexin 1 1
MIRT050870 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative function) 1 1
MIRT050871 EARS2 glutamyl-tRNA synthetase 2, mitochondrial (putative) 1 1
MIRT050872 RPL7 ribosomal protein L7 1 1
MIRT050873 CAP1 CAP, adenylate cyclase-associated protein 1 (yeast) 1 1
MIRT050874 UBE2C ubiquitin-conjugating enzyme E2C 1 1
MIRT050875 RMDN1 family with sequence similarity 82, member B 1 1
MIRT050876 SLC25A37 solute carrier family 25, member 37 1 1
MIRT050877 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 1 1
MIRT050878 DCTPP1 dCTP pyrophosphatase 1 1 1
MIRT050879 MFHAS1 malignant fibrous histiocytoma amplified sequence 1 1 1
MIRT050880 ASH1L ash1 (absent, small, or homeotic)-like (Drosophila) 1 1
MIRT050881 HDAC10 histone deacetylase 10 1 1
MIRT050882 RBM5 RNA binding motif protein 5 1 1
MIRT050883 UBE3C ubiquitin protein ligase E3C 1 1
MIRT050884 DEPDC1 DEP domain containing 1 1 1
MIRT050885 TRUB1 TruB pseudouridine (psi) synthase homolog 1 (E. coli) 1 1
MIRT050886 TMED10 transmembrane emp24-like trafficking protein 10 (yeast) 1 1
MIRT050887 MDK midkine (neurite growth-promoting factor 2) 1 1
MIRT050888 ZBED3 zinc finger, BED-type containing 3 1 1
MIRT050889 LCOR ligand dependent nuclear receptor corepressor 1 1
MIRT050890 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT050891 KIF5C kinesin family member 5C 1 1
MIRT050892 WDR82 WD repeat domain 82 1 1
MIRT050893 COX7B cytochrome c oxidase subunit VIIb 1 1
MIRT050894 SH3GLB2 SH3-domain GRB2-like endophilin B2 1 1
MIRT050895 TAF9B TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa 1 1
MIRT050896 NAPEPLD N-acyl phosphatidylethanolamine phospholipase D 1 1
MIRT050897 ATRX alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae) 1 1
MIRT050898 PTBP1 polypyrimidine tract binding protein 1 1 1
MIRT050899 FTH1 ferritin, heavy polypeptide 1 1 1
MIRT050900 PLXNA1 plexin A1 1 1
MIRT050901 OFD1 oral-facial-digital syndrome 1 1 1
MIRT050902 PER1 period homolog 1 (Drosophila) 1 1
MIRT050903 ARL9 ADP-ribosylation factor-like 9 1 1
MIRT050904 ARHGAP5 Rho GTPase activating protein 5 1 1
MIRT050905 SIPA1L3 signal-induced proliferation-associated 1 like 3 1 1
MIRT050906 QARS glutaminyl-tRNA synthetase 1 1
MIRT050907 ELP2 elongation protein 2 homolog (S. cerevisiae) 1 1
MIRT050908 SURF4 surfeit 4 1 1
MIRT050909 RPL21 ribosomal protein L21 1 1
MIRT050910 CTSA cathepsin A 1 1
MIRT050911 EPB41L5 erythrocyte membrane protein band 4.1 like 5 1 1
MIRT050912 ABI2 abl-interactor 2 1 1
MIRT050913 UQCRFS1 ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 1 1
MIRT050914 TMEM9 transmembrane protein 9 1 1
MIRT050915 MED12 mediator complex subunit 12 1 1
MIRT050916 NAGK N-acetylglucosamine kinase 1 1
MIRT050917 TSC2 tuberous sclerosis 2 1 1
MIRT050918 GPM6A glycoprotein M6A 1 1
MIRT050919 SEPT2 septin 2 1 1
MIRT050920 TEFM chromosome 17 open reading frame 42 1 1
MIRT050921 FASN fatty acid synthase 1 1
MIRT050922 AMD1 adenosylmethionine decarboxylase 1 1 1
MIRT050923 TRA2B transformer 2 beta homolog (Drosophila) 1 1
MIRT050924 DCUN1D4 DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae) 1 1
MIRT050925 PRICKLE1 prickle homolog 1 (Drosophila) 1 1
MIRT050926 SEPT11 septin 11 1 1
MIRT050927 CHST14 carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14 1 1
MIRT050928 TRIM44 tripartite motif-containing 44 1 1
MIRT050929 SON SON DNA binding protein 1 1
MIRT050930 SMIM15 chromosome 5 open reading frame 43 1 1
MIRT050931 LAPTM4A lysosomal protein transmembrane 4 alpha 1 1
MIRT050932 CHTF8 CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae) 1 1
