Accession ID: MIRT051616 [miRNA, hsa-let-7e-5p :: CTSA, target gene]
pre-miRNA Information
pre-miRNA ID hsa-let-7eLinkOut: [miRBase ]
Synonyms MIRNLET7E, hsa-let-7e, let-7e, MIRLET7E
Description Homo sapiens let-7e stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-let-7e-5p
Mature Sequence 8| UGAGGUAGGAGGUUGUAUAGUU |29
Evidence Experimental
Experiments Cloned
Putative hsa-let-7e-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CTSA LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms GLB2, GSL, NGBE, PPCA, PPGB
Description cathepsin A
Transcript NM_000308    LinkOut: [ RefSeq ]
Other Transcripts NM_001127695 , NM_001167594   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CTSA LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CTSA
(miRNA target sites are highlighted)
>CTSA|NM_000308|3'UTR
   1 CAGCCATACTGATGACCACAGCAACCAGCTCCACGGCCTGATGCAGCCCCTCCCAGCCTCTCCCGCTAGGAGAGTCCTCT
  81 TCTAAGCAAAGTGCCCCTGCAGGCCGGGTTCTGCCGCCAGGACTGCCCCCTTCCCAGAGCCCTGTACATCCCAGACTGGG
 161 CCCAGGGTCTCCCATAGACAGCCTGGGGGCAAGTTAGCACTTTATTCCCGCAGCAGTTCCTGAATGGGGTGGCCTGGCCC
 241 CTTCTCTGCTTAAAGAATGCCCTTTATGATGCACTGATTCCATCCCAGGAACCCAACAGAGCTCAGGACAGCCCACAGGG
 321 AGGTGGTGGACGGACTGTAATTGATAGATTGATTATGGAATTAAATTGGGTACAGCTTCAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uuGA-UAUGUU--GGA-GGAUGGAGu 5'
            || ||:||:  ||| || :|||| 
Target 5' gcCTGATGCAGCCCCTCCCAGCCTCt 3'
36 - 61 118.00 -17.80
2
miRNA  3' uugauAUGU-UGG---AGGAUGGAGu 5'
               |:|| :||   |:||:|| | 
Target 5' gccccTGCAGGCCGGGTTCTGCCGCc 3'
93 - 118 105.00 -14.30
3
miRNA  3' uuGAUAUGUUGGAG-GAUGGAgu 5'
            ||: :|  |:|| ||:|:|  
Target 5' gcCTG-GCCCCTTCTCTGCTTaa 3'
232 - 253 99.00 -9.70
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-let-7e-5p :: CTSA    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
576 hsa-let-7e-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT002081 HMGA2 high mobility group AT-hook 2 4 3
MIRT003932 EIF3J eukaryotic translation initiation factor 3, subunit J 2 1
MIRT004469 SMC1A structural maintenance of chromosomes 1A 3 4
MIRT005718 WNT1 wingless-type MMTV integration site family, member 1 4 1
MIRT006122 CCND1 cyclin D1 4 3
MIRT006404 MPL myeloproliferative leukemia virus oncogene 1 1
MIRT032098 RABGAP1L RAB GTPase activating protein 1-like 1 1
MIRT032099 DAD1 defender against cell death 1 1 1
MIRT032100 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 4 2
MIRT051413 WDR67 WD repeat domain 67 1 1
MIRT051414 FAM219B family with sequence similarity 219, member B 1 1
MIRT051415 C11orf91 chromosome 11 open reading frame 91 1 1
MIRT051416 CENPP centromere protein P 1 1
MIRT051417 TMEM107 transmembrane protein 107 1 1
MIRT051418 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT051419 DAAM1 dishevelled associated activator of morphogenesis 1 1 1
MIRT051420 DGCR8 DiGeorge syndrome critical region gene 8 1 1
MIRT051421 RAP1A RAP1A, member of RAS oncogene family 1 1
MIRT051422 RPA1 replication protein A1, 70kDa 1 1
MIRT051423 SKIV2L superkiller viralicidic activity 2-like (S. cerevisiae) 1 1
MIRT051424 AGO1 eukaryotic translation initiation factor 2C, 1 4 2
MIRT051425 RPS27 ribosomal protein S27 1 1
MIRT051426 ARNT2 aryl-hydrocarbon receptor nuclear translocator 2 1 1
MIRT051427 GPM6B glycoprotein M6B 1 1
MIRT051428 TTLL12 tubulin tyrosine ligase-like family, member 12 1 1
MIRT051429 HIST2H2BF histone cluster 2, H2bf 1 1
MIRT051430 CELF2 CUGBP, Elav-like family member 2 1 1
MIRT051431 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT051432 VPS13D vacuolar protein sorting 13 homolog D (S. cerevisiae) 1 1
MIRT051433 RPL10 ribosomal protein L10 1 1
MIRT051434 SPCS2 signal peptidase complex subunit 2 homolog (S. cerevisiae) 1 1
MIRT051435 DCAF8 DDB1 and CUL4 associated factor 8 1 1
MIRT051436 CTC1 CTS telomere maintenance complex component 1 1 1
MIRT051437 NAA60 N(alpha)-acetyltransferase 60, NatF catalytic subunit 1 1
MIRT051438 PHF3 PHD finger protein 3 1 1
MIRT051439 TUBA1B tubulin, alpha 1b 1 1
MIRT051440 SHANK1 SH3 and multiple ankyrin repeat domains 1 1 1
MIRT051441 SKA2 spindle and kinetochore associated complex subunit 2 1 1
MIRT051442 SPTBN1 spectrin, beta, non-erythrocytic 1 1 1
MIRT051443 ND2 MTND2 1 1
MIRT051444 MED13L mediator complex subunit 13-like 1 1
MIRT051445 RCOR3 REST corepressor 3 1 1
MIRT051446 MACF1 microtubule-actin crosslinking factor 1 1 1
