Accession ID: MIRT051313 [miRNA, hsa-miR-15a-5p :: IKBKG, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-15aLinkOut: [miRBase ]
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Mature Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
Putative hsa-miR-15a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-15a-5p :: IKBKG    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 5'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gtgtttggtaatacacGACGAt 5'
                          | ||| 
Target 5' ---cttccggatcccaCAGCTa 3'
1 - 19
2
miRNA  3' gtgTTTGGTAAT-ACACGAcgat 5'
             ||:||:  |  ||| |    
Target 5' cggAAGCCGGAAGCGTGGT---- 3'
26 - 44
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
690 hsa-miR-15a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 polycomb ring finger oncogene 3 1
MIRT000282 WNT3A wingless-type MMTV integration site family, member 3A 3 2
MIRT000283 MYB v-myb myeloblastosis viral oncogene homolog (avian) 5 3
MIRT000284 CDC25A cell division cycle 25 homolog A (S. pombe) 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 B-cell CLL/lymphoma 2 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2 (Drosophila) 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family, member 8 2 1
MIRT000827 CDC14B CDC14 cell division cycle 14 homolog B (S. cerevisiae) 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63kDa 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein-like 2 3 3
MIRT000835 ECHDC1 enoyl CoA hydratase domain containing 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3-like 2 1
MIRT000851 GTF2H1 general transcription factor IIH, polypeptide 1, 62kDa 2 1
MIRT000853 H3F3B H3 histone, family 3B (H3.3B) 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase-like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 heat-responsive protein 12 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock 70kDa protein 1A 2 1
MIRT000868 JUN jun proto-oncogene 2 1
MIRT000878 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 2 1
MIRT000880 MSH2 mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase homolog (S. cerevisiae) 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase-like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase, beta 2 1
MIRT000892 PMS1 PMS1 postmeiotic segregation increased 1 (S. cerevisiae) 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 primase, DNA, polypeptide 1 (49kDa) 2 1
MIRT000898 RAD51C RAD51 homolog C (S. cerevisiae) 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent) 2 1
MIRT000906 SLC35A1 solute carrier family 35 (CMP-sialic acid transporter), member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35, member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule-associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-site APP-cleaving enzyme 1 2 1
MIRT002946 DMTF1 cyclin D binding myb-like transcription factor 1 3 3
MIRT003333 BRCA1 breast cancer 1, early onset 2 2
MIRT003334 AKT3 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family, member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog (S. cerevisiae) 2 1
MIRT003874 HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69, member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 coiled-coil domain containing 111 2 1
MIRT003883 C2orf43 chromosome 2 open reading frame 43 2 1
MIRT003884 C4orf27 chromosome 4 open reading frame 27 2 1
MIRT003885 NIPAL2 NIPA-like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog (S. cerevisiae) 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta (A4) precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 (mitochondrial, proton carrier) 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 5 10
MIRT004680 TSPYL2 TSPY-like 2 2 1
MIRT004829 NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride channel, voltage-sensitive 3 4 1
MIRT006177 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 5 2
MIRT006181 MN1 meningioma (disrupted in balanced translocation) 1 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon, gamma 2 1
MIRT006998 PURA purine-rich element binding protein A 2 2
MIRT007090 RECK reversion-inducing-cysteine-rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta-like 1 homolog (Drosophila) 2 1
MIRT051311 PLA2G2D phospholipase A2, group IID 1 1
MIRT051312 ACVR1B activin A receptor, type IB 1 1
MIRT051313 IKBKG inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase, modifier subunit 1 1
MIRT051315 PCF11 PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae) 1 1
MIRT051316 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP 30kDa subunit 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y-like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex, component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3, acidic 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 (EGR1 binding protein 1) 1 1
MIRT051329 CCT6B chaperonin containing TCP1, subunit 6B (zeta 2) 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC-like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome (prosome, macropain) 26S subunit, ATPase, 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase, H+ transporting, lysosomal accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog (S. cerevisiae) 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein homolog (yeast) 1 1
MIRT051349 MYBL1 v-myb myeloblastosis viral oncogene homolog (avian)-like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel-like factor 4 (gut) 1 1
MIRT054283 YAP1 Yes-associated protein 1 3 1
MIRT054424 CARM1 coactivator-associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY (sex determining region Y)-box 5 2 1
MIRT055421 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 1 1
MIRT057514 CEP55 centrosomal protein 55kDa 1 4
MIRT057729 ZDHHC16 zinc finger, DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG family, member 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TAR (HIV-1) RNA binding protein 2 1 2
MIRT066291 MTFR1L family with sequence similarity 54, member B 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A kinase (PRKA) anchor protein 11 1 1
