Accession ID: MIRT051313 [miRNA, hsa-miR-15a-5p :: IKBKG, target gene]
| pre-miRNA ID | hsa-mir-15aLinkOut: [miRBase ] |
|---|---|
| Synonyms | MIRN15A, hsa-mir-15a, miRNA15A, MIR15A |
| Description | Homo sapiens miR-15a stem-loop |
| Comment | Reference . |
| 2nd Structure of pre-miRNA |  |
| Disease |
|
| Mature miRNA | hsa-miR-15a-5p |
|---|---|
| Mature Sequence | 14| UAGCAGCACAUAAUGGUUUGUG |35 |
| Evidence | Experimental |
| Experiments | Cloned |
| Putative hsa-miR-15a-5p Targets | LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ] |
| Gene Symbol | LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ] |
|---|---|
| Synonyms | |
| Description | |
| Transcript | LinkOut: [ RefSeq ] |
| Expression | LinkOut: [ BioGPS ] |
| Putative miRNA Targets on | LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ] |
| 3'UTR of (miRNA target sites are highlighted) |
>||3'UTR Target sites
Provided by authors Predicted by miRanda |
| miRNA:Target | hsa-miR-15a-5p :: IKBKG [ Functional MTI ] | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Validation Method | CLASH | |||||||||
| Conditions | Flp-In T-REx 293-hAGO1 cells | |||||||||
| Location of target site | 5'UTR | |||||||||
| Original Description (Extracted from the article) |
...
Validation of interactions identified by CLASH suppports their reliability.
... - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell. |
|||||||||
| miRNA-target interactions (Provided by authors) |
|
|||||||||
| Article |
- Helwak, A.
Kudla, G.
Dudnakova, T.
Tollervey, D. - Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
|
MiRNA-Target Expression Profile:
|
|
MiRNA-Target Expression Profile(TCGA):
|
|
MiRNA-Target Interaction Network:
Functional analysis: [KEGG Pathway Enrichment] [Gene Ontology Enrichment]
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
Other evidence
690 hsa-miR-15a-5p Target Genes:
Functional analysis: [KEGG Pathway Enrichment] [Gene Ontology Enrichment]
ID |
Target | Description | Validation methods |
 |
 |
||||||
| Strong evidence | Less strong evidence | ||||||||||
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT000280 | BMI1 | BMI1 polycomb ring finger oncogene |  |
|
|
3 | 1 | ||||
| MIRT000282 | WNT3A | wingless-type MMTV integration site family, member 3A | |
|
|
3 | 2 | ||||
| MIRT000283 | MYB | v-myb myeloblastosis viral oncogene homolog (avian) | |
|
|
|
|
5 | 3 | ||
| MIRT000284 | CDC25A | cell division cycle 25 homolog A (S. pombe) | |
|
|
3 | 3 | ||||
| MIRT000285 | CCND2 | cyclin D2 | |
|
|
3 | 5 | ||||
| MIRT000804 | RAB9B | RAB9B, member RAS oncogene family | |
1 | 1 | ||||||
| MIRT000806 | ACTR1A | ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) | |
1 | 1 | ||||||
| MIRT000808 | TPI1 | triosephosphate isomerase 1 | |
1 | 1 | ||||||
| MIRT000810 | PDCD4 | programmed cell death 4 (neoplastic transformation inhibitor) | |
|
|
3 | 2 | ||||
| MIRT000812 | RAB21 | RAB21, member RAS oncogene family | |
|
2 | 1 | |||||
| MIRT000815 | BCL2 | B-cell CLL/lymphoma 2 | |
|
|
|
|
|
6 | 13 | |
| MIRT000817 | WT1 | Wilms tumor 1 | |
|
2 | 1 | |||||
| MIRT000819 | ASXL2 | additional sex combs like 2 (Drosophila) | |
|
2 | 1 | |||||
| MIRT000823 | TMEM251 | transmembrane protein 251 | |
|
2 | 1 | |||||
| MIRT000825 | CARD8 | caspase recruitment domain family, member 8 | |
|
2 | 1 | |||||
| MIRT000827 | CDC14B | CDC14 cell division cycle 14 homolog B (S. cerevisiae) | |
|
2 | 1 | |||||
| MIRT000829 | CENPJ | centromere protein J | |
|
2 | 1 | |||||
| MIRT000831 | CEP63 | centrosomal protein 63kDa | |
|
2 | 1 | |||||
| MIRT000833 | CREBL2 | cAMP responsive element binding protein-like 2 | |
|
|
3 | 3 | ||||
| MIRT000835 | ECHDC1 | enoyl CoA hydratase domain containing 1 | |
|
2 | 1 | |||||
| MIRT000847 | GOLGA5 | golgin A5 | |
|
2 | 1 | |||||
| MIRT000849 | GOLPH3L | golgi phosphoprotein 3-like | |
|
2 | 1 | |||||
| MIRT000851 | GTF2H1 | general transcription factor IIH, polypeptide 1, 62kDa | |
|
2 | 1 | |||||
| MIRT000853 | H3F3B | H3 histone, family 3B (H3.3B) | |
|
2 | 1 | |||||
| MIRT000855 | HACE1 | HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 | |
|
2 | 1 | |||||
| MIRT000857 | HDHD2 | haloacid dehalogenase-like hydrolase domain containing 2 | |
|
2 | 1 | |||||
| MIRT000859 | HERC6 | HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 | |
|
2 | 1 | |||||
| MIRT000863 | HRSP12 | heat-responsive protein 12 | |
|
2 | 1 | |||||
| MIRT000865 | HSDL2 | hydroxysteroid dehydrogenase like 2 | |
|
2 | 1 | |||||
| MIRT000866 | HSPA1A | heat shock 70kDa protein 1A | |
|
2 | 1 | |||||
| MIRT000868 | JUN | jun proto-oncogene | |
|
2 | 1 | |||||
| MIRT000878 | MCL1 | myeloid cell leukemia sequence 1 (BCL2-related) | |
|
2 | 1 | |||||
| MIRT000880 | MSH2 | mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) | |
|
2 | 1 | |||||
| MIRT000884 | OMA1 | OMA1 zinc metallopeptidase homolog (S. cerevisiae) | |
|
2 | 1 | |||||
| MIRT000886 | OSGEPL1 | O-sialoglycoprotein endopeptidase-like 1 | |
|
2 | 1 | |||||
| MIRT000888 | PDCD6IP | programmed cell death 6 interacting protein | |
|
2 | 1 | |||||
| MIRT000890 | PHKB | phosphorylase kinase, beta | |
|
2 | 1 | |||||
| MIRT000892 | PMS1 | PMS1 postmeiotic segregation increased 1 (S. cerevisiae) | |
|
2 | 1 | |||||
| MIRT000894 | PNN | pinin, desmosome associated protein | |
|
2 | 1 | |||||
| MIRT000896 | PRIM1 | primase, DNA, polypeptide 1 (49kDa) | |
|
2 | 1 | |||||
| MIRT000898 | RAD51C | RAD51 homolog C (S. cerevisiae) | |
|
2 | 1 | |||||
| MIRT000900 | RHOT1 | ras homolog family member T1 | |
|
2 | 1 | |||||
| MIRT000902 | RNASEL | ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent) | |
|
2 | 1 | |||||
| MIRT000906 | SLC35A1 | solute carrier family 35 (CMP-sialic acid transporter), member A1 | |
|
2 | 1 | |||||
| MIRT000908 | SLC35B3 | solute carrier family 35, member B3 | |
|
2 | 1 | |||||
| MIRT000910 | TIA1 | TIA1 cytotoxic granule-associated RNA binding protein | |
|
2 | 1 | |||||
| MIRT000914 | UGDH | UDP-glucose 6-dehydrogenase | |
|
2 | 1 | |||||
| MIRT000916 | UGP2 | UDP-glucose pyrophosphorylase 2 | |
|
2 | 1 | |||||
| MIRT000922 | ZNF559 | zinc finger protein 559 | |
|
2 | 1 | |||||
| MIRT001227 | CCND1 | cyclin D1 | |
|
|
|
|
5 | 7 | ||
| MIRT001228 | CCNE1 | cyclin E1 | |
|
|
|
|
|
6 | 8 | |
| MIRT001802 | BACE1 | beta-site APP-cleaving enzyme 1 | |
|
2 | 1 | |||||
| MIRT002946 | DMTF1 | cyclin D binding myb-like transcription factor 1 | |
|
|
3 | 3 | ||||
| MIRT003333 | BRCA1 | breast cancer 1, early onset | |
|
2 | 2 | |||||
| MIRT003334 | AKT3 | v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) | |
|
2 | 4 | |||||
| MIRT003872 | WIPF1 | WAS/WASL interacting protein family, member 1 | |
|
2 | 1 | |||||
| MIRT003873 | VPS45 | vacuolar protein sorting 45 homolog (S. cerevisiae) | |
|
2 | 1 | |||||
| MIRT003874 | HSP90B1 | heat shock protein 90kDa beta (Grp94), member 1 | |
|
2 | 1 | |||||
| MIRT003875 | SKAP2 | src kinase associated phosphoprotein 2 | |
|
|
3 | 1 | ||||
| MIRT003876 | NT5DC1 | 5'-nucleotidase domain containing 1 | |
|
2 | 1 | |||||
| MIRT003877 | FAM69A | family with sequence similarity 69, member A | |
|
2 | 1 | |||||