MIRT051447 RDX radixin 1 3
MIRT051448 PCBP2 poly(rC) binding protein 2 1 1
MIRT051449 UBAP2L ubiquitin associated protein 2-like 1 1
MIRT051450 CDCA3 cell division cycle associated 3 1 1
MIRT051451 CABLES1 Cdk5 and Abl enzyme substrate 1 1 1
MIRT051452 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 1
MIRT051453 C12orf49 chromosome 12 open reading frame 49 1 1
MIRT051454 TIMP3 TIMP metallopeptidase inhibitor 3 1 1
MIRT051455 WBSCR16 Williams-Beuren syndrome chromosome region 16 1 1
MIRT051456 SLC2A11 solute carrier family 2 (facilitated glucose transporter), member 11 1 1
MIRT051457 NF1 neurofibromin 1 1 1
MIRT051458 LRRC8A leucine rich repeat containing 8 family, member A 1 1
MIRT051459 RUNX1T1 runt-related transcription factor 1; translocated to, 1 (cyclin D-related) 1 1
MIRT051460 DTNB dystrobrevin, beta 1 1
MIRT051461 SCMH1 sex comb on midleg homolog 1 (Drosophila) 1 1
MIRT051462 YWHAG tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide 1 1
MIRT051463 RHBDD2 rhomboid domain containing 2 1 1
MIRT051464 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT051465 NDST1 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 1 1
MIRT051466 IGF2BP3 insulin-like growth factor 2 mRNA binding protein 3 1 3
MIRT051467 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT051468 BAHCC1 BAH domain and coiled-coil containing 1 1 1
MIRT051469 CARM1 coactivator-associated arginine methyltransferase 1 1 1
MIRT051470 DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 1 1
MIRT051471 ND3 NADH dehydrogenase, subunit 3 (complex I) 1 1
MIRT051472 PIGS phosphatidylinositol glycan anchor biosynthesis, class S 1 1
MIRT051473 ALG13 asparagine-linked glycosylation 13 homolog (S. cerevisiae) 1 1
MIRT051474 RPN2 ribophorin II 1 1
MIRT051475 RPL12 ribosomal protein L12 1 1
MIRT051476 NME4 NME/NM23 nucleoside diphosphate kinase 4 1 1
MIRT051477 IVD isovaleryl-CoA dehydrogenase 1 1
MIRT051478 JAZF1 JAZF zinc finger 1 1 1
MIRT051479 ND4 NADH dehydrogenase, subunit 4 (complex I) 1 1
MIRT051480 VARS valyl-tRNA synthetase 1 1
MIRT051481 RNF26 ring finger protein 26 1 1
MIRT051482 LHFPL2 lipoma HMGIC fusion partner-like 2 1 1
MIRT051483 ARCN1 archain 1 1 1
MIRT051484 COX1 cytochrome c oxidase subunit I 1 1
MIRT051485 SLC12A4 solute carrier family 12 (potassium/chloride transporters), member 4 1 1
MIRT051486 AEBP2 AE binding protein 2 1 1
MIRT051487 PET112 PET112 homolog (yeast) 1 1
MIRT051488 UROC1 urocanate hydratase 1 1 1
MIRT051489 IGF1R insulin-like growth factor 1 receptor 4 6
MIRT051490 BSDC1 BSD domain containing 1 1 1
MIRT051491 PTK2 PTK2 protein tyrosine kinase 2 1 1
MIRT051492 CDC5L CDC5 cell division cycle 5-like (S. pombe) 1 1
MIRT051493 EN2 engrailed homeobox 2 1 1
MIRT051494 SSB Sjogren syndrome antigen B (autoantigen La) 1 1
MIRT051495 SLCO3A1 solute carrier organic anion transporter family, member 3A1 1 1
MIRT051496 RRAGC Ras-related GTP binding C 1 1
MIRT051497 ZNF236 zinc finger protein 236 1 1
MIRT051498 SEMA4B sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B 1 1
MIRT051499 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT051500 XIAP X-linked inhibitor of apoptosis 1 1
MIRT051501 GTF2I general transcription factor IIi 1 1
MIRT051502 JMJD1C jumonji domain containing 1C 1 1
MIRT051503 OTUD5 OTU domain containing 5 1 1
MIRT051504 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT051505 PPIG peptidylprolyl isomerase G (cyclophilin G) 1 1
MIRT051506 PSMD2 proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 1 1
MIRT051507 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 1 1
MIRT051508 VAMP2 vesicle-associated membrane protein 2 (synaptobrevin 2) 1 1
MIRT051509 LSR lipolysis stimulated lipoprotein receptor 1 1
MIRT051510 KIAA0355 KIAA0355 1 1
MIRT051511 RPSA ribosomal protein SA 1 1
MIRT051512 DCAF6 DDB1 and CUL4 associated factor 6 1 1
MIRT051513 UHRF1BP1 UHRF1 binding protein 1 1 1
MIRT051514 OTUB1 OTU domain, ubiquitin aldehyde binding 1 1 1
MIRT051515 PIGP phosphatidylinositol glycan anchor biosynthesis, class P 1 1
MIRT051516 LMLN leishmanolysin-like (metallopeptidase M8 family) 1 1
MIRT051517 PPP2R1A protein phosphatase 2, regulatory subunit A, alpha 1 1
MIRT051518 HIPK1 homeodomain interacting protein kinase 1 1 1
MIRT051519 SERF2 small EDRK-rich factor 2 1 1
MIRT051520 RBM4 RNA binding motif protein 4 1 1