MIRT050933 SMAD3 SMAD family member 3 1 1
MIRT050934 NONO non-POU domain containing, octamer-binding 1 1
MIRT050935 EIF4G3 eukaryotic translation initiation factor 4 gamma, 3 1 1
MIRT050936 NOTCH2 Notch homolog 2 (Drosophila) 1 1
MIRT050937 SDHA succinate dehydrogenase complex, subunit A, flavoprotein (Fp) 1 1
MIRT050938 XIAP X-linked inhibitor of apoptosis 1 1
MIRT050939 DNMBP dynamin binding protein 1 1
MIRT050940 TRAP1 TNF receptor-associated protein 1 1 1
MIRT050941 EPB41L2 erythrocyte membrane protein band 4.1-like 2 1 1
MIRT050942 MED13 mediator complex subunit 13 1 1
MIRT050943 TMTC4 transmembrane and tetratricopeptide repeat containing 4 1 1
MIRT050944 BACE1 beta-site APP-cleaving enzyme 1 1 1
MIRT050945 POGZ pogo transposable element with ZNF domain 1 1
MIRT050946 GDF11 growth differentiation factor 11 1 1
MIRT050947 GPI glucose-6-phosphate isomerase 1 1
MIRT050948 MNT MAX binding protein 1 1
MIRT050949 VPRBP Vpr (HIV-1) binding protein 1 1
MIRT050950 PGAM1 phosphoglycerate mutase 1 (brain) 1 1
MIRT050951 KANSL1 KIAA1267 1 1
MIRT050952 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT050953 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT050954 FOPNL chromosome 16 open reading frame 63 1 1
MIRT050955 TUBB4B tubulin, beta 2C 1 1
MIRT050956 DPYSL2 dihydropyrimidinase-like 2 1 1
MIRT050957 NBR1 neighbor of BRCA1 gene 1 1 1
MIRT050958 KIAA1919 KIAA1919 1 1
MIRT050959 ZNF507 zinc finger protein 507 1 1
MIRT050960 BLVRA biliverdin reductase A 1 1
MIRT050961 PPP2R1A protein phosphatase 2, regulatory subunit A, alpha 1 1
MIRT050962 DCBLD2 discoidin, CUB and LCCL domain containing 2 1 1
MIRT050963 CLPTM1 cleft lip and palate associated transmembrane protein 1 1 1
MIRT050964 ARHGEF7 Rho guanine nucleotide exchange factor (GEF) 7 1 1
MIRT050965 HIST2H3A histone cluster 2, H3a 1 1
MIRT050966 FANCA Fanconi anemia, complementation group A 1 1
MIRT050967 MORF4L2 mortality factor 4 like 2 1 1
MIRT050968 RLF rearranged L-myc fusion 1 1
MIRT050969 RAB5B RAB5B, member RAS oncogene family 1 1
MIRT050970 TOB1 transducer of ERBB2, 1 1 1
MIRT050971 EFHC1 EF-hand domain (C-terminal) containing 1 1 1
MIRT050972 MTMR3 myotubularin related protein 3 1 1
MIRT050973 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 1 1
MIRT050974 GANAB glucosidase, alpha; neutral AB 1 1
MIRT050975 SLC16A2 solute carrier family 16, member 2 (monocarboxylic acid transporter 8) 1 1
MIRT050976 RTN3 reticulon 3 1 1
MIRT050977 ERCC2 excision repair cross-complementing rodent repair deficiency, complementation group 2 1 1
MIRT050978 ATXN7 ataxin 7 1 1
MIRT050979 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT050980 GLO1 glyoxalase I 1 1
MIRT050981 LPIN1 lipin 1 1 1
MIRT050982 LSM14A LSM14A, SCD6 homolog A (S. cerevisiae) 1 1
MIRT050983 ILF3 interleukin enhancer binding factor 3, 90kDa 1 1
MIRT050984 ANKRD27 ankyrin repeat domain 27 (VPS9 domain) 1 1
MIRT050985 TNPO3 transportin 3 1 1
MIRT050986 NAT8L N-acetyltransferase 8-like (GCN5-related, putative) 1 1
MIRT050987 PTTG1 pituitary tumor-transforming 1 1 1
MIRT050988 ARPC2 actin related protein 2/3 complex, subunit 2, 34kDa 1 1
MIRT050989 HN1 hematological and neurological expressed 1 1 1
MIRT050990 SLC25A28 solute carrier family 25, member 28 1 1
MIRT050991 TRRAP transformation/transcription domain-associated protein 1 1
MIRT050992 ELMO2 engulfment and cell motility 2 1 1
MIRT050993 PCNX pecanex homolog (Drosophila) 1 1
MIRT050994 TMEM19 transmembrane protein 19 1 1
MIRT050995 PBXIP1 pre-B-cell leukemia homeobox interacting protein 1 1 1