MIRT071206 FCF1 FCF1 small subunit (SSU) processome component homolog (S. cerevisiae) 1 1
MIRT072822 ARIH1 ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate-rich protein 1 1 2
MIRT075249 SNTB2 syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A (S. cerevisiae) 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen-like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase, 70kDa, polypeptide 1 1 1
MIRT079655 NAPG N-ethylmaleimide-sensitive factor attachment protein, gamma 1 6
MIRT080011 GALNT1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) 1 2
MIRT082985 PNPLA6 patatin-like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger, CCHC domain containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin-related protein 2 homolog (yeast) 1 2
MIRT090446 CDV3 CDV3 homolog (mouse) 1 1
MIRT090688 U2SURP U2 snRNP-associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor, beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor, type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family, member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1, regulatory (inhibitor) subunit 11 1 1
MIRT100364 HSPA1B heat shock 70kDa protein 1B 2 5
MIRT100566 PIM1 pim-1 oncogene 1 1
MIRT100896 CD2AP CD2-associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B (S. cerevisiae) 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC, cation transport regulator homolog 1 (E. coli) 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 protein (Cdc42/Rac)-activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type, J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association (RalGDS/AF-6) domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A B-cell CLL/lymphoma 7A 1 1
MIRT133769 SKI v-ski sarcoma viral oncogene homolog (avian) 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty-related, EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin-conjugating enzyme E2Q family member 2 1 1
MIRT142237 DCTN5 dynactin 5 (p25) 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste homolog 1 (Drosophila) 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138, E3 ubiquitin protein ligase 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 tumor necrosis factor (ligand) superfamily, member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L chromosome 20 open reading frame 112 1 1
MIRT154043 RASSF2 Ras association (RalGDS/AF-6) domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific) 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C, delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 3 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline-rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 eukaryotic translation initiation factor 2C, 4 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent, 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 (zinc transporter), member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103, member A1 1 3
MIRT194903 RBBP6 retinoblastoma binding protein 6 1 4
MIRT196275 PAFAH1B1 platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa) 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50kDa 1 4
MIRT211199 FGF2 fibroblast growth factor 2 (basic) 1 2
MIRT211314 HSPA4L heat shock 70kDa protein 4-like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TBP-like 1 1 2
MIRT223681 FZD6 frizzled family receptor 6 1 3
MIRT224965 BAG4 BCL2-associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family, member 6 1 1
MIRT230120 DDX3Y DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked 1 1
MIRT234342 MSL1 male-specific lethal 1 homolog (Drosophila) 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline-rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 homolog (S. pombe) 1 2
MIRT247236 ELK4 ELK4, ETS-domain protein (SRF accessory protein 1) 1 2
MIRT247368 GABARAPL1 GABA(A) receptor-associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7-like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein, light chain, LC8-type 2 1 2
MIRT255333 SRPRB signal recognition particle receptor, B subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein (rabin3) 1 1
MIRT277504 PPP2R5C protein phosphatase 2, regulatory subunit B', gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family, member 3A1 1 1
MIRT286968 MLLT6 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 1 1
MIRT289625 CBX2 chromobox homolog 2 1 1
MIRT294283 ZFP28 zinc finger protein 28 homolog (mouse) 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor, alpha subunit 60kDa 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 (chordin-like) 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like 1 2
MIRT313675 ITGA2 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase (cyclophilin)-like 1 1 4
MIRT319331 CAPZA2 capping protein (actin filament) muscle Z-line, alpha 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 homolog (Chlamydomonas) 1 1
MIRT326301 OCRL oculocerebrorenal syndrome of Lowe 1 1
MIRT327962 CHIC1 cysteine-rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel-like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family, member 2 1 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid-like 1 1 1
MIRT449190 LUC7L3 LUC7-like 3 (S. cerevisiae) 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family, member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1, epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 (beta) 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin-related protein 3 homolog B (yeast) 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin-conjugating enzyme E2 variant 1 1 4
MIRT464751 UBE2Q1 ubiquitin-conjugating enzyme E2Q family member 1 1 2
MIRT465165 TSC22D2 TSC22 domain family, member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt-inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3-domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 family, member A (S. cerevisiae) 1 2
MIRT469090 RNF168 ring finger protein 168, E3 ubiquitin protein ligase 1 1