MIRT051521 RBM14 RNA binding motif protein 14 1 1
MIRT051522 HMGB1 high mobility group box 1 1 1
MIRT051523 GMPS guanine monphosphate synthetase 1 1
MIRT051524 DIAPH1 diaphanous homolog 1 (Drosophila) 1 1
MIRT051525 STAM signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 1 1
MIRT051526 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide 1 1
MIRT051527 APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 1 1
MIRT051528 MARCH5 membrane-associated ring finger (C3HC4) 5 1 1
MIRT051529 SQLE squalene epoxidase 1 1
MIRT051530 TIMM50 translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) 1 1
MIRT051531 NDUFA3 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa 1 1
MIRT051532 NDUFS5 NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase) 1 1
MIRT051533 NRSN2 neurensin 2 1 1
MIRT051534 SALL1 sal-like 1 (Drosophila) 1 1
MIRT051535 COX3 cytochrome c oxidase III 1 1
MIRT051536 RABL6 RAB, member RAS oncogene family-like 6 1 1
MIRT051537 SUPT4H1 suppressor of Ty 4 homolog 1 (S. cerevisiae) 1 1
MIRT051538 PACS2 phosphofurin acidic cluster sorting protein 2 1 1
MIRT051539 MTMR14 myotubularin related protein 14 1 1
MIRT051540 LUZP1 leucine zipper protein 1 1 1
MIRT051541 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT051542 SUZ12 suppressor of zeste 12 homolog (Drosophila) 1 1
MIRT051543 PAPD4 PAP associated domain containing 4 1 1
MIRT051544 QSOX1 quiescin Q6 sulfhydryl oxidase 1 1 1
MIRT051545 SPATA13 spermatogenesis associated 13 1 1
MIRT051546 DHX57 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 1 1
MIRT051547 KATNB1 katanin p80 (WD repeat containing) subunit B 1 1 1
MIRT051548 COL6A1 collagen, type VI, alpha 1 1 1
MIRT051549 DHX15 DEAH (Asp-Glu-Ala-His) box polypeptide 15 1 1
MIRT051550 MTCH2 mitochondrial carrier 2 1 1
MIRT051551 KIAA0100 KIAA0100 1 1
MIRT051552 SUGP2 SURP and G patch domain containing 2 1 1
MIRT051553 NCLN nicalin 1 1
MIRT051554 ATXN2L ataxin 2-like 1 1
MIRT051555 CHD9 chromodomain helicase DNA binding protein 9 1 1
MIRT051556 PES1 pescadillo ribosomal biogenesis factor 1 1 1
MIRT051557 NUP155 nucleoporin 155kDa 1 4
MIRT051558 GNG5 guanine nucleotide binding protein (G protein), gamma 5 1 2
MIRT051559 ARHGAP19 Rho GTPase activating protein 19 1 1
MIRT051560 MTFR1 mitochondrial fission regulator 1 1 1
MIRT051561 IRS2 insulin receptor substrate 2 1 1
MIRT051562 IRS4 insulin receptor substrate 4 1 1
MIRT051563 PPP1R10 protein phosphatase 1, regulatory subunit 10 1 1
MIRT051564 ZNF284 zinc finger protein 284 1 1
MIRT051565 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 1
MIRT051566 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT051567 FDPS farnesyl diphosphate synthase 1 1
MIRT051568 KRBOX4 zinc finger family member 673 1 1
MIRT051569 BRI3 brain protein I3 1 1
MIRT051570 CHD7 chromodomain helicase DNA binding protein 7 1 1
MIRT051571 PYCR1 pyrroline-5-carboxylate reductase 1 1 1
MIRT051572 SMAP2 small ArfGAP2 1 1
MIRT051573 WDFY3 WD repeat and FYVE domain containing 3 1 1
MIRT051574 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 1 1
MIRT051575 SRSF2 serine/arginine-rich splicing factor 2 1 1
MIRT051576 PGD phosphogluconate dehydrogenase 1 1
MIRT051577 RMND5A required for meiotic nuclear division 5 homolog A (S. cerevisiae) 1 1
MIRT051578 ZNF652 zinc finger protein 652 1 1
MIRT051579 PSMA6 proteasome (prosome, macropain) subunit, alpha type, 6 1 1
MIRT051580 SLC38A2 solute carrier family 38, member 2 1 1
MIRT051581 LRRC41 leucine rich repeat containing 41 1 1
MIRT051582 RANBP2 RAN binding protein 2 1 1
MIRT051583 SVIL supervillin 1 1
MIRT051584 CCNG1 cyclin G1 1 1
MIRT051585 ZNF256 zinc finger protein 256 1 1
MIRT051586 COPG1 coatomer protein complex, subunit gamma 1 1 1
MIRT051587 PDCD11 programmed cell death 11 1 1
MIRT051588 CNBP CCHC-type zinc finger, nucleic acid binding protein 1 1
MIRT051589 USP37 ubiquitin specific peptidase 37 1 1
MIRT051590 UBE2V2 ubiquitin-conjugating enzyme E2 variant 2 1 1
MIRT051591 UBE2H ubiquitin-conjugating enzyme E2H 1 1
MIRT051592 LMNA lamin A/C 1 1
MIRT051593 STAT3 signal transducer and activator of transcription 3 (acute-phase response factor) 1 1
MIRT051594 TRPV1 transient receptor potential cation channel, subfamily V, member 1 1 1
MIRT051595 MATR3 matrin 3 1 1
MIRT051596 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 1 1
MIRT051597 HS6ST2 heparan sulfate 6-O-sulfotransferase 2 1 1