| MIRT003878 | C2orf74 | chromosome 2 open reading frame 74 | |
1 | 1 | ||||||
| MIRT003879 | FAM122C | family with sequence similarity 122C | |
|
2 | 1 | |||||
| MIRT003880 | PWWP2A | PWWP domain containing 2A | |
|
2 | 1 | |||||
| MIRT003881 | C17orf80 | chromosome 17 open reading frame 80 | |
|
2 | 1 | |||||
| MIRT003882 | CCDC111 | coiled-coil domain containing 111 | |
|
2 | 1 | |||||
| MIRT003883 | C2orf43 | chromosome 2 open reading frame 43 | |
|
2 | 1 | |||||
| MIRT003884 | C4orf27 | chromosome 4 open reading frame 27 | |
|
2 | 1 | |||||
| MIRT003885 | NIPAL2 | NIPA-like domain containing 2 | |
|
2 | 1 | |||||
| MIRT003886 | TRMT13 | tRNA methyltransferase 13 homolog (S. cerevisiae) | |
|
2 | 1 | |||||
| MIRT003887 | ANAPC16 | anaphase promoting complex subunit 16 | |
|
2 | 1 | |||||
| MIRT003888 | CADM1 | cell adhesion molecule 1 | |
|
|
3 | 1 | ||||
| MIRT003891 | TMEM184B | transmembrane protein 184B | |
|
2 | 1 | |||||
| MIRT003899 | APP | amyloid beta (A4) precursor protein | |
|
|
3 | 2 | ||||
| MIRT004046 | UCP2 | uncoupling protein 2 (mitochondrial, proton carrier) | |
|
|
3 | 1 | ||||
| MIRT004275 | VEGFA | vascular endothelial growth factor A | |
|
|
|
|
5 | 10 | ||
| MIRT004680 | TSPYL2 | TSPY-like 2 | |
|
2 | 1 | |||||
| MIRT004829 | NFKB1 | nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 | |
|
|
3 | 1 | ||||
| MIRT005552 | CHUK | conserved helix-loop-helix ubiquitous kinase | |
|
|
|
4 | 1 | |||
| MIRT005763 | TP53 | tumor protein p53 | |
1 | 1 | ||||||
| MIRT006027 | FGF7 | fibroblast growth factor 7 | |
|
2 | 1 | |||||
| MIRT006176 | CLCN3 | chloride channel, voltage-sensitive 3 | |
|
|
|
4 | 1 | |||
| MIRT006177 | CRKL | v-crk sarcoma virus CT10 oncogene homolog (avian)-like | |
|
|
|
|
5 | 2 | ||
| MIRT006181 | MN1 | meningioma (disrupted in balanced translocation) 1 | |
|
|
|
4 | 1 | |||
| MIRT006658 | Ccnd1 | cyclin D1 | |
1 | 1 | ||||||
| MIRT006801 | HMGA1 | high mobility group AT-hook 1 | |
|
|
|
4 | 2 | |||
| MIRT006805 | HMGA2 | high mobility group AT-hook 2 | |
|
|
3 | 1 | ||||
| MIRT006913 | IFNG | interferon, gamma | |
|
2 | 1 | |||||
| MIRT006998 | PURA | purine-rich element binding protein A | |
|
2 | 2 | |||||
| MIRT007090 | RECK | reversion-inducing-cysteine-rich protein with kazal motifs | |
|
|
3 | 2 | ||||
| MIRT032077 | DLK1 | delta-like 1 homolog (Drosophila) | |
|
2 | 1 | |||||
| MIRT051311 | PLA2G2D | phospholipase A2, group IID | |
1 | 1 | ||||||
| MIRT051312 | ACVR1B | activin A receptor, type IB | |
1 | 1 | ||||||
| MIRT051313 | IKBKG | inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma | |
1 | 1 | ||||||
| MIRT051314 | GCLM | glutamate-cysteine ligase, modifier subunit | |
1 | 1 | ||||||
| MIRT051315 | PCF11 | PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae) | |
1 | 1 | ||||||
| MIRT051316 | HIST1H2BK | histone cluster 1, H2bk | |
1 | 1 | ||||||
| MIRT051317 | ODC1 | ornithine decarboxylase 1 | |
1 | 1 | ||||||
| MIRT051318 | CALD1 | caldesmon 1 | |
1 | 1 | ||||||
| MIRT051319 | RPP30 | ribonuclease P/MRP 30kDa subunit | |
1 | 1 | ||||||
| MIRT051320 | ASNSD1 | asparagine synthetase domain containing 1 | |
1 | 1 | ||||||
| MIRT051321 | CCNYL1 | cyclin Y-like 1 | |
1 | 1 | ||||||
| MIRT051322 | RGPD5 | RANBP2-like and GRIP domain containing 5 | |
1 | 1 | ||||||
| MIRT051323 | PREB | prolactin regulatory element binding | |
1 | 1 | ||||||
| MIRT051324 | PDHX | pyruvate dehydrogenase complex, component X | |
1 | 1 | ||||||
| MIRT051325 | SNX6 | sorting nexin 6 | |
1 | 1 | ||||||
| MIRT051326 | CNN3 | calponin 3, acidic | |
1 | 1 | ||||||
| MIRT051327 | KIF1A | kinesin family member 1A | |
1 | 1 | ||||||
| MIRT051328 | NAB1 | NGFI-A binding protein 1 (EGR1 binding protein 1) | |
1 | 1 | ||||||
| MIRT051329 | CCT6B | chaperonin containing TCP1, subunit 6B (zeta 2) | |
1 | 1 | ||||||
| MIRT051330 | CHD4 | chromodomain helicase DNA binding protein 4 | |
1 | 1 | ||||||
| MIRT051331 | CLCC1 | chloride channel CLIC-like 1 | |
1 | 1 | ||||||
| MIRT051332 | GDI2 | GDP dissociation inhibitor 2 | |
1 | 1 | ||||||
| MIRT051333 | BRWD1 | bromodomain and WD repeat domain containing 1 | |
1 | 1 | ||||||
| MIRT051334 | MAPK6 | mitogen-activated protein kinase 6 | |
1 | 1 | ||||||
| MIRT051335 | PSMC4 | proteasome (prosome, macropain) 26S subunit, ATPase, 4 | |
1 | 1 | ||||||
| MIRT051336 | ATF2 | activating transcription factor 2 | |
1 | 1 | ||||||
| MIRT051337 | ATP6AP1 | ATPase, H+ transporting, lysosomal accessory protein 1 | |
1 | 1 | ||||||
| MIRT051338 | FBXO3 | F-box protein 3 | |
1 | 1 | ||||||
| MIRT051339 | PRDX3 | peroxiredoxin 3 | |
1 | 1 | ||||||
| MIRT051340 | CABIN1 | calcineurin binding protein 1 | |
1 | 1 | ||||||
| MIRT051341 | FASN | fatty acid synthase | |
1 | 3 | ||||||
| MIRT051342 | SEC63 | SEC63 homolog (S. cerevisiae) | |
1 | 1 | ||||||
| MIRT051343 | PTAR1 | protein prenyltransferase alpha subunit repeat containing 1 | |
1 | 1 | ||||||
| MIRT051344 | DSTYK | dual serine/threonine and tyrosine protein kinase | |
1 | 1 | ||||||
| MIRT051345 | FOXO1 | forkhead box O1 | |
|
|
|
4 | 2 | |||
| MIRT051346 | TMEM214 | transmembrane protein 214 | |
1 | 1 | ||||||
| MIRT051347 | TRIM28 | tripartite motif containing 28 | |
1 | 1 | ||||||
| MIRT051348 | NOP2 | NOP2 nucleolar protein homolog (yeast) | |
1 | 1 | ||||||
| MIRT051349 | MYBL1 | v-myb myeloblastosis viral oncogene homolog (avian)-like 1 | |
1 | 1 | ||||||
| MIRT051350 | TTC1 | tetratricopeptide repeat domain 1 | |
1 | 1 | ||||||
| MIRT051351 | BTRC | beta-transducin repeat containing E3 ubiquitin protein ligase | |
1 | 2 | ||||||
| MIRT052930 | REPIN1 | replication initiator 1 | |
|
2 | 1 | |||||
| MIRT053079 | KLF4 | Kruppel-like factor 4 (gut) | |
1 | 1 | ||||||
| MIRT054283 | YAP1 | Yes-associated protein 1 | |
|
|
3 | 1 | ||||
| MIRT054424 | CARM1 | coactivator-associated arginine methyltransferase 1 | |
|
|
3 | 1 | ||||
| MIRT054895 | SOX5 | SRY (sex determining region Y)-box 5 | |
|
2 | 1 | |||||
| MIRT055421 | SHOC2 | soc-2 suppressor of clear homolog (C. elegans) | |
1 | 6 | ||||||
| MIRT055811 | PLEKHA1 | pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 | |
1 | 1 | ||||||
| MIRT057514 | CEP55 | centrosomal protein 55kDa | |
1 | 4 | ||||||
| MIRT057729 | ZDHHC16 | zinc finger, DHHC-type containing 16 | |
1 | 1 | ||||||
| MIRT057906 | STXBP3 | syntaxin binding protein 3 | |
1 | 1 | ||||||
| MIRT061005 | C1ORF21 | chromosome 1 open reading frame 21 | |
1 | 3 | ||||||
| MIRT061244 | AMOTL1 | angiomotin like 1 | |
1 | 6 | ||||||
| MIRT061529 | BTG2 | BTG family, member 2 | |
1 | 1 | ||||||
| MIRT063394 | ETNK1 | ethanolamine kinase 1 | |
1 | 1 | ||||||
| MIRT065711 | TARBP2 | TAR (HIV-1) RNA binding protein 2 | |
1 | 2 | ||||||
| MIRT066291 | MTFR1L | family with sequence similarity 54, member B | |
1 | 1 | ||||||
| MIRT066312 | USP15 | ubiquitin specific peptidase 15 | |
1 | 1 | ||||||
| MIRT068655 | AKAP11 | A kinase (PRKA) anchor protein 11 | |
1 | 1 | ||||||
| MIRT071206 | FCF1 | FCF1 small subunit (SSU) processome component homolog (S. cerevisiae) | |
1 | 1 | ||||||
| MIRT072822 | ARIH1 | ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) | |
1 | 3 | ||||||