MIRT050996 CCT6A chaperonin containing TCP1, subunit 6A (zeta 1) 1 1
MIRT050997 HDHD1 haloacid dehalogenase-like hydrolase domain containing 1A 1 1
MIRT050998 PLS1 plastin 1 1 1
MIRT050999 RNF145 ring finger protein 145 1 1
MIRT051000 AK1 adenylate kinase 1 1 1
MIRT051001 TCEA2 transcription elongation factor A (SII), 2 1 1
MIRT051002 PLAG1 pleiomorphic adenoma gene 1 1 1
MIRT051003 PDPK1 3-phosphoinositide dependent protein kinase-1 1 1
MIRT051004 TNFAIP1 tumor necrosis factor, alpha-induced protein 1 (endothelial) 1 1
MIRT051005 RTCA RNA terminal phosphate cyclase domain 1 1 1
MIRT051006 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT051007 LAS1L LAS1-like (S. cerevisiae) 1 1
MIRT051008 RPSA ribosomal protein SA 1 1
MIRT051009 TMSB10 thymosin beta 10 1 1
MIRT051010 ERLIN1 ER lipid raft associated 1 1 1
MIRT051011 EHMT2 euchromatic histone-lysine N-methyltransferase 2 1 1
MIRT051012 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT051013 ARHGAP10 Rho GTPase activating protein 10 1 1
MIRT051014 PDLIM5 PDZ and LIM domain 5 1 1
MIRT051015 CCDC47 coiled-coil domain containing 47 1 1
MIRT051016 CPSF1 cleavage and polyadenylation specific factor 1, 160kDa 1 1
MIRT051017 MTF1 metal-regulatory transcription factor 1 1 1
MIRT051018 C15orf41 chromosome 15 open reading frame 41 1 1
MIRT051019 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT051020 GNB1 guanine nucleotide binding protein (G protein), beta polypeptide 1 1 1
MIRT051021 IRAK1 interleukin-1 receptor-associated kinase 1 1 1
MIRT051022 CPS1 carbamoyl-phosphate synthase 1, mitochondrial 1 1
MIRT051023 FXR2 fragile X mental retardation, autosomal homolog 2 1 1
MIRT051024 SUOX sulfite oxidase 1 1
MIRT051025 STIL SCL/TAL1 interrupting locus 1 1
MIRT051026 WAC WW domain containing adaptor with coiled-coil 1 1
MIRT051027 FER fer (fps/fes related) tyrosine kinase 1 1
MIRT051028 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 1
MIRT051029 BTN3A1 butyrophilin, subfamily 3, member A1 1 1
MIRT051030 TRIM8 tripartite motif-containing 8 1 1
MIRT051031 RUNDC1 RUN domain containing 1 1 1
MIRT051032 ZFYVE26 zinc finger, FYVE domain containing 26 1 1
MIRT051033 RNF146 ring finger protein 146 1 1
MIRT051034 PPP1CA protein phosphatase 1, catalytic subunit, alpha isozyme 1 1
MIRT051035 NAP1L1 nucleosome assembly protein 1-like 1 1 1
MIRT051036 ZIK1 zinc finger protein interacting with K protein 1 homolog (mouse) 1 1
MIRT051037 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT051038 MAP3K8 mitogen-activated protein kinase kinase kinase 8 1 1
MIRT051039 ZNF598 zinc finger protein 598 1 1
MIRT051040 TRIM71 tripartite motif-containing 71 1 1
MIRT051041 KIF1A kinesin family member 1A 1 1
MIRT051042 MAP3K9 mitogen-activated protein kinase kinase kinase 9 1 1
MIRT051043 KMT2A myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 1 1
MIRT051044 RALGAPA1 Ral GTPase activating protein, alpha subunit 1 (catalytic) 1 1
MIRT051045 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT051046 PCGF5 polycomb group ring finger 5 1 1
MIRT051047 GNAS GNAS complex locus 1 1
MIRT051048 WASL Wiskott-Aldrich syndrome-like 1 1
MIRT051049 RBM12B RNA binding motif protein 12B 1 1
MIRT051050 TXLNA taxilin alpha 1 1
MIRT051051 ARIH1 ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) 1 1
MIRT051052 KCTD7 potassium channel tetramerisation domain containing 7 1 1
MIRT051053 HEXIM1 hexamethylene bis-acetamide inducible 1 1 1
MIRT051054 DAPK3 death-associated protein kinase 3 1 1
MIRT051055 PLEKHM1 pleckstrin homology domain containing, family M (with RUN domain) member 1 1 1