MIRT051598 WDR48 WD repeat domain 48 1 1
MIRT051599 RBM8A RNA binding motif protein 8A 1 1
MIRT051600 SCYL1 SCY1-like 1 (S. cerevisiae) 1 1
MIRT051601 C19orf48 chromosome 19 open reading frame 48 1 1
MIRT051602 FOXD4L6 forkhead box D4-like 6 1 1
MIRT051603 PIGN phosphatidylinositol glycan anchor biosynthesis, class N 1 1
MIRT051604 SPCS3 signal peptidase complex subunit 3 homolog (S. cerevisiae) 1 1
MIRT051605 TNFAIP1 tumor necrosis factor, alpha-induced protein 1 (endothelial) 1 1
MIRT051606 MS4A10 membrane-spanning 4-domains, subfamily A, member 10 1 1
MIRT051607 MSMO1 methylsterol monooxygenase 1 1 1
MIRT051608 ARID1A AT rich interactive domain 1A (SWI-like) 1 1
MIRT051609 NCKIPSD NCK interacting protein with SH3 domain 1 3
MIRT051610 NCBP1 nuclear cap binding protein subunit 1, 80kDa 1 1
MIRT051611 COX16 COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) 1 1
MIRT051612 NUDT8 nudix (nucleoside diphosphate linked moiety X)-type motif 8 1 1
MIRT051613 PHKA1 phosphorylase kinase, alpha 1 (muscle) 1 1
MIRT051614 TXNRD1 thioredoxin reductase 1 1 1
MIRT051615 ELMSAN1 ELM2 and Myb/SANT-like domain containing 1 1 1
MIRT051616 CTSA cathepsin A 1 1
MIRT051617 PRRC2A proline-rich coiled-coil 2A 1 1
MIRT051618 SPAG9 sperm associated antigen 9 1 1
MIRT051619 AGMAT agmatine ureohydrolase (agmatinase) 1 1
MIRT051620 NCKAP5L NCK-associated protein 5-like 1 1
MIRT051621 ZFP62 zinc finger protein 62 homolog (mouse) 1 1
MIRT051622 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 1 1
MIRT051623 POLR3D polymerase (RNA) III (DNA directed) polypeptide D, 44kDa 1 2
MIRT051624 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT051625 ATP6 ATP synthase F0 subunit 6 1 1
MIRT051626 ZFAND5 zinc finger, AN1-type domain 5 1 1
MIRT051627 BAZ1B bromodomain adjacent to zinc finger domain, 1B 1 1
MIRT051628 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT051629 BMP2K BMP2 inducible kinase 1 1
MIRT051630 SPN sialophorin 1 1
MIRT051631 PA2G4 proliferation-associated 2G4, 38kDa 1 1
MIRT051632 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT051633 TUBB4B tubulin, beta 4B class IVb 1 1
MIRT051634 TRRAP transformation/transcription domain-associated protein 1 1
MIRT051635 SLCO4A1 solute carrier organic anion transporter family, member 4A1 1 1
MIRT051636 CCRN4L CCR4 carbon catabolite repression 4-like (S. cerevisiae) 1 1
MIRT051637 USE1 unconventional SNARE in the ER 1 homolog (S. cerevisiae) 1 1
MIRT051638 STARD7 StAR-related lipid transfer (START) domain containing 7 1 1
MIRT051639 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 2
MIRT051640 CLTC clathrin, heavy chain (Hc) 1 1
MIRT051641 TERF1 telomeric repeat binding factor (NIMA-interacting) 1 1 1
MIRT051642 PAX3 paired box 3 1 1
MIRT051643 CCDC97 coiled-coil domain containing 97 1 1
MIRT051644 HLA-C major histocompatibility complex, class I, C 1 1
MIRT051645 GTPBP8 GTP-binding protein 8 (putative) 1 1
MIRT051646 VGLL4 vestigial like 4 (Drosophila) 1 1
MIRT051647 ANKRD40 ankyrin repeat domain 40 1 1
MIRT051648 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT051649 ND1 NADH dehydrogenase, subunit 1 (complex I) 1 1
MIRT051650 DSP desmoplakin 1 1
MIRT051651 UBN2 ubinuclein 2 1 1
MIRT051652 ZNF805 zinc finger protein 805 1 1
MIRT051653 RBBP4 retinoblastoma binding protein 4 1 1
MIRT051654 OCLN occludin 1 1
MIRT051655 CBX5 chromobox homolog 5 1 2
MIRT051656 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT051657 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT051658 SUB1 SUB1 homolog (S. cerevisiae) 1 1
MIRT051659 RSL1D1 ribosomal L1 domain containing 1 1 1
MIRT051660 SEC23IP SEC23 interacting protein 1 1
MIRT051661 RNMT RNA (guanine-7-) methyltransferase 1 1
MIRT051662 SGSM3 small G protein signaling modulator 3 1 1
MIRT051663 ZFP3 zinc finger protein 3 homolog (mouse) 1 1
MIRT051664 GLUL glutamate-ammonia ligase 1 1
MIRT051665 POLD1 polymerase (DNA directed), delta 1, catalytic subunit 1 1
MIRT051666 WDR4 WD repeat domain 4 1 1
MIRT051667 PPP1R2 protein phosphatase 1, regulatory (inhibitor) subunit 2 1 1
MIRT051668 RAI2 retinoic acid induced 2 1 1
MIRT051669 PLCXD1 phosphatidylinositol-specific phospholipase C, X domain containing 1 1 1
MIRT051670 UTP15 UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) 1 1
MIRT051671 THADA thyroid adenoma associated 1 1
MIRT051672 ZNF451 zinc finger protein 451 1 1