| MIRT074530 | PAGR1 | PAXIP1 associated glutamate-rich protein 1 | |
1 | 2 | ||||||
| MIRT075249 | SNTB2 | syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) | |
1 | 2 | ||||||
| MIRT075273 | VPS4A | vacuolar protein sorting 4 homolog A (S. cerevisiae) | |
1 | 4 | ||||||
| MIRT075891 | C16ORF72 | chromosome 16 open reading frame 72 | |
1 | 4 | ||||||
| MIRT076791 | GOSR1 | golgi SNAP receptor complex member 1 | |
1 | 1 | ||||||
| MIRT077781 | MINK1 | misshapen-like kinase 1 | |
1 | 1 | ||||||
| MIRT078282 | RPS6KB1 | ribosomal protein S6 kinase, 70kDa, polypeptide 1 | |
1 | 1 | ||||||
| MIRT079655 | NAPG | N-ethylmaleimide-sensitive factor attachment protein, gamma | |
1 | 6 | ||||||
| MIRT080011 | GALNT1 | UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) | |
1 | 2 | ||||||
| MIRT082985 | PNPLA6 | patatin-like phospholipase domain containing 6 | |
1 | 1 | ||||||
| MIRT083265 | ZCCHC3 | zinc finger, CCHC domain containing 3 | |
1 | 3 | ||||||
| MIRT084462 | SOWAHC | sosondowah ankyrin repeat domain family member C | |
1 | 2 | ||||||
| MIRT085215 | CCNT2 | cyclin T2 | |
1 | 1 | ||||||
| MIRT086005 | UBR3 | ubiquitin protein ligase E3 component n-recognin 3 (putative) | |
1 | 1 | ||||||
| MIRT087424 | ZNRF3 | zinc and ring finger 3 | |
1 | 1 | ||||||
| MIRT087554 | YWHAH | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide | |
1 | 1 | ||||||
| MIRT088102 | SEPT2 | septin 2 | |
1 | 1 | ||||||
| MIRT089105 | B3GNT2 | UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 | |
1 | 2 | ||||||
| MIRT089206 | ACTR2 | ARP2 actin-related protein 2 homolog (yeast) | |
1 | 2 | ||||||
| MIRT090446 | CDV3 | CDV3 homolog (mouse) | |
1 | 1 | ||||||
| MIRT090688 | U2SURP | U2 snRNP-associated SURP domain containing | |
1 | 1 | ||||||
| MIRT091667 | RARB | retinoic acid receptor, beta | |
1 | 3 | ||||||
| MIRT092190 | ITPR1 | inositol 1,4,5-trisphosphate receptor, type 1 | |
1 | 1 | ||||||
| MIRT092209 | BHLHE40 | basic helix-loop-helix family, member e40 | |
1 | 1 | ||||||
| MIRT093682 | PI4K2B | phosphatidylinositol 4-kinase type 2 beta | |
1 | 3 | ||||||
| MIRT096234 | CANX | calnexin | |
1 | 1 | ||||||
| MIRT098827 | PCMT1 | protein-L-isoaspartate (D-aspartate) O-methyltransferase | |
1 | 1 | ||||||
| MIRT099631 | E2F3 | E2F transcription factor 3 | |
1 | 1 | ||||||
| MIRT100207 | PPP1R11 | protein phosphatase 1, regulatory (inhibitor) subunit 11 | |
1 | 1 | ||||||
| MIRT100364 | HSPA1B | heat shock 70kDa protein 1B | |
|
2 | 5 | |||||
| MIRT100566 | PIM1 | pim-1 oncogene | |
1 | 1 | ||||||
| MIRT100896 | CD2AP | CD2-associated protein | |
1 | 1 | ||||||
| MIRT102434 | CALU | calumenin | |
1 | 2 | ||||||
| MIRT102632 | UBN2 | ubinuclein 2 | |
1 | 6 | ||||||
| MIRT102971 | EN2 | engrailed homeobox 2 | |
1 | 3 | ||||||
| MIRT103092 | MAFK | v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) | |
1 | 3 | ||||||
| MIRT103856 | FOXK1 | forkhead box K1 | |
1 | 2 | ||||||
| MIRT104015 | USP42 | ubiquitin specific peptidase 42 | |
1 | 3 | ||||||
| MIRT106292 | ZFHX4 | zinc finger homeobox 4 | |
1 | 3 | ||||||
| MIRT106733 | RAD23B | RAD23 homolog B (S. cerevisiae) | |
1 | 2 | ||||||
| MIRT107218 | ZBTB34 | zinc finger and BTB domain containing 34 | |
1 | 1 | ||||||
| MIRT108983 | SLC9A6 | solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6 | |
1 | 1 | ||||||
| MIRT109240 | ZNF275 | zinc finger protein 275 | |
1 | 1 | ||||||
| MIRT110051 | OGT | O-linked N-acetylglucosamine (GlcNAc) transferase | |
1 | 4 | ||||||
| MIRT112969 | LUZP1 | leucine zipper protein 1 | |
1 | 3 | ||||||
| MIRT114923 | CHAC1 | ChaC, cation transport regulator homolog 1 (E. coli) | |
1 | 1 | ||||||
| MIRT117655 | SCAMP4 | secretory carrier membrane protein 4 | |
1 | 1 | ||||||
| MIRT120680 | PAK2 | p21 protein (Cdc42/Rac)-activated kinase 2 | |
1 | 1 | ||||||
| MIRT127725 | ENTPD1 | ectonucleoside triphosphate diphosphohydrolase 1 | |
1 | 2 | ||||||
| MIRT128798 | UBE4A | ubiquitination factor E4A | |
1 | 1 | ||||||
| MIRT129055 | ARCN1 | archain 1 | |
1 | 1 | ||||||
| MIRT130380 | PTPRJ | protein tyrosine phosphatase, receptor type, J | |
1 | 1 | ||||||
| MIRT131097 | TMEM138 | transmembrane protein 138 | |
1 | 1 | ||||||
| MIRT132734 | RASSF5 | Ras association (RalGDS/AF-6) domain family member 5 | |
1 | 1 | ||||||
| MIRT132831 | MAPKAPK2 | mitogen-activated protein kinase-activated protein kinase 2 | |
1 | 1 | ||||||
| MIRT133334 | BCL7A | B-cell CLL/lymphoma 7A | |
1 | 1 | ||||||
| MIRT133769 | SKI | v-ski sarcoma viral oncogene homolog (avian) | |
1 | 2 | ||||||
| MIRT137517 | RCOR1 | REST corepressor 1 | |
1 | 1 | ||||||
| MIRT140146 | SPRED1 | sprouty-related, EVH1 domain containing 1 | |
1 | 2 | ||||||
| MIRT140820 | SMAD3 | SMAD family member 3 | |
1 | 1 | ||||||
| MIRT141243 | SCAMP5 | secretory carrier membrane protein 5 | |
1 | 1 | ||||||
| MIRT141279 | UBE2Q2 | ubiquitin-conjugating enzyme E2Q family member 2 | |
1 | 1 | ||||||
| MIRT142237 | DCTN5 | dynactin 5 (p25) | |
1 | 5 | ||||||
| MIRT144019 | PSKH1 | protein serine kinase H1 | |
1 | 1 | ||||||
| MIRT145377 | ANKRD13B | ankyrin repeat domain 13B | |
1 | 1 | ||||||
| MIRT146014 | EZH1 | enhancer of zeste homolog 1 (Drosophila) | |
1 | 1 | ||||||
| MIRT146351 | PNPO | pyridoxamine 5'-phosphate oxidase | |
1 | 1 | ||||||
| MIRT146496 | SNX11 | sorting nexin 11 | |
1 | 1 | ||||||
| MIRT148302 | RNF138 | ring finger protein 138, E3 ubiquitin protein ligase | |
1 | 1 | ||||||
| MIRT150354 | IER2 | immediate early response 2 | |
1 | 1 | ||||||
| MIRT152274 | TNFSF9 | tumor necrosis factor (ligand) superfamily, member 9 | |
1 | 2 | ||||||
| MIRT152503 | ENTPD6 | ectonucleoside triphosphate diphosphohydrolase 6 (putative) | |
1 | 1 | ||||||
| MIRT152736 | KIF3B | kinesin family member 3B | |
1 | 1 | ||||||
| MIRT152922 | NOL4L | chromosome 20 open reading frame 112 | |
1 | 1 | ||||||
| MIRT154043 | RASSF2 | Ras association (RalGDS/AF-6) domain family member 2 | |
1 | 1 | ||||||
| MIRT154392 | CDS2 | CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 | |
1 | 1 | ||||||
| MIRT156452 | ATP5G3 | ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9) | |
1 | 1 | ||||||
| MIRT158519 | TNRC6B | trinucleotide repeat containing 6B | |
1 | 3 | ||||||
| MIRT158990 | EPT1 | ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific) | |
1 | 1 | ||||||
| MIRT159580 | PEX13 | peroxisomal biogenesis factor 13 | |
1 | 1 | ||||||
| MIRT160169 | TET3 | tet methylcytosine dioxygenase 3 | |
1 | 1 | ||||||
| MIRT163253 | PRKCD | protein kinase C, delta | |
1 | 1 | ||||||
| MIRT164260 | CPEB2 | cytoplasmic polyadenylation element binding protein 2 | |
1 | 1 | ||||||
| MIRT164952 | TADA2B | transcriptional adaptor 2B | |
1 | 1 | ||||||
| MIRT165172 | GRAMD3 | GRAM domain containing 3 | |
1 | 2 | ||||||
| MIRT165883 | CREBRF | CREB3 regulatory factor | |
1 | 2 | ||||||
| MIRT168680 | CDKN1A | cyclin-dependent kinase inhibitor 1A (p21, Cip1) | |
1 | 1 | ||||||
| MIRT169058 | IRF4 | interferon regulatory factor 4 | |
1 | 1 | ||||||
| MIRT170136 | KLHDC10 | kelch domain containing 10 | |
1 | 1 | ||||||
| MIRT170733 | UBE3C | ubiquitin protein ligase E3C | |
1 | 1 | ||||||
| MIRT171597 | SUN1 | Sad1 and UNC84 domain containing 1 | |