MIRT469415 REL v-rel reticuloendotheliosis viral oncogene homolog (avian) 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D, cAMP-specific 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 1
MIRT472263 NFIC nuclear factor I/C (CCAAT-binding transcription factor) 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin, gamma 1 (formerly LAMB2) 1 1
MIRT474828 KIAA0226 KIAA0226 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol 1,3,4,5,6-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hairy/enhancer-of-split related with YRPW motif-like 1 1
MIRT475843 HDGF hepatoma-derived growth factor 1 2
MIRT476259 GNB1 guanine nucleotide binding protein (G protein), beta polypeptide 1 1 4
MIRT476276 GNAL guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type 1 3
MIRT476698 FURIN furin (paired basic amino acid cleaving enzyme) 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7, 59kDa 1 3
MIRT479457 CDK6 cyclin-dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family, member 10 1 1
MIRT481181 AVL9 AVL9 homolog (S. cerevisiase) 1 3
MIRT482370 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT482556 ABL2 v-abl Abelson murine leukemia viral oncogene homolog 2 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP-binding cassette, sub-family C (CFTR/MRP), member 6 1 2
MIRT485215 PRKAR2A protein kinase, cAMP-dependent, regulatory, type II, alpha 1 4
MIRT487394 C10orf54 chromosome 10 open reading frame 54 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1, E3 ubiquitin protein ligase 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex, subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2-like 1 4
MIRT499619 DNAJA1 DnaJ (Hsp40) homolog, subfamily A, member 1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger, matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin-like 1 1 4
MIRT500936 SRPR signal recognition particle receptor (docking protein) 1 4
MIRT500953 SREK1 splicing regulatory glutamine/lysine-rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle homolog 2 (Drosophila) 1 1
MIRT502038 LRIG2 leucine-rich repeats and immunoglobulin-like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 homolog (S. cerevisiae)-like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin-like complex, subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine/arginine-rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domains 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G (cyclophilin G) 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 pleiomorphic adenoma gene 1 1 5
MIRT506194 PHKA1 phosphorylase kinase, alpha 1 (muscle) 1 3
MIRT506487 MYO5A myosin VA (heavy chain 12, myoxin) 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D-like 1 3
MIRT507820 CDK1 cyclin-dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox homolog 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 2
MIRT509368 DMPK dystrophia myotonica-protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1, member B10 (aldose reductase) 1 2
MIRT511847 GPATCH8 G patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor (GDI) alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji, AT rich interactive domain 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin-associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 (Drosophila) 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal-associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin-B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox homolog 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 (Drosophila) 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine, 21 (testisin) 1 1
MIRT543801 RALGAPB Ral GTPase activating protein, beta subunit (non-catalytic) 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 polymerase (DNA-directed), delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor-related protein complex 5, zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase 2 family, polypeptide B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl CoA reductase 1, mitochondrial 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 sal-like 1 (Drosophila) 1 2
MIRT546619 RUNX1T1 runt-related transcription factor 1; translocated to, 1 (cyclin D-related) 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN-interacting serine/arginine-rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein associated with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain protein 4 1 1
MIRT547546 LRRFIP2 leucine rich repeat (in FLII) interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin alpha 3 (importin alpha 4) 1 1
MIRT547702 KPNA1 karyopherin alpha 1 (importin alpha 5) 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family, member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor-bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A, 12kDa 1 1
MIRT548275 FBXL20 F-box and leucine-rich repeat protein 20 1 1
MIRT548727 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 1 1
MIRT548809 CLIP4 CAP-GLY domain containing linker protein family, member 4 1 2
MIRT548946 CDK17 cyclin-dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2-associated, cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ash1 (absent, small, or homeotic)-like (Drosophila) 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 (nucleoside transporters), member 1 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase (NAD(P)H) 1 1
MIRT550827 FAM229B chromosome 6 open reading frame 225 1 1
MIRT551383 EPM2AIP1 EPM2A (laforin) interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) 1 1
MIRT552039 DNAJC10 DnaJ (Hsp40) homolog, subfamily C, member 10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC domain containing (E. coli) 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type, D 1 1
MIRT555229 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 2
MIRT555278 PRDM4 PR domain containing 4 1 1
MIRT555431 PPAP2B phosphatidic acid phosphatase type 2B 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1-like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2, H2be 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin 1 1 1