MIRT051673 CREBBP CREB binding protein 1 1
MIRT051674 ZNF770 zinc finger protein 770 1 1
MIRT051675 CLDN4 claudin 4 1 1
MIRT051676 ZKSCAN7 zinc finger protein 167 1 1
MIRT051677 NICN1 nicolin 1 1 1
MIRT051678 RPLP2 ribosomal protein, large, P2 1 1
MIRT051679 DCBLD2 discoidin, CUB and LCCL domain containing 2 1 1
MIRT051680 IRGQ immunity-related GTPase family, Q 1 1
MIRT051681 CA5B carbonic anhydrase VB, mitochondrial 1 1
MIRT051682 COX14 cytochrome c oxidase assembly homolog 14 (S. cerevisiae) 1 1
MIRT051683 PSD3 pleckstrin and Sec7 domain containing 3 1 1
MIRT051684 RPL27A ribosomal protein L27a 1 1
MIRT051685 CWC15 CWC15 spliceosome-associated protein homolog (S. cerevisiae) 1 1
MIRT051686 NT5DC2 5'-nucleotidase domain containing 2 1 1
MIRT051687 OR7D2 olfactory receptor, family 7, subfamily D, member 2 1 1
MIRT051688 HIF1AN hypoxia inducible factor 1, alpha subunit inhibitor 1 1
MIRT051689 NUDT15 nudix (nucleoside diphosphate linked moiety X)-type motif 15 1 1
MIRT051690 CDH18 cadherin 18, type 2 1 1
MIRT051691 FAM160B1 family with sequence similarity 160, member B1 1 1
MIRT051692 DZIP1 DAZ interacting protein 1 1 1
MIRT051693 TDRD7 tudor domain containing 7 1 1
MIRT051694 TCF4 transcription factor 4 1 1
MIRT051695 ENSA endosulfine alpha 1 1
MIRT051696 GTF3C1 general transcription factor IIIC, polypeptide 1, alpha 220kDa 1 1
MIRT051697 TNFRSF1A tumor necrosis factor receptor superfamily, member 1A 1 1
MIRT051698 CCDC113 coiled-coil domain containing 113 1 1
MIRT051699 MYO9B myosin IXB 1 1
MIRT051700 COX10 cytochrome c oxidase assembly homolog 10 (yeast) 1 1
MIRT051701 PRAMEF13 PRAME family member 13 1 1
MIRT051702 PMPCA peptidase (mitochondrial processing) alpha 1 3
MIRT051703 MRPS2 mitochondrial ribosomal protein S2 1 1
MIRT051704 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT051705 CCDC106 coiled-coil domain containing 106 1 1
MIRT051706 CYP2B6 cytochrome P450, family 2, subfamily B, polypeptide 6 1 1
MIRT051707 CDKAL1 CDK5 regulatory subunit associated protein 1-like 1 1 2
MIRT051708 PSME4 proteasome (prosome, macropain) activator subunit 4 1 1
MIRT051709 SETD1A SET domain containing 1A 1 1
MIRT054561 MMP9 matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase) 3 1
MIRT054579 IGF1 insulin-like growth factor 1 (somatomedin C) 3 1
MIRT063195 ADIPOR2 adiponectin receptor 2 1 1
MIRT065687 ESPL1 extra spindle pole bodies homolog 1 (S. cerevisiae) 1 2
MIRT067399 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT068154 TXLNA taxilin alpha 1 1
MIRT068528 NHLRC3 NHL repeat containing 3 1 3
MIRT068789 FNDC3A fibronectin type III domain containing 3A 1 1
MIRT073006 ARID3B AT rich interactive domain 3B (BRIGHT-like) 1 3
MIRT076223 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 1 3
MIRT077616 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 1 1
MIRT080398 ONECUT2 one cut homeobox 2 1 1
MIRT083300 ZCCHC3 zinc finger, CCHC domain containing 3 1 1
MIRT084976 BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 1 1
MIRT094160 PCGF3 polycomb group ring finger 3 1 3
MIRT094460 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 1 2
MIRT095766 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 5
MIRT100094 ABT1 activator of basal transcription 1 1 4
MIRT112242 MDM4 Mdm4 p53 binding protein homolog (mouse) 1 2
MIRT118586 STK4 serine/threonine kinase 4 1 1
MIRT120921 PDE12 phosphodiesterase 12 1 4
MIRT123317 CALU calumenin 1 1
MIRT152272 TNFSF9 tumor necrosis factor (ligand) superfamily, member 9 1 1
MIRT153847 NCOA3 nuclear receptor coactivator 3 1 1
MIRT168583 HMGA1 high mobility group AT-hook 1 1 2
MIRT180603 CRY2 cryptochrome 2 (photolyase-like) 1 1
MIRT187717 SUOX sulfite oxidase 1 1
MIRT191404 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 1 1
MIRT193101 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT215720 C5ORF51 chromosome 5 open reading frame 51 1 5
MIRT218815 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 1
MIRT240330 UBXN2B UBX domain protein 2B 1 1
MIRT243473 TRIM71 tripartite motif containing 71, E3 ubiquitin protein ligase 1 1
MIRT244069 EDN1 endothelin 1 1 1
MIRT252330 SALL3 sal-like 3 (Drosophila) 1 1
MIRT255314 CDV3 CDV3 homolog (mouse) 1 1
MIRT259277 PGRMC1 progesterone receptor membrane component 1 1 1
MIRT259479 TXLNG taxilin gamma 1 1
MIRT260707 CLDN12 claudin 12 1 3
MIRT264693 C11ORF57 chromosome 11 open reading frame 57 1 2