1 | 1 | ||||||
| MIRT172813 | HMBOX1 | homeobox containing 1 | |
1 | 1 | ||||||
| MIRT174781 | RNF38 | ring finger protein 38 | |
1 | 1 | ||||||
| MIRT175232 | PSAT1 | phosphoserine aminotransferase 1 | |
1 | 4 | ||||||
| MIRT175524 | ZBTB33 | zinc finger and BTB domain containing 33 | |
1 | 1 | ||||||
| MIRT179008 | PAFAH1B2 | platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) | |
1 | 1 | ||||||
| MIRT180909 | RPRD2 | regulation of nuclear pre-mRNA domain containing 2 | |
1 | 4 | ||||||
| MIRT186371 | PNRC2 | proline-rich nuclear receptor coactivator 2 | |
1 | 1 | ||||||
| MIRT189760 | CDADC1 | cytidine and dCMP deaminase domain containing 1 | |
1 | 1 | ||||||
| MIRT189961 | AGO4 | eukaryotic translation initiation factor 2C, 4 | |
1 | 1 | ||||||
| MIRT190184 | GPR180 | G protein-coupled receptor 180 | |
1 | 3 | ||||||
| MIRT191454 | PPM1A | protein phosphatase, Mg2+/Mn2+ dependent, 1A | |
1 | 1 | ||||||
| MIRT191625 | SLC39A9 | solute carrier family 39 (zinc transporter), member 9 | |
1 | 3 | ||||||
| MIRT194237 | FAM103A1 | family with sequence similarity 103, member A1 | |
1 | 3 | ||||||
| MIRT194903 | RBBP6 | retinoblastoma binding protein 6 | |
1 | 4 | ||||||
| MIRT196275 | PAFAH1B1 | platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa) | |
1 | 1 | ||||||
| MIRT196450 | TAOK1 | TAO kinase 1 | |
1 | 1 | ||||||
| MIRT201456 | SNRPB2 | small nuclear ribonucleoprotein polypeptide B | |
1 | 4 | ||||||
| MIRT204592 | HSPE1-MOB4 | HSPE1-MOB4 readthrough | |
1 | 4 | ||||||
| MIRT204623 | MOB4 | MOB family member 4, phocein | |
1 | 4 | ||||||
| MIRT204741 | BZW1 | basic leucine zipper and W2 domains 1 | |
1 | 6 | ||||||
| MIRT206020 | NUP50 | nucleoporin 50kDa | |
1 | 4 | ||||||
| MIRT211199 | FGF2 | fibroblast growth factor 2 (basic) | |
1 | 2 | ||||||
| MIRT211314 | HSPA4L | heat shock 70kDa protein 4-like | |
1 | 2 | ||||||
| MIRT212604 | RBPJ | recombination signal binding protein for immunoglobulin kappa J region | |
1 | 4 | ||||||
| MIRT217743 | TBPL1 | TBP-like 1 | |
1 | 2 | ||||||
| MIRT223681 | FZD6 | frizzled family receptor 6 | |
1 | 3 | ||||||
| MIRT224965 | BAG4 | BCL2-associated athanogene 4 | |
1 | 1 | ||||||
| MIRT229343 | ZNF449 | zinc finger protein 449 | |
1 | 1 | ||||||
| MIRT229860 | YIPF6 | Yip1 domain family, member 6 | |
1 | 1 | ||||||
| MIRT230120 | DDX3Y | DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked | |
1 | 1 | ||||||
| MIRT234342 | MSL1 | male-specific lethal 1 homolog (Drosophila) | |
1 | 4 | ||||||
| MIRT245003 | ENTPD7 | ectonucleoside triphosphate diphosphohydrolase 7 | |
1 | 1 | ||||||
| MIRT246938 | PRRC2C | proline-rich coiled-coil 2C | |
1 | 1 | ||||||
| MIRT247095 | WEE1 | WEE1 homolog (S. pombe) | |
1 | 2 | ||||||
| MIRT247236 | ELK4 | ELK4, ETS-domain protein (SRF accessory protein 1) | |
1 | 2 | ||||||
| MIRT247368 | GABARAPL1 | GABA(A) receptor-associated protein like 1 | |
1 | 3 | ||||||
| MIRT248550 | PDIK1L | PDLIM1 interacting kinase 1 like | |
1 | 1 | ||||||
| MIRT248765 | ATXN7L3B | ataxin 7-like 3B | |
1 | 2 | ||||||
| MIRT249449 | ZNF691 | zinc finger protein 691 | |
1 | 2 | ||||||
| MIRT251487 | DYNLL2 | dynein, light chain, LC8-type 2 | |
1 | 2 | ||||||
| MIRT255333 | SRPRB | signal recognition particle receptor, B subunit | |
1 | 3 | ||||||
| MIRT256305 | CDC42SE2 | CDC42 small effector 2 | |
1 | 1 | ||||||
| MIRT258410 | WIPI2 | WD repeat domain, phosphoinositide interacting 2 | |
1 | 2 | ||||||
| MIRT265056 | TBRG1 | transforming growth factor beta regulator 1 | |
1 | 1 | ||||||
| MIRT265076 | CHEK1 | checkpoint kinase 1 | |
1 | 2 | ||||||
| MIRT267254 | TMEM109 | transmembrane protein 109 | |
1 | 1 | ||||||
| MIRT267527 | C1ORF226 | chromosome 1 open reading frame 226 | |
1 | 1 | ||||||
| MIRT270454 | SIRT4 | sirtuin 4 | |
1 | 1 | ||||||
| MIRT270552 | SETD1B | SET domain containing 1B | |
1 | 1 | ||||||
| MIRT273665 | HOXC8 | homeobox C8 | |
1 | 1 | ||||||
| MIRT274741 | RAB3IP | RAB3A interacting protein (rabin3) | |
1 | 1 | ||||||
| MIRT277504 | PPP2R5C | protein phosphatase 2, regulatory subunit B', gamma | |
1 | 2 | ||||||
| MIRT282532 | SLCO3A1 | solute carrier organic anion transporter family, member 3A1 | |
1 | 1 | ||||||
| MIRT286968 | MLLT6 | myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 | |
1 | 1 | ||||||
| MIRT289625 | CBX2 | chromobox homolog 2 | |
1 | 1 | ||||||
| MIRT294283 | ZFP28 | zinc finger protein 28 homolog (mouse) | |
1 | 1 | ||||||
| MIRT295810 | CHMP4B | charged multivesicular body protein 4B | |
1 | 1 | ||||||
| MIRT297778 | GABPA | GA binding protein transcription factor, alpha subunit 60kDa | |
1 | 2 | ||||||
| MIRT300100 | STRADB | STE20-related kinase adaptor beta | |
1 | 1 | ||||||
| MIRT300992 | MTMR3 | myotubularin related protein 3 | |
1 | 1 | ||||||
| MIRT302611 | CRIM1 | cysteine rich transmembrane BMP regulator 1 (chordin-like) | |
1 | 3 | ||||||
| MIRT302825 | SOCS5 | suppressor of cytokine signaling 5 | |
1 | 1 | ||||||
| MIRT307141 | CTDSPL | CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like | |
1 | 2 | ||||||
| MIRT313675 | ITGA2 | integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) | |
1 | 1 | ||||||
| MIRT314051 | PIK3R1 | phosphoinositide-3-kinase, regulatory subunit 1 (alpha) | |
1 | 4 | ||||||
| MIRT317722 | PPIL1 | peptidylprolyl isomerase (cyclophilin)-like 1 | |
1 | 4 | ||||||
| MIRT319331 | CAPZA2 | capping protein (actin filament) muscle Z-line, alpha 2 | |
1 | 1 | ||||||
| MIRT320626 | ZNRF2 | zinc and ring finger 2 | |
1 | 1 | ||||||
| MIRT324839 | IFT74 | intraflagellar transport 74 homolog (Chlamydomonas) | |
1 | 1 | ||||||
| MIRT326301 | OCRL | oculocerebrorenal syndrome of Lowe | |
1 | 1 | ||||||
| MIRT327962 | CHIC1 | cysteine-rich hydrophobic domain 1 | |
1 | 3 | ||||||
| MIRT437998 | KLF6 | Kruppel-like factor 6 | |
|
2 | 1 | |||||
| MIRT438163 | PHLPP1 | PH domain and leucine rich repeat protein phosphatase 1 | |
|
|
3 | 1 | ||||
| MIRT438610 | RET | ret proto-oncogene | |
1 | 1 | ||||||
| MIRT443809 | SIDT2 | SID1 transmembrane family, member 2 | |
1 | 1 | ||||||
| MIRT446508 | ASCC1 | activating signal cointegrator 1 complex subunit 1 | |
1 | 1 | ||||||
| MIRT447778 | DMRT2 | doublesex and mab-3 related transcription factor 2 | |
1 | 1 | ||||||
| MIRT448440 | TLL1 | tolloid-like 1 | |
1 | 1 | ||||||
| MIRT449190 | LUC7L3 | LUC7-like 3 (S. cerevisiae) | |
1 | 1 | ||||||
| MIRT451839 | ALDH3B1 | aldehyde dehydrogenase 3 family, member B1 | |
1 | 1 | ||||||
| MIRT453288 | EFTUD2 | elongation factor Tu GTP binding domain containing 2 | |
1 | 1 | ||||||
| MIRT453754 | CSNK1E | casein kinase 1, epsilon | |
1 | 1 | ||||||
| MIRT454970 | TPM2 | tropomyosin 2 (beta) | |
1 | 1 | ||||||
| MIRT456867 | ZNF460 | zinc finger protein 460 | |
1 | 5 | ||||||
| MIRT460224 | FGFR4 | fibroblast growth factor receptor 4 | |
1 | 1 | ||||||
| MIRT460438 | DOCK11 | dedicator of cytokinesis 11 | |
1 | 1 | ||||||
| MIRT461564 | ACTR3B | ARP3 actin-related protein 3 homolog B (yeast) | |
1 | 1 | ||||||
| MIRT463167 | ZNF367 | zinc finger protein 367 | |
1 | 5 | ||||||
| MIRT464668 | UBE2V1 | ubiquitin-conjugating enzyme E2 variant 1 | |
1 | 4 | ||||||