MIRT558511 CYP26B1 cytochrome P450, family 26, subfamily B, polypeptide 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase VIII 1 1
MIRT559155 BTN3A3 butyrophilin, subfamily 3, member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein-like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin, beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT-like DNA-binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC lantibiotic synthetase component C-like 1 (bacterial) 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 (aspartate/glutamate carrier), member 12 1 2
MIRT563507 DLGAP3 discs, large (Drosophila) homolog-associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 chromosome 22 open reading frame 32 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK, Kell blood group complex subunit-related family, member 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav 2 guanine nucleotide exchange factor 1 1
MIRT565400 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK-associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT567450 GNG12 guanine nucleotide binding protein (G protein), gamma 12 1 1
MIRT567482 FZD9 frizzled family receptor 9 1 1
MIRT568025 CMTM4 CKLF-like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor, type IIA 1 1
MIRT570464 TLK1 tousled-like kinase 1 1 2
MIRT571123 UBE2H ubiquitin-conjugating enzyme E2H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase-like family, member 5 1 1
MIRT571431 RIF1 RAP1 interacting factor homolog (yeast) 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC proline synthetase co-transcribed homolog (bacterial) 1 1
MIRT574207 CLEC2D C-type lectin domain family 2, member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A, member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking protein, kinesin binding 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor, family C, group 5, member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch repeat and BTB (POZ) domain containing 5 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon-like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35, member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin, gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B vacuolar protein sorting 33 homolog B (yeast) 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin, beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B transmembrane protein 55B 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) 1 1
MIRT726322 TKTL1 transketolase-like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 homolog (yeast) 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47) 1 1
MIRT726356 TBL1XR1 transducin (beta)-like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family, member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family, member 14 1 1
MIRT726384 TASP1 taspase, threonine aspartase, 1 1 1
MIRT726410 SUPT16H suppressor of Ty 16 homolog (S. cerevisiae) 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase, long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1 1 1
MIRT726511 SLC7A5 solute carrier family 7 (amino acid transporter light chain, L system), member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 (mitochondrial carnitine/acylcarnitine carrier), member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 (mitochondrial carrier: glutamate), member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase, 90kDa, polypeptide 3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein S1, serine-rich domain 1 1
MIRT726715 RNMT RNA (guanine-7-) methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2, E3 ubiquitin protein ligase 1 1
MIRT726764 REXO1 REX1, RNA exonuclease 1 homolog (S. cerevisiae) 1 1
MIRT726773 RELT RELT tumor necrosis factor receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 (class I) 1 1
MIRT726853 PSMB5 proteasome (prosome, macropain) subunit, beta type, 5 1 1
MIRT726874 PPP6C protein phosphatase 6, catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 polymerase (DNA-directed), epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU domain, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2, group C, member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 LYR motif containing 5 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine-rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide-induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT727426 IRAK1BP1 interleukin-1 receptor-associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase, alpha; neutral AB 1 1
MIRT727619 GABARAP GABA(A) receptor-associated protein 1 1
MIRT727647 FRYL FRY-like 1 1
MIRT727701 FAM73A family with sequence similarity 73, member A 1 1
MIRT727719 AMER1 family with sequence similarity 123B 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 homolog (S. cerevisiae) 1 1
MIRT727856 DSCR3 Down syndrome critical region gene 3 1 1
MIRT727860 DPP8 dipeptidyl-peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ (Hsp40) homolog, subfamily C, member 9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease type III 1 1
MIRT727910 CYLD cylindromatosis (turban tumor syndrome) 1 1
MIRT727913 CYB561A3 cytochrome b, ascorbate dependent 3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT727936 CREG1 cellular repressor of E1A-stimulated genes 1 1 1
MIRT727953 CPNE1 copine I 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 homolog (S. cerevisiae) 1 1
MIRT728047 CBFA2T3 core-binding factor, runt domain, alpha subunit 2; translocated to, 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 1 1
MIRT728265 ATP13A3 ATPase type 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1 (Drosophila) 1 1
MIRT728330 AP3M1 adaptor-related protein complex 3, mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family, member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1, palmitoyl 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*