MIRT266212 PEX11B peroxisomal biogenesis factor 11 beta 1 1
MIRT266626 CHTOP chromatin target of PRMT1 1 1
MIRT268839 C1ORF21 chromosome 1 open reading frame 21 1 1
MIRT294446 ZNF264 zinc finger protein 264 1 1
MIRT297013 RRM2 ribonucleotide reductase M2 1 1
MIRT297443 SLC20A1 solute carrier family 20 (phosphate transporter), member 1 1 2
MIRT300037 BZW1 basic leucine zipper and W2 domains 1 1 2
MIRT300893 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT303320 MXD1 MAX dimerization protein 1 1 1
MIRT309846 NAT8L N-acetyltransferase 8-like (GCN5-related, putative) 1 1
MIRT322428 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 1
MIRT324731 ACER2 alkaline ceramidase 2 1 1
MIRT402057 ATP6V1F ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F 1 2
MIRT437395 LIN28A lin-28 homolog A (C. elegans) 4 1
MIRT437396 AURKB aurora kinase B 4 1
MIRT437435 EZH2 enhancer of zeste homolog 2 (Drosophila) 2 1
MIRT438632 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 2 1
MIRT439135 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 0 1
MIRT442020 NDUFA4P1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa, pseudogene 1 1 1
MIRT445658 ATP6V1G1 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 1 3
MIRT447136 KIF27 kinesin family member 27 1 1
MIRT448259 ZNF774 zinc finger protein 774 1 1
MIRT449005 ANKRD46 ankyrin repeat domain 46 1 1
MIRT449953 FMNL3 formin-like 3 1 1
MIRT451155 C19orf53 chromosome 19 open reading frame 53 1 1
MIRT451624 MEIS3P1 Meis homeobox 3 pseudogene 1 1 1
MIRT451693 C1RL complement component 1, r subcomponent-like 1 1
MIRT452092 NUCB2 nucleobindin 2 1 1
MIRT452431 QDPR quinoid dihydropteridine reductase 1 1
MIRT452943 DISC1 disrupted in schizophrenia 1 1 1
MIRT453401 RHD Rh blood group, D antigen 1 3
MIRT454164 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT454280 FXN frataxin 1 1
MIRT454539 RABL2A RAB, member of RAS oncogene family-like 2A 1 1
MIRT454854 ACOT9 acyl-CoA thioesterase 9 1 2
MIRT455676 GLO1 glyoxalase I 1 1
MIRT457248 RABL2B RAB, member of RAS oncogene family-like 2B 1 1
MIRT457677 ZNF587 zinc finger protein 587 1 1
MIRT457887 THEM6 thioesterase superfamily member 6 1 2
MIRT458016 MRPL12 mitochondrial ribosomal protein L12 1 1
MIRT458279 FUT10 fucosyltransferase 10 (alpha (1,3) fucosyltransferase) 1 1
MIRT459736 RRM1 ribonucleotide reductase M1 1 1
MIRT460453 NOM1 nucleolar protein with MIF4G domain 1 1 2
MIRT460500 FAM105A family with sequence similarity 105, member A 1 3
MIRT460938 NOA1 nitric oxide associated 1 1 2
MIRT461092 OPA3 optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) 1 1
MIRT461169 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 2
MIRT461364 COL8A1 collagen, type VIII, alpha 1 1 1
MIRT462382 YAE1D1 Yae1 domain containing 1 1 1
MIRT462780 ZNF8 zinc finger protein 8 1 1
MIRT463420 ZC3HAV1L zinc finger CCCH-type, antiviral 1-like 1 1
MIRT463662 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT464265 VCL vinculin 1 1
MIRT465122 TSC22D2 TSC22 domain family, member 2 1 2
MIRT466184 TMED5 transmembrane emp24 protein transport domain containing 5 1 2
MIRT466722 SYNJ2BP synaptojanin 2 binding protein 1 1
MIRT469102 RNF144B ring finger protein 144B 1 1
MIRT469714 RAB40C RAB40C, member RAS oncogene family 1 1
MIRT470425 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT470679 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 1 2
MIRT470861 PLXND1 plexin D1 1 1
MIRT471271 PGM2L1 phosphoglucomutase 2-like 1 1 1
MIRT471957 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 1
MIRT472672 NAA20 N(alpha)-acetyltransferase 20, NatB catalytic subunit 1 1
MIRT472739 MTUS1 microtubule associated tumor suppressor 1 1 3
MIRT473134 MLLT10 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 1 1
MIRT473234 SMCR7L Smith-Magenis syndrome chromosome region, candidate 7-like 1 4
MIRT473828 MAP2K7 mitogen-activated protein kinase kinase 7 1 1
MIRT473940 LYN v-yes-1 Yamaguchi sarcoma viral related oncogene homolog 1 1
MIRT474022 LRRC20 leucine rich repeat containing 20 1 1
MIRT474502 KLHDC8B kelch domain containing 8B 1 1
MIRT474766 KIAA0930 KIAA0930 1 1
MIRT474905 KCTD21 potassium channel tetramerisation domain containing 21 1 1
MIRT475331 IFNLR1 interleukin 28 receptor, alpha (interferon, lambda receptor) 1 1
MIRT475379 ICOSLG inducible T-cell co-stimulator ligand 1 1