| MIRT464751 | UBE2Q1 | ubiquitin-conjugating enzyme E2Q family member 1 | |
1 | 2 | ||||||
| MIRT465165 | TSC22D2 | TSC22 domain family, member 2 | |
1 | 1 | ||||||
| MIRT465570 | TOB2 | transducer of ERBB2, 2 | |
1 | 1 | ||||||
| MIRT465926 | TMEM189-UBE2V1 | TMEM189-UBE2V1 readthrough | |
1 | 4 | ||||||
| MIRT466008 | TMEM189 | transmembrane protein 189 | |
1 | 4 | ||||||
| MIRT466298 | TM4SF1 | transmembrane 4 L six family member 1 | |
1 | 1 | ||||||
| MIRT466436 | TFAP2A | transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) | |
1 | 4 | ||||||
| MIRT466917 | STK38 | serine/threonine kinase 38 | |
1 | 5 | ||||||
| MIRT467002 | SSRP1 | structure specific recognition protein 1 | |
1 | 3 | ||||||
| MIRT468052 | SIK1 | salt-inducible kinase 1 | |
1 | 2 | ||||||
| MIRT468151 | SH3BP4 | SH3-domain binding protein 4 | |
1 | 1 | ||||||
| MIRT468676 | SEC24A | SEC24 family, member A (S. cerevisiae) | |
1 | 2 | ||||||
| MIRT469090 | RNF168 | ring finger protein 168, E3 ubiquitin protein ligase | |
1 | 1 | ||||||
| MIRT469415 | REL | v-rel reticuloendotheliosis viral oncogene homolog (avian) | |
1 | 3 | ||||||
| MIRT471038 | PISD | phosphatidylserine decarboxylase | |
1 | 5 | ||||||
| MIRT471495 | PDE4D | phosphodiesterase 4D, cAMP-specific | |
1 | 2 | ||||||
| MIRT471956 | NR6A1 | nuclear receptor subfamily 6, group A, member 1 | |
1 | 1 | ||||||
| MIRT472263 | NFIC | nuclear factor I/C (CCAAT-binding transcription factor) | |
1 | 1 | ||||||
| MIRT472665 | NAA25 | N(alpha)-acetyltransferase 25, NatB auxiliary subunit | |
1 | 2 | ||||||
| MIRT474318 | LAMC1 | laminin, gamma 1 (formerly LAMB2) | |
1 | 1 | ||||||
| MIRT474828 | KIAA0226 | KIAA0226 | |
1 | 1 | ||||||
| MIRT475068 | IVNS1ABP | influenza virus NS1A binding protein | |
1 | 3 | ||||||
| MIRT475123 | IPPK | inositol 1,3,4,5,6-pentakisphosphate 2-kinase | |
1 | 1 | ||||||
| MIRT475539 | HOXA3 | homeobox A3 | |
1 | 4 | ||||||
| MIRT475720 | HEYL | hairy/enhancer-of-split related with YRPW motif-like | |
1 | 1 | ||||||
| MIRT475843 | HDGF | hepatoma-derived growth factor | |
1 | 2 | ||||||
| MIRT476259 | GNB1 | guanine nucleotide binding protein (G protein), beta polypeptide 1 | |
1 | 4 | ||||||
| MIRT476276 | GNAL | guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type | |
1 | 3 | ||||||
| MIRT476698 | FURIN | furin (paired basic amino acid cleaving enzyme) | |
1 | 1 | ||||||
| MIRT477565 | EIF1AX | eukaryotic translation initiation factor 1A, X-linked | |
1 | 4 | ||||||
| MIRT477849 | DYRK3 | dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 | |
1 | 1 | ||||||
| MIRT478911 | CPSF7 | cleavage and polyadenylation specific factor 7, 59kDa | |
1 | 3 | ||||||
| MIRT479457 | CDK6 | cyclin-dependent kinase 6 | |
1 | 1 | ||||||
| MIRT479988 | CARD10 | caspase recruitment domain family, member 10 | |
1 | 1 | ||||||
| MIRT481181 | AVL9 | AVL9 homolog (S. cerevisiase) | |
1 | 3 | ||||||
| MIRT482370 | AGO2 | eukaryotic translation initiation factor 2C, 2 | |
1 | 1 | ||||||
| MIRT482556 | ABL2 | v-abl Abelson murine leukemia viral oncogene homolog 2 | |
1 | 5 | ||||||
| MIRT482581 | ABHD2 | abhydrolase domain containing 2 | |
1 | 1 | ||||||
| MIRT484778 | ABCC6 | ATP-binding cassette, sub-family C (CFTR/MRP), member 6 | |
1 | 2 | ||||||
| MIRT485215 | PRKAR2A | protein kinase, cAMP-dependent, regulatory, type II, alpha | |
1 | 4 | ||||||
| MIRT487394 | C10orf54 | chromosome 10 open reading frame 54 | |
1 | 1 | ||||||
| MIRT492715 | PHYHIP | phytanoyl-CoA 2-hydroxylase interacting protein | |
1 | 1 | ||||||
| MIRT494354 | CASKIN1 | CASK interacting protein 1 | |
1 | 1 | ||||||
| MIRT495146 | ZNRF1 | zinc and ring finger 1, E3 ubiquitin protein ligase | |
1 | 1 | ||||||
| MIRT496019 | CD180 | CD180 molecule | |
1 | 1 | ||||||
| MIRT497776 | KIAA0895 | KIAA0895 | |
1 | 1 | ||||||
| MIRT498984 | ORC4 | origin recognition complex, subunit 4 | |
1 | 4 | ||||||
| MIRT499456 | ODF2L | outer dense fiber of sperm tails 2-like | |
1 | 4 | ||||||
| MIRT499619 | DNAJA1 | DnaJ (Hsp40) homolog, subfamily A, member 1 | |
1 | 4 | ||||||
| MIRT500097 | L2HGDH | L-2-hydroxyglutarate dehydrogenase | |
1 | 4 | ||||||
| MIRT500321 | ZNF622 | zinc finger protein 622 | |
1 | 5 | ||||||
| MIRT500425 | ZMAT3 | zinc finger, matrin-type 3 | |
1 | 2 | ||||||
| MIRT500580 | USP53 | ubiquitin specific peptidase 53 | |
1 | 1 | ||||||
| MIRT500860 | SYPL1 | synaptophysin-like 1 | |
1 | 4 | ||||||
| MIRT500936 | SRPR | signal recognition particle receptor (docking protein) | |
1 | 4 | ||||||
| MIRT500953 | SREK1 | splicing regulatory glutamine/lysine-rich protein 1 | |
1 | 4 | ||||||
| MIRT501089 | SMAD7 | SMAD family member 7 | |
1 | 4 | ||||||
| MIRT501506 | PRICKLE2 | prickle homolog 2 (Drosophila) | |
1 | 1 | ||||||
| MIRT502038 | LRIG2 | leucine-rich repeats and immunoglobulin-like domains 2 | |
1 | 1 | ||||||
| MIRT502151 | KIF5B | kinesin family member 5B | |
1 | 5 | ||||||
| MIRT502496 | FAM122B | family with sequence similarity 122B | |
1 | 4 | ||||||
| MIRT502570 | E2F7 | E2F transcription factor 7 | |
1 | 6 | ||||||
| MIRT502643 | DDX3X | DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked | |
1 | 4 | ||||||
| MIRT502922 | CDCA4 | cell division cycle associated 4 | |
1 | 5 | ||||||
| MIRT502950 | CDC37L1 | cell division cycle 37 homolog (S. cerevisiae)-like 1 | |
1 | 5 | ||||||
| MIRT503140 | ATG9A | autophagy related 9A | |
1 | 4 | ||||||
| MIRT504338 | ASGR2 | asialoglycoprotein receptor 2 | |
1 | 3 | ||||||
| MIRT504540 | ZNF620 | zinc finger protein 620 | |
1 | 3 | ||||||
| MIRT504855 | HAUS3 | HAUS augmin-like complex, subunit 3 | |
1 | 3 | ||||||
| MIRT505116 | YTHDC1 | YTH domain containing 1 | |
1 | 3 | ||||||
| MIRT505349 | TMEM245 | transmembrane protein 245 | |
1 | 3 | ||||||
| MIRT505398 | TMEM100 | transmembrane protein 100 | |
1 | 1 | ||||||
| MIRT505505 | SRSF1 | serine/arginine-rich splicing factor 1 | |
1 | 3 | ||||||
| MIRT505549 | SNX16 | sorting nexin 16 | |
1 | 3 | ||||||
| MIRT505686 | SESTD1 | SEC14 and spectrin domains 1 | |
1 | 3 | ||||||
| MIRT505911 | RIMS3 | regulating synaptic membrane exocytosis 3 | |
1 | 3 | ||||||
| MIRT505930 | RCAN3 | RCAN family member 3 | |
1 | 2 | ||||||
| MIRT506112 | PPIG | peptidylprolyl isomerase G (cyclophilin G) | |
1 | 3 | ||||||
| MIRT506138 | PLRG1 | pleiotropic regulator 1 | |
1 | 2 | ||||||
| MIRT506166 | PLAG1 | pleiomorphic adenoma gene 1 | |
1 | 5 | ||||||
| MIRT506194 | PHKA1 | phosphorylase kinase, alpha 1 (muscle) | |
1 | 3 | ||||||
| MIRT506487 | MYO5A | myosin VA (heavy chain 12, myoxin) | |
1 | 4 | ||||||
| MIRT506854 | KIF23 | kinesin family member 23 | |
1 | 4 | ||||||
| MIRT507002 | HNRNPDL | heterogeneous nuclear ribonucleoprotein D-like | |
1 | 3 | ||||||
| MIRT507820 | CDK1 | cyclin-dependent kinase 1 | |
1 | 3 | ||||||
| MIRT507853 | CCNE2 | cyclin E2 | |
1 | 3 | ||||||
| MIRT507877 | CBX6 | chromobox homolog 6 | |
1 | 1 | ||||||
| MIRT508041 | AXIN2 | axin 2 | |
1 | 3 | ||||||
| MIRT508644 | CASK | calcium/calmodulin-dependent serine protein kinase (MAGUK family) | |
1 | 2 | ||||||
| MIRT509368 | DMPK | dystrophia myotonica-protein kinase | |
1 | 5 | ||||||