MIRT475733 HERPUD1 homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 1 2
MIRT476548 GABPB1 GA binding protein transcription factor, beta subunit 1 1 2
MIRT476973 FAM83G family with sequence similarity 83, member G 1 2
MIRT477534 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 2
MIRT477682 EFHD2 EF-hand domain family, member D2 1 1
MIRT481201 ATXN7L3B ataxin 7-like 3B 1 2
MIRT481241 ATXN7L3 ataxin 7-like 3 1 1
MIRT481363 ATG9A autophagy related 9A 1 1
MIRT481388 ATG12 autophagy related 12 1 1
MIRT481652 AREL1 KIAA0317 1 1
MIRT481851 AP1S1 adaptor-related protein complex 1, sigma 1 subunit 1 1
MIRT482184 AHR aryl hydrocarbon receptor 1 1
MIRT482220 AHCYL2 adenosylhomocysteinase-like 2 1 1
MIRT485296 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT486659 ZNF28 zinc finger protein 28 1 1
MIRT489413 TUBB2A tubulin, beta 2A class IIa 1 1
MIRT491867 ZBTB5 zinc finger and BTB domain containing 5 1 4
MIRT492216 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT492626 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT493323 LIMD2 LIM domain containing 2 1 1
MIRT493901 FAM43A family with sequence similarity 43, member A 1 2
MIRT494263 CEP120 centrosomal protein 120kDa 1 1
MIRT494687 ARID3A AT rich interactive domain 3A (BRIGHT-like) 1 1
MIRT495968 TBC1D19 TBC1 domain family, member 19 1 1
MIRT496111 SNX17 sorting nexin 17 1 1
MIRT497875 SLC12A7 solute carrier family 12 (potassium/chloride transporters), member 7 1 1
MIRT498122 PLEKHO1 pleckstrin homology domain containing, family O member 1 1 2
MIRT499405 PLCG2 phospholipase C, gamma 2 (phosphatidylinositol-specific) 1 2
MIRT499493 GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT499653 SDR42E1 short chain dehydrogenase/reductase family 42E, member 1 1 1
MIRT499942 MFSD8 major facilitator superfamily domain containing 8 1 1
MIRT499997 HIST1H2BD histone cluster 1, H2bd 1 2
MIRT500819 THBS1 thrombospondin 1 1 1
MIRT500902 STRN striatin, calmodulin binding protein 1 2
MIRT501118 SLC5A6 solute carrier family 5 (sodium-dependent vitamin transporter), member 6 1 2
MIRT501173 SLC10A7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 3
MIRT501202 SUMO1 SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) 1 1
MIRT501241 SEMA4C sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C 1 3
MIRT501328 RNFT1 ring finger protein, transmembrane 1 1 1
MIRT501355 RNF44 ring finger protein 44 1 2
MIRT501387 RBFOX2 RNA binding protein, fox-1 homolog (C. elegans) 2 1 5
MIRT501441 RAB11FIP4 RAB11 family interacting protein 4 (class II) 1 1
MIRT501759 NSD1 nuclear receptor binding SET domain protein 1 1 1
MIRT501943 MBD2 methyl-CpG binding domain protein 2 1 4
MIRT502106 KPNA5 karyopherin alpha 5 (importin alpha 6) 1 4
MIRT502130 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 2
MIRT502784 CEP135 centrosomal protein 135kDa 1 1
MIRT502845 CELF1 CUGBP, Elav-like family member 1 1 1
MIRT504789 C12orf4 chromosome 12 open reading frame 4 1 1
MIRT505017 ZNF644 zinc finger protein 644 1 1
MIRT506942 IGDCC4 immunoglobulin superfamily, DCC subclass, member 4 1 3
MIRT507252 FIGN fidgetin 1 4
MIRT507694 COIL coilin 1 3
MIRT508401 C1orf210 chromosome 1 open reading frame 210 1 3
MIRT508665 DIABLO diablo, IAP-binding mitochondrial protein 1 2
MIRT508932 AK4 adenylate kinase 4 1 2
MIRT510395 ZNF566 zinc finger protein 566 1 3
MIRT510518 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 3
MIRT511386 IKZF3 IKAROS family zinc finger 3 (Aiolos) 1 2
MIRT512745 CD59 CD59 molecule, complement regulatory protein 1 2
MIRT515954 C9orf156 chromosome 9 open reading frame 156 1 1
MIRT516083 ZBTB8OS zinc finger and BTB domain containing 8 opposite strand 1 2
MIRT523619 FZD9 frizzled family receptor 9 1 2
MIRT523733 FBXW2 F-box and WD repeat domain containing 2 1 2
MIRT523990 DVL3 dishevelled, dsh homolog 3 (Drosophila) 1 1
MIRT524113 DNA2 DNA replication helicase 2 homolog (yeast) 1 1
MIRT525727 SOD2 superoxide dismutase 2, mitochondrial 1 1
MIRT527763 RRAD Ras-related associated with diabetes 1 1
MIRT529727 OPRL1 opiate receptor-like 1 1 1
MIRT533187 WASL Wiskott-Aldrich syndrome-like 1 3
MIRT536378 LEFTY1 left-right determination factor 1 1 1
MIRT543785 RBM12B RNA binding motif protein 12B 1 2
MIRT543868 SLC16A9 solute carrier family 16, member 9 (monocarboxylic acid transporter 9) 1 1
MIRT545387 PM20D2 peptidase M20 domain containing 2 1 1