| MIRT509693 | ATAD5 | ATPase family, AAA domain containing 5 | |
1 | 2 | ||||||
| MIRT510047 | AKR1B10 | aldo-keto reductase family 1, member B10 (aldose reductase) | |
1 | 2 | ||||||
| MIRT511847 | GPATCH8 | G patch domain containing 8 | |
1 | 3 | ||||||
| MIRT512288 | ARHGDIA | Rho GDP dissociation inhibitor (GDI) alpha | |
1 | 4 | ||||||
| MIRT512646 | CPEB3 | cytoplasmic polyadenylation element binding protein 3 | |
1 | 3 | ||||||
| MIRT513854 | JARID2 | jumonji, AT rich interactive domain 2 | |
1 | 4 | ||||||
| MIRT514020 | CAMSAP1 | calmodulin regulated spectrin-associated protein 1 | |
1 | 3 | ||||||
| MIRT514042 | ATG14 | autophagy related 14 | |
1 | 1 | ||||||
| MIRT518095 | TRIM35 | tripartite motif containing 35 | |
1 | 1 | ||||||
| MIRT518533 | FLCN | folliculin | |
1 | 3 | ||||||
| MIRT518998 | NNT | nicotinamide nucleotide transhydrogenase | |
1 | 2 | ||||||
| MIRT521055 | SLC2A3 | solute carrier family 2 (facilitated glucose transporter), member 3 | |
1 | 2 | ||||||
| MIRT521207 | SBNO1 | strawberry notch homolog 1 (Drosophila) | |
1 | 3 | ||||||
| MIRT521818 | POM121C | POM121 transmembrane nucleoporin C | |
1 | 1 | ||||||
| MIRT522098 | NUFIP2 | nuclear fragile X mental retardation protein interacting protein 2 | |
1 | 3 | ||||||
| MIRT522778 | LAMP2 | lysosomal-associated membrane protein 2 | |
1 | 3 | ||||||
| MIRT537815 | EFNB2 | ephrin-B2 | |
1 | 2 | ||||||
| MIRT539902 | RPL14 | ribosomal protein L14 | |
1 | 2 | ||||||
| MIRT540847 | GNAT1 | guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1 | |
1 | 2 | ||||||
| MIRT541217 | HOXA10 | homeobox A10 | |
1 | 1 | ||||||
| MIRT541432 | CBX4 | chromobox homolog 4 | |
1 | 2 | ||||||
| MIRT542810 | PHC3 | polyhomeotic homolog 3 (Drosophila) | |
1 | 2 | ||||||
| MIRT542837 | PDCD1 | programmed cell death 1 | |
1 | 3 | ||||||
| MIRT543062 | BAZ2A | bromodomain adjacent to zinc finger domain, 2A | |
1 | 1 | ||||||
| MIRT543310 | ZNF585B | zinc finger protein 585B | |
1 | 1 | ||||||
| MIRT543411 | ANAPC13 | anaphase promoting complex subunit 13 | |
1 | 1 | ||||||
| MIRT543529 | PRSS21 | protease, serine, 21 (testisin) | |
1 | 1 | ||||||
| MIRT543801 | RALGAPB | Ral GTPase activating protein, beta subunit (non-catalytic) | |
1 | 2 | ||||||
| MIRT543839 | GSG1 | germ cell associated 1 | |
1 | 1 | ||||||
| MIRT544575 | POLDIP3 | polymerase (DNA-directed), delta interacting protein 3 | |
1 | 1 | ||||||
| MIRT544593 | AP5Z1 | adaptor-related protein complex 5, zeta 1 subunit | |
1 | 2 | ||||||
| MIRT544916 | CLSPN | claspin | |
1 | 1 | ||||||
| MIRT544969 | UGT2B4 | UDP glucuronosyltransferase 2 family, polypeptide B4 | |
1 | 1 | ||||||
| MIRT545190 | MAP4K2 | mitogen-activated protein kinase kinase kinase kinase 2 | |
1 | 2 | ||||||
| MIRT545351 | CCDC83 | coiled-coil domain containing 83 | |
1 | 1 | ||||||
| MIRT545686 | DECR1 | 2,4-dienoyl CoA reductase 1, mitochondrial | |
1 | 1 | ||||||
| MIRT545961 | ZBTB10 | zinc finger and BTB domain containing 10 | |
1 | 1 | ||||||
| MIRT545973 | YWHAQ | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide | |
1 | 1 | ||||||
| MIRT546118 | USP48 | ubiquitin specific peptidase 48 | |
1 | 2 | ||||||
| MIRT546611 | SALL1 | sal-like 1 (Drosophila) | |
1 | 2 | ||||||
| MIRT546619 | RUNX1T1 | runt-related transcription factor 1; translocated to, 1 (cyclin D-related) | |
1 | 1 | ||||||
| MIRT546640 | RTN4 | reticulon 4 | |
1 | 1 | ||||||
| MIRT547069 | PNISR | PNN-interacting serine/arginine-rich protein | |
1 | 2 | ||||||
| MIRT547131 | PHLPP2 | PH domain and leucine rich repeat protein phosphatase 2 | |
1 | 1 | ||||||
| MIRT547233 | PAG1 | phosphoprotein associated with glycosphingolipid microdomains 1 | |
1 | 2 | ||||||
| MIRT547305 | NUCKS1 | nuclear casein kinase and cyclin-dependent kinase substrate 1 | |
1 | 2 | ||||||
| MIRT547406 | MKX | mohawk homeobox | |
1 | 1 | ||||||
| MIRT547463 | MBD4 | methyl-CpG binding domain protein 4 | |
1 | 1 | ||||||
| MIRT547546 | LRRFIP2 | leucine rich repeat (in FLII) interacting protein 2 | |
1 | 2 | ||||||
| MIRT547661 | KPNA3 | karyopherin alpha 3 (importin alpha 4) | |
1 | 1 | ||||||
| MIRT547702 | KPNA1 | karyopherin alpha 1 (importin alpha 5) | |
1 | 2 | ||||||
| MIRT547968 | HIGD1A | HIG1 hypoxia inducible domain family, member 1A | |
1 | 2 | ||||||
| MIRT548001 | HCFC2 | host cell factor C2 | |
1 | 2 | ||||||
| MIRT548018 | GRB2 | growth factor receptor-bound protein 2 | |
1 | 2 | ||||||
| MIRT548219 | FKBP1A | FK506 binding protein 1A, 12kDa | |
1 | 1 | ||||||
| MIRT548275 | FBXL20 | F-box and leucine-rich repeat protein 20 | |
1 | 1 | ||||||
| MIRT548727 | CRK | v-crk sarcoma virus CT10 oncogene homolog (avian) | |
1 | 1 | ||||||
| MIRT548809 | CLIP4 | CAP-GLY domain containing linker protein family, member 4 | |
1 | 2 | ||||||
| MIRT548946 | CDK17 | cyclin-dependent kinase 17 | |
1 | 2 | ||||||
| MIRT549076 | CACUL1 | CDK2-associated, cullin domain 1 | |
1 | 1 | ||||||
| MIRT549123 | C11orf24 | chromosome 11 open reading frame 24 | |
1 | 2 | ||||||
| MIRT549278 | ASH1L | ash1 (absent, small, or homeotic)-like (Drosophila) | |
1 | 2 | ||||||
| MIRT549389 | AMOT | angiomotin | |
1 | 1 | ||||||
| MIRT550405 | SLC29A1 | solute carrier family 29 (nucleoside transporters), member 1 | |
1 | 2 | ||||||
| MIRT550470 | OSCAR | osteoclast associated, immunoglobulin-like receptor | |
1 | 2 | ||||||
| MIRT550619 | MTHFR | methylenetetrahydrofolate reductase (NAD(P)H) | |
1 | 1 | ||||||
| MIRT550827 | FAM229B | chromosome 6 open reading frame 225 | |
1 | 1 | ||||||
| MIRT551383 | EPM2AIP1 | EPM2A (laforin) interacting protein 1 | |
1 | 1 | ||||||
| MIRT551621 | ZNF267 | zinc finger protein 267 | |
1 | 1 | ||||||
| MIRT551740 | SSU72 | SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) | |
1 | 1 | ||||||
| MIRT552039 | DNAJC10 | DnaJ (Hsp40) homolog, subfamily C, member 10 | |
1 | 1 | ||||||
| MIRT552348 | ZNF704 | zinc finger protein 704 | |
1 | 1 | ||||||
| MIRT552744 | YRDC | yrdC domain containing (E. coli) | |
1 | 1 | ||||||
| MIRT553442 | TPM3 | tropomyosin 3 | |
1 | 1 | ||||||
| MIRT553565 | TMEM161B | transmembrane protein 161B | |
1 | 1 | ||||||
| MIRT553620 | TM7SF3 | transmembrane 7 superfamily member 3 | |
1 | 1 | ||||||
| MIRT553777 | TAF13 | TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa | |
1 | 2 | ||||||
| MIRT553812 | SZRD1 | SUZ RNA binding domain containing 1 | |
1 | 2 | ||||||
| MIRT554702 | RNF149 | ring finger protein 149 | |
1 | 1 | ||||||
| MIRT554965 | RACGAP1 | Rac GTPase activating protein 1 | |
1 | 1 | ||||||
| MIRT555035 | RAB23 | RAB23, member RAS oncogene family | |
1 | 1 | ||||||
| MIRT555143 | PTPRD | protein tyrosine phosphatase, receptor type, D | |
1 | 1 | ||||||
| MIRT555229 | PRKAA1 | protein kinase, AMP-activated, alpha 1 catalytic subunit | |
1 | 2 | ||||||
| MIRT555278 | PRDM4 | PR domain containing 4 | |
1 | 1 | ||||||
| MIRT555431 | PPAP2B | phosphatidic acid phosphatase type 2B | |
1 | 1 | ||||||
| MIRT556385 | LURAP1L | leucine rich adaptor protein 1-like | |
1 | 1 | ||||||
| MIRT556861 | KANK1 | KN motif and ankyrin repeat domains 1 | |
1 | 2 | ||||||
| MIRT557284 | HIST2H2BE | histone cluster 2, H2be | |
1 | 1 | ||||||
| MIRT557484 | GPR27 | G protein-coupled receptor 27 | |
1 | 2 | ||||||
| MIRT558041 | EXT1 | exostosin 1 | |
1 | 1 | ||||||
| MIRT558511 | CYP26B1 | cytochrome P450, family 26, subfamily B, polypeptide 1 | |
1 | 2 | ||||||
| MIRT558664 | CNKSR3 | CNKSR family member 3 | |
1 | 1 | ||||||
| MIRT559006 | CA8 | carbonic anhydrase VIII | |
1 | 1 | ||||||
| MIRT559155 | BTN3A3 | butyrophilin, subfamily 3, member A3 | |
1 | 1 | ||||||
| MIRT559536 | ARHGAP12 | Rho GTPase activating protein 12 | |
1 | 3 | ||||||
| MIRT560855 | OSBPL3 | oxysterol binding protein-like 3 | |
1 | 1 | ||||||
| MIRT561153 | KRT33B | keratin 33B | |
1 | 1 | ||||||
| MIRT561404 | TUBB2A | tubulin, beta 2A class IIa | |
1 | 1 | ||||||
| MIRT561878 | MSANTD4 | Myb/SANT-like DNA-binding domain containing 4 with coiled-coils | |
1 | 1 | ||||||
| MIRT562031 | LANCL1 | LanC lantibiotic synthetase component C-like 1 (bacterial) | |
1 | 1 | ||||||
| MIRT562204 | HNRNPA2B1 | heterogeneous nuclear ribonucleoprotein A2/B1 | |
1 | 1 | ||||||
| MIRT562881 | KIAA1456 | KIAA1456 | |
1 | 1 | ||||||
| MIRT563090 | SLC25A12 | solute carrier family 25 (aspartate/glutamate carrier), member 12 | |
1 | 2 | ||||||
| MIRT563507 | DLGAP3 | discs, large (Drosophila) homolog-associated protein 3 | |
1 | 1 | ||||||
| MIRT563705 | THRAP3 | thyroid hormone receptor associated protein 3 | |
1 | 1 | ||||||
| MIRT563849 | SMDT1 | chromosome 22 open reading frame 32 | |
1 | 1 | ||||||
| MIRT563900 | RAPH1 | Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 | |
1 | 1 | ||||||
| MIRT564336 | CCNT1 | cyclin T1 | |
1 | 1 | ||||||
| MIRT564482 | ZNF391 | zinc finger protein 391 | |
1 | 1 | ||||||
| MIRT564556 | CCDC80 | coiled-coil domain containing 80 | |
1 | 1 | ||||||
| MIRT564838 | ZBTB16 | zinc finger and BTB domain containing 16 | |
1 | 1 | ||||||
| MIRT564954 | XKR7 | XK, Kell blood group complex subunit-related family, member 7 | |
1 | 1 | ||||||
| MIRT564987 | WNK3 | WNK lysine deficient protein kinase 3 | |
1 | 1 | ||||||
| MIRT565041 | VAV2 | vav 2 guanine nucleotide exchange factor | |
1 | 1 | ||||||
| MIRT565400 | TGFBR3 | transforming growth factor, beta receptor III | |
1 | 1 | ||||||
| MIRT566122 | RASEF | RAS and EF-hand domain containing | |
1 | 1 | ||||||
| MIRT566654 | NCKAP1 | NCK-associated protein 1 | |
1 | 1 | ||||||
| MIRT566834 | MAP3K7 | mitogen-activated protein kinase kinase kinase 7 | |
1 | 1 | ||||||
| MIRT567017 | KLHL15 | kelch-like 15 (Drosophila) | |
1 | 1 | ||||||
| MIRT567450 | GNG12 | guanine nucleotide binding protein (G protein), gamma 12 | |
1 | 1 | ||||||
| MIRT567482 | FZD9 | frizzled family receptor 9 | |
1 | 1 | ||||||
| MIRT568025 | CMTM4 | CKLF-like MARVEL transmembrane domain containing 4 | |
1 | 1 | ||||||
| MIRT568143 | CCDC88C | coiled-coil domain containing 88C | |
1 | 1 | ||||||
| MIRT568477 | ARMC12 | armadillo repeat containing 12 | |
1 | 1 | ||||||
| MIRT568575 | AHNAK2 | AHNAK nucleoprotein 2 | |
1 | 1 | ||||||
| MIRT568621 | ACVR2A | activin A receptor, type IIA | |
1 | 1 | ||||||
| MIRT570464 | TLK1 | tousled-like kinase 1 | |
1 | 2 | ||||||
| MIRT571123 | UBE2H | ubiquitin-conjugating enzyme E2H | |
1 | 1 | ||||||
| MIRT571287 | TTLL5 | tubulin tyrosine ligase-like family, member 5 | |
1 | 1 | ||||||
| MIRT571431 | RIF1 | RAP1 interacting factor homolog (yeast) | |
1 | 1 | ||||||
| MIRT571662 | SERBP1 | SERPINE1 mRNA binding protein 1 | |
1 | 1 | ||||||
| MIRT571824 | PHF19 | PHD finger protein 19 | |
1 | 1 | ||||||
| MIRT571926 | LSM11 | LSM11, U7 small nuclear RNA associated | |
1 | 2 | ||||||
| MIRT574062 | PROSC | proline synthetase co-transcribed homolog (bacterial) | |
1 | 1 | ||||||
| MIRT574207 | CLEC2D | C-type lectin domain family 2, member D | |
1 | 1 | ||||||
| MIRT574542 | PDIA6 | protein disulfide isomerase family A, member 6 | |
1 | 2 | ||||||
| MIRT574595 | N4BP1 | NEDD4 binding protein 1 | |
1 | 2 | ||||||
| MIRT575886 | Cask | calcium/calmodulin-dependent serine protein kinase (MAGUK family) | |
1 | 1 | ||||||
| MIRT575928 | Dmpk | dystrophia myotonica-protein kinase | |
1 | 1 | ||||||
| MIRT576100 | Pdcd1 | programmed cell death 1 | |
1 | 1 | ||||||
| MIRT576593 | Npepps | aminopeptidase puromycin sensitive | |
1 | 1 | ||||||
| MIRT614697 | TRAK1 | trafficking protein, kinesin binding 1 | |
1 | 1 | ||||||
| MIRT616471 | ADRA2B | adrenoceptor alpha 2B | |
1 | 1 | ||||||
| MIRT618900 | ANKMY1 | ankyrin repeat and MYND domain containing 1 | |
1 | 1 | ||||||
| MIRT621501 | GPRC5A | G protein-coupled receptor, family C, group 5, member A | |
1 | 2 | ||||||
| MIRT640542 | C3orf36 | chromosome 3 open reading frame 36 | |
1 | 1 | ||||||
| MIRT645514 | BSPRY | B-box and SPRY domain containing | |
1 | 1 | ||||||
| MIRT646599 | ANKRD36 | ankyrin repeat domain 36 | |
1 | 1 | ||||||
| MIRT648788 | KLHL40 | kelch repeat and BTB (POZ) domain containing 5 | |
1 | 1 | ||||||
| MIRT655815 | NOTCH2 | notch 2 | |
1 | 2 | ||||||
| MIRT658796 | EIF2B2 | eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa | |
1 | 1 | ||||||
| MIRT659260 | CUL3 | cullin 3 | |
1 | 1 | ||||||
| MIRT680986 | DCAF17 | DDB1 and CUL4 associated factor 17 | |
1 | 1 | ||||||
| MIRT682280 | RS1 | retinoschisin 1 | |
1 | 1 | ||||||
| MIRT682518 | GLP2R | glucagon-like peptide 2 receptor | |
1 | 1 | ||||||
| MIRT691713 | FLOT2 | flotillin 2 | |
1 | 2 | ||||||
| MIRT693934 | HNRNPA1L2 | heterogeneous nuclear ribonucleoprotein A1-like 2 | |
1 | 1 | ||||||
| MIRT701510 | NEGR1 | neuronal growth regulator 1 | |
1 | 1 | ||||||
| MIRT702096 | MCFD2 | multiple coagulation factor deficiency 2 | |
1 | 1 | ||||||
| MIRT702879 | HNRNPA1 | heterogeneous nuclear ribonucleoprotein A1 | |
1 | 1 | ||||||
| MIRT713423 | SLC35E2B | solute carrier family 35, member E2B | |
1 | 1 | ||||||
| MIRT714442 | ARHGAP32 | Rho GTPase activating protein 32 | |
1 | 1 | ||||||
| MIRT716436 | RAB15 | RAB15, member RAS oncogene family | |
1 | 1 | ||||||
| MIRT717465 | ADORA3 | adenosine A3 receptor | |
1 | 1 | ||||||
| MIRT720153 | PPIP5K2 | diphosphoinositol pentakisphosphate kinase 2 | |
1 | 1 | ||||||
| MIRT725130 | SYNRG | synergin, gamma | |
1 | 1 | ||||||
| MIRT726007 | ZNF91 | zinc finger protein 91 | |
1 | 1 | ||||||
| MIRT726084 | ZBTB5 | zinc finger and BTB domain containing 5 | |
1 | 1 | ||||||
| MIRT726128 | VPS33B | vacuolar protein sorting 33 homolog B (yeast) | |
1 | 1 | ||||||
| MIRT726132 | CHMP3 | charged multivesicular body protein 3 | |
1 | 1 | ||||||
| MIRT726143 | VCL | vinculin | |
1 | 1 | ||||||
| MIRT726158 | USP3 | ubiquitin specific peptidase 3 | |
1 | 1 | ||||||
| MIRT726166 | USP31 | ubiquitin specific peptidase 31 | |
1 | 1 | ||||||
| MIRT726221 | TUBB | tubulin, beta class I | |
1 | 1 | ||||||
| MIRT726238 | TRAM1 | translocation associated membrane protein 1 | |
1 | 1 | ||||||
| MIRT726280 | TMEM69 | transmembrane protein 69 | |
1 | 1 | ||||||
| MIRT726287 | TMEM55B | transmembrane protein 55B | |
1 | 1 | ||||||
| MIRT726307 | TMEM135 | transmembrane protein 135 | |
1 | 1 | ||||||
| MIRT726317 | TLE4 | transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) | |
1 | 1 | ||||||
| MIRT726322 | TKTL1 | transketolase-like 1 | |
1 | 1 | ||||||