MIRT545890 ZNF200 zinc finger protein 200 1 2
MIRT546334 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT547373 MSI2 musashi homolog 2 (Drosophila) 1 1
MIRT547579 LRIG3 leucine-rich repeats and immunoglobulin-like domains 3 1 2
MIRT548264 FBXL20 F-box and leucine-rich repeat protein 20 1 1
MIRT548351 EPHA4 EPH receptor A4 1 1
MIRT548534 DUSP1 dual specificity phosphatase 1 1 1
MIRT548560 DNAL1 dynein, axonemal, light chain 1 1 1
MIRT548779 COLEC12 collectin sub-family member 12 1 1
MIRT548978 CCNT2 cyclin T2 1 1
MIRT549208 BEND4 BEN domain containing 4 1 2
MIRT549763 ZNF611 zinc finger protein 611 1 3
MIRT549799 KIAA0391 KIAA0391 1 1
MIRT549847 ECHDC1 enoyl CoA hydratase domain containing 1 1 1
MIRT550898 ACTA1 actin, alpha 1, skeletal muscle 1 1
MIRT551283 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 1 3
MIRT551318 GSG2 germ cell associated 2 (haspin) 1 3
MIRT551932 AKAP8 A kinase (PRKA) anchor protein 8 1 2
MIRT552003 RAD18 RAD18 homolog (S. cerevisiae) 1 1
MIRT552410 ZNF460 zinc finger protein 460 1 2
MIRT553013 USP38 ubiquitin specific peptidase 38 1 1
MIRT555550 PLEKHA3 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3 1 1
MIRT555711 PDZD8 PDZ domain containing 8 1 1
MIRT557372 HAND1 heart and neural crest derivatives expressed 1 1 1
MIRT557960 FAM222B family with sequence similarity 222, member B 1 1
MIRT559087 C19orf47 chromosome 19 open reading frame 47 1 2
MIRT559497 ARIH1 ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) 1 1
MIRT561772 PEG10 paternally expressed 10 1 1
MIRT564402 EMILIN2 elastin microfibril interfacer 2 1 2
MIRT565443 SURF4 surfeit 4 1 1
MIRT566518 PARP16 poly (ADP-ribose) polymerase family, member 16 1 1
MIRT567715 E2F6 E2F transcription factor 6 1 1
MIRT568655 ABHD17C family with sequence similarity 108, member C1 1 1
MIRT569498 THYN1 thymocyte nuclear protein 1 1 1
MIRT573820 TGOLN2 trans-golgi network protein 2 1 1
MIRT574363 ZBTB37 zinc finger and BTB domain containing 37 1 1
MIRT574750 GOLGA4 golgin A4 1 1
MIRT574788 FAM104A family with sequence similarity 104, member A 1 1
MIRT576089 Poteg POTE ankyrin domain family, member G 1 1
MIRT576812 Thbs1 thrombospondin 1 1 1
MIRT616370 RWDD1 RWD domain containing 1 1 1
MIRT617851 FMO4 flavin containing monooxygenase 4 1 1
MIRT642394 ZNF556 zinc finger protein 556 1 1
MIRT680519 PRIM2 primase, DNA, polypeptide 2 (58kDa) 1 1
MIRT680547 ZNF584 zinc finger protein 584 1 1
MIRT680800 ZNF578 zinc finger protein 578 1 1
MIRT680838 ARL8B ADP-ribosylation factor-like 8B 1 1
MIRT681141 INTS7 integrator complex subunit 7 1 1
MIRT681271 RFC2 replication factor C (activator 1) 2, 40kDa 1 1
MIRT681323 ZFAND4 zinc finger, AN1-type domain 4 1 2
MIRT681359 BRI3BP BRI3 binding protein 1 1
MIRT681506 STAT2 signal transducer and activator of transcription 2, 113kDa 1 1
MIRT681536 ZNF738 zinc finger protein 738 1 1
MIRT681658 DTX3L deltex 3-like (Drosophila) 1 1
MIRT681738 RAB19 RAB19, member RAS oncogene family 1 2
MIRT681797 EIF4A3 eukaryotic translation initiation factor 4A3 1 1
MIRT681869 DNAH9 dynein, axonemal, heavy chain 9 1 1
MIRT681941 SLC19A3 solute carrier family 19, member 3 1 1
MIRT682102 ITGA3 integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) 1 2
MIRT682181 SLC38A7 solute carrier family 38, member 7 1 1
MIRT682238 SAR1A SAR1 homolog A (S. cerevisiae) 1 1
MIRT682384 PHACTR4 phosphatase and actin regulator 4 1 1
MIRT682444 MTX3 metaxin 3 1 1
MIRT682604 CPA4 carboxypeptidase A4 1 1
MIRT682640 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT689327 FPR1 formyl peptide receptor 1 1 1
MIRT689730 ATXN2 ataxin 2 1 1
MIRT691036 ZNF799 zinc finger protein 799 1 1
MIRT691935 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 1
MIRT694884 ZNF417 zinc finger protein 417 1 1
MIRT695255 ZNF443 zinc finger protein 443 1 1
MIRT695413 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 1 1
MIRT700589 PRSS22 protease, serine, 22 1 1
MIRT701428 NHLRC2 NHL repeat containing 2 1 1
MIRT702484 KIAA1328 KIAA1328 1 1
MIRT702715 IPO9 importin 9 1 1
MIRT704028 EDEM3 ER degradation enhancer, mannosidase alpha-like 3 1 1
MIRT704418 CTPS1 CTP synthase 1 1 1
MIRT705750 AMD1 adenosylmethionine decarboxylase 1 1 1
MIRT712373 NAP1L1 nucleosome assembly protein 1-like 1 1 1
MIRT713520 PAFAH2 platelet-activating factor acetylhydrolase 2, 40kDa 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*