| MIRT726325 | TIMM13 | translocase of inner mitochondrial membrane 13 homolog (yeast) | |
1 | 1 | ||||||
| MIRT726339 | TFB1M | transcription factor B1, mitochondrial | |
1 | 1 | ||||||
| MIRT726348 | TCF3 | transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47) | |
1 | 1 | ||||||
| MIRT726356 | TBL1XR1 | transducin (beta)-like 1 X-linked receptor 1 | |
1 | 1 | ||||||
| MIRT726360 | TBCCD1 | TBCC domain containing 1 | |
1 | 1 | ||||||
| MIRT726367 | TBC1D20 | TBC1 domain family, member 20 | |
1 | 1 | ||||||
| MIRT726372 | TBC1D14 | TBC1 domain family, member 14 | |
1 | 1 | ||||||
| MIRT726384 | TASP1 | taspase, threonine aspartase, 1 | |
1 | 1 | ||||||
| MIRT726410 | SUPT16H | suppressor of Ty 16 homolog (S. cerevisiae) | |
1 | 1 | ||||||
| MIRT726422 | STX17 | syntaxin 17 | |
1 | 1 | ||||||
| MIRT726455 | SRPK1 | SRSF protein kinase 1 | |
1 | 1 | ||||||
| MIRT726462 | SPTLC1 | serine palmitoyltransferase, long chain base subunit 1 | |
1 | 1 | ||||||
| MIRT726482 | SMURF1 | SMAD specific E3 ubiquitin protein ligase 1 | |
1 | 1 | ||||||
| MIRT726507 | SLC9A1 | solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1 | |
1 | 1 | ||||||
| MIRT726511 | SLC7A5 | solute carrier family 7 (amino acid transporter light chain, L system), member 5 | |
1 | 1 | ||||||
| MIRT726545 | SLC25A29 | solute carrier family 25 (mitochondrial carnitine/acylcarnitine carrier), member 29 | |
1 | 1 | ||||||
| MIRT726548 | SLC25A22 | solute carrier family 25 (mitochondrial carrier: glutamate), member 22 | |
1 | 1 | ||||||
| MIRT726677 | RPS6KA3 | ribosomal protein S6 kinase, 90kDa, polypeptide 3 | |
1 | 1 | ||||||
| MIRT726680 | RPS5 | ribosomal protein S5 | |
1 | 1 | ||||||
| MIRT726685 | RPL36 | ribosomal protein L36 | |
1 | 1 | ||||||
| MIRT726712 | RNPS1 | RNA binding protein S1, serine-rich domain | |
1 | 1 | ||||||
| MIRT726715 | RNMT | RNA (guanine-7-) methyltransferase | |
1 | 1 | ||||||
| MIRT726720 | RNH1 | ribonuclease/angiogenin inhibitor 1 | |
1 | 1 | ||||||
| MIRT726756 | RFWD2 | ring finger and WD repeat domain 2, E3 ubiquitin protein ligase | |
1 | 1 | ||||||
| MIRT726764 | REXO1 | REX1, RNA exonuclease 1 homolog (S. cerevisiae) | |
1 | 1 | ||||||
| MIRT726773 | RELT | RELT tumor necrosis factor receptor | |
1 | 1 | ||||||
| MIRT726789 | RAP2C | RAP2C, member of RAS oncogene family | |
1 | 1 | ||||||
| MIRT726812 | RAB40B | RAB40B, member RAS oncogene family | |
1 | 1 | ||||||
| MIRT726826 | RAB11FIP2 | RAB11 family interacting protein 2 (class I) | |
1 | 1 | ||||||
| MIRT726853 | PSMB5 | proteasome (prosome, macropain) subunit, beta type, 5 | |
1 | 1 | ||||||
| MIRT726874 | PPP6C | protein phosphatase 6, catalytic subunit | |
1 | 1 | ||||||
| MIRT726902 | POU2AF1 | POU class 2 associating factor 1 | |
1 | 1 | ||||||
| MIRT726910 | POLE4 | polymerase (DNA-directed), epsilon 4, accessory subunit | |
1 | 1 | ||||||
| MIRT726967 | PGD | phosphogluconate dehydrogenase | |
1 | 1 | ||||||
| MIRT726974 | PEX12 | peroxisomal biogenesis factor 12 | |
1 | 1 | ||||||
| MIRT727021 | PANK1 | pantothenate kinase 1 | |
1 | 1 | ||||||
| MIRT727028 | TM9SF2 | transmembrane 9 superfamily member 2 | |
1 | 1 | ||||||
| MIRT727038 | OTUB1 | OTU domain, ubiquitin aldehyde binding 1 | |
1 | 1 | ||||||
| MIRT727068 | NR2C2 | nuclear receptor subfamily 2, group C, member 2 | |
1 | 1 | ||||||
| MIRT727096 | NCOR2 | nuclear receptor corepressor 2 | |
1 | 1 | ||||||
| MIRT727137 | MTMR4 | myotubularin related protein 4 | |
1 | 1 | ||||||
| MIRT727154 | MRPL40 | mitochondrial ribosomal protein L40 | |
1 | 1 | ||||||
| MIRT727176 | MLXIP | MLX interacting protein | |
1 | 1 | ||||||
| MIRT727198 | MIB1 | mindbomb E3 ubiquitin protein ligase 1 | |
1 | 1 | ||||||
| MIRT727223 | MED11 | mediator complex subunit 11 | |
1 | 1 | ||||||
| MIRT727228 | MCM3AP-AS1 | MCM3AP antisense RNA 1 | |
1 | 1 | ||||||
| MIRT727262 | LYRM5 | LYR motif containing 5 | |
1 | 1 | ||||||
| MIRT727268 | LRRC57 | leucine rich repeat containing 57 | |
1 | 1 | ||||||
| MIRT727271 | LRPPRC | leucine-rich pentatricopeptide repeat containing | |
1 | 1 | ||||||
| MIRT727297 | LITAF | lipopolysaccharide-induced TNF factor | |
1 | 1 | ||||||
| MIRT727349 | KLC2 | kinesin light chain 2 | |
1 | 1 | ||||||
| MIRT727377 | TECPR2 | tectonin beta-propeller repeat containing 2 | |
1 | 1 | ||||||
| MIRT727385 | KATNAL1 | katanin p60 subunit A-like 1 | |
1 | 1 | ||||||
| MIRT727426 | IRAK1BP1 | interleukin-1 receptor-associated kinase 1 binding protein 1 | |
1 | 1 | ||||||
| MIRT727483 | HYOU1 | hypoxia up-regulated 1 | |
1 | 1 | ||||||
| MIRT727523 | GSK3B | glycogen synthase kinase 3 beta | |
1 | 1 | ||||||
| MIRT727585 | GGA3 | golgi-associated, gamma adaptin ear containing, ARF binding protein 3 | |
1 | 1 | ||||||
| MIRT727605 | GANAB | glucosidase, alpha; neutral AB | |
1 | 1 | ||||||
| MIRT727619 | GABARAP | GABA(A) receptor-associated protein | |
1 | 1 | ||||||
| MIRT727647 | FRYL | FRY-like | |
1 | 1 | ||||||
| MIRT727701 | FAM73A | family with sequence similarity 73, member A | |
1 | 1 | ||||||
| MIRT727719 | AMER1 | family with sequence similarity 123B | |
1 | 1 | ||||||
| MIRT727814 | EDC3 | enhancer of mRNA decapping 3 homolog (S. cerevisiae) | |
1 | 1 | ||||||
| MIRT727856 | DSCR3 | Down syndrome critical region gene 3 | |
1 | 1 | ||||||
| MIRT727860 | DPP8 | dipeptidyl-peptidase 8 | |
1 | 1 | ||||||
| MIRT727866 | DNAJC9 | DnaJ (Hsp40) homolog, subfamily C, member 9 | |
1 | 1 | ||||||
| MIRT727876 | DICER1 | dicer 1, ribonuclease type III | |
1 | 1 | ||||||
| MIRT727910 | CYLD | cylindromatosis (turban tumor syndrome) | |
1 | 1 | ||||||
| MIRT727913 | CYB561A3 | cytochrome b, ascorbate dependent 3 | |
1 | 1 | ||||||
| MIRT727917 | CUL2 | cullin 2 | |
1 | 1 | ||||||
| MIRT727924 | CSDE1 | cold shock domain containing E1, RNA-binding | |
1 | 1 | ||||||
| MIRT727936 | CREG1 | cellular repressor of E1A-stimulated genes 1 | |
1 | 1 | ||||||
| MIRT727953 | CPNE1 | copine I | |
1 | 1 | ||||||
| MIRT727999 | RHOV | ras homolog family member V | |
1 | 1 | ||||||
| MIRT728006 | CDKN2AIPNL | CDKN2A interacting protein N-terminal like | |
1 | 1 | ||||||
| MIRT728019 | CDC27 | cell division cycle 27 homolog (S. cerevisiae) | |
1 | 1 | ||||||
| MIRT728047 | CBFA2T3 | core-binding factor, runt domain, alpha subunit 2; translocated to, 3 | |
1 | 1 | ||||||
| MIRT728092 | C6orf106 | chromosome 6 open reading frame 106 | |
1 | 1 | ||||||
| MIRT728101 | C2orf42 | chromosome 2 open reading frame 42 | |
1 | 1 | ||||||
| MIRT728127 | LRIF1 | ligand dependent nuclear receptor interacting factor 1 | |
1 | 1 | ||||||
| MIRT728133 | C15orf39 | chromosome 15 open reading frame 39 | |
1 | 1 | ||||||
| MIRT728194 | BSG | basigin (Ok blood group) | |
1 | 1 | ||||||
| MIRT728237 | B4GALT1 | UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 | |
1 | 1 | ||||||
| MIRT728265 | ATP13A3 | ATPase type 13A3 | |
1 | 1 | ||||||
| MIRT728290 | ASXL1 | additional sex combs like 1 (Drosophila) | |
1 | 1 | ||||||
| MIRT728330 | AP3M1 | adaptor-related protein complex 3, mu 1 subunit | |
1 | 1 | ||||||
| MIRT728384 | AFF4 | AF4/FMR2 family, member 4 | |
1 | 1 | ||||||
| MIRT728400 | ACOX1 | acyl-CoA oxidase 1, palmitoyl | |
1 | 1 | ||||||