Accession ID: MIRT051616 [miRNA, hsa-let-7e-5p :: CTSA, target gene]
pre-miRNA Information
pre-miRNA ID hsa-let-7eLinkOut: [miRBase ]
Synonyms MIRNLET7E, hsa-let-7e, let-7e, MIRLET7E
Description Homo sapiens let-7e stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-let-7e-5p
Mature Sequence 8| UGAGGUAGGAGGUUGUAUAGUU |29
Evidence Experimental
Experiments Cloned
Putative hsa-let-7e-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CTSA LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms GLB2, GSL, NGBE, PPCA, PPGB
Description cathepsin A
Transcript NM_0011675    LinkOut: [ RefSeq ]
Other Transcripts NM_0011276 , NM_0003   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CTSA LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CTSA
(miRNA target sites are highlighted)
>CTSA|NM_0011675|3'UTR
   1 CAGCCATACTGATGACCACAGCAACCAGCTCCACGGCCTGATGCAGCCCCTCCCAGCCTCTCCCGCTAGGAGAGTCCTCT
  81 TCTAAGCAAAGTGCCCCTGCAGGCCGGGTTCTGCCGCCAGGACTGCCCCCTTCCCAGAGCCCTGTACATCCCAGACTGGG
 161 CCCAGGGTCTCCCATAGACAGCCTGGGGGCAAGTTAGCACTTTATTCCCGCAGCAGTTCCTGAATGGGGTGGCCTGGCCC
 241 CTTCTCTGCTTAAAGAATGCCCTTTATGATGCACTGATTCCATCCCAGGAACCCAACAGAGCTCAGGACAGCCCACAGGG
 321 AGGTGGTGGACGGACTGTAATTGATAGATTGATTATGGAATTAAATTGGGTACAGCTTCAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uuGA-UAUGUU--GGA-GGAUGGAGu 5'
            || ||:||:  ||| || :|||| 
Target 5' gcCTGATGCAGCCCCTCCCAGCCTCt 3'
36 - 61 118.00 -17.80
2
miRNA  3' uugauAUGU-UGG---AGGAUGGAGu 5'
               |:|| :||   |:||:|| | 
Target 5' gccccTGCAGGCCGGGTTCTGCCGCc 3'
93 - 118 105.00 -14.30
3
miRNA  3' uuGAUAUGUUGGAG-GAUGGAgu 5'
            ||: :|  |:|| ||:|:|  
Target 5' gcCTG-GCCCCTTCTCTGCTTaa 3'
232 - 253 99.00 -9.70
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-let-7e-5p :: CTSA    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
305 hsa-let-7e-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT002081 HMGA2 high mobility group AT-hook 2 3 1
MIRT003932 EIF3J eukaryotic translation initiation factor 3, subunit J 2 1
MIRT004469 SMC1A structural maintenance of chromosomes 1A 2 1
MIRT005718 WNT1 wingless-type MMTV integration site family, member 1 4 1
MIRT006122 CCND1 cyclin D1 3 1
MIRT006404 MPL myeloproliferative leukemia virus oncogene 1 1
MIRT032098 RABGAP1L RAB GTPase activating protein 1-like 1 1
MIRT032099 DAD1 defender against cell death 1 1 1
MIRT032100 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 1 1
MIRT051413 WDR67 WD repeat domain 67 1 1
MIRT051414 FAM219B chromosome 15 open reading frame 17 1 1
MIRT051415 C11orf91 chromosome 11 open reading frame 91 1 1
MIRT051416 CENPP centromere protein P 1 1
MIRT051417 TMEM107 transmembrane protein 107 1 1
MIRT051418 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT051419 DAAM1 dishevelled associated activator of morphogenesis 1 1 1
MIRT051420 DGCR8 DiGeorge syndrome critical region gene 8 1 1
MIRT051421 RAP1A RAP1A, member of RAS oncogene family 1 1
MIRT051422 RPA1 replication protein A1, 70kDa 1 1
MIRT051423 SKIV2L superkiller viralicidic activity 2-like (S. cerevisiae) 1 1
MIRT051424 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT051425 RPS27 ribosomal protein S27 1 1
MIRT051426 ARNT2 aryl-hydrocarbon receptor nuclear translocator 2 1 1
MIRT051427 GPM6B glycoprotein M6B 1 1
MIRT051428 TTLL12 tubulin tyrosine ligase-like family, member 12 1 1
MIRT051429 HIST2H2BF histone cluster 2, H2bf 1 1
MIRT051430 CELF2 CUGBP, Elav-like family member 2 1 1
MIRT051431 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT051432 VPS13D vacuolar protein sorting 13 homolog D (S. cerevisiae) 1 1
MIRT051433 RPL10 ribosomal protein L10 1 1
MIRT051434 SPCS2 signal peptidase complex subunit 2 homolog (S. cerevisiae) 1 1
MIRT051435 DCAF8 DDB1 and CUL4 associated factor 8 1 1
MIRT051436 CTC1 chromosome 17 open reading frame 68 1 1
MIRT051437 NAA60 N-acetyltransferase 15 (GCN5-related, putative) 1 1
MIRT051438 PHF3 PHD finger protein 3 1 1
MIRT051439 TUBA1B tubulin, alpha 1b 1 1
MIRT051440 SHANK1 SH3 and multiple ankyrin repeat domains 1 1 1
MIRT051441 SKA2 spindle and kinetochore associated complex subunit 2 1 1
MIRT051442 SPTBN1 spectrin, beta, non-erythrocytic 1 1 1
MIRT051443 ND2 MTND2 1 1
MIRT051444 MED13L mediator complex subunit 13-like 1 1
MIRT051445 RCOR3 REST corepressor 3 1 1
MIRT051446 MACF1 microtubule-actin crosslinking factor 1 1 1
MIRT051447 RDX radixin 1 1
MIRT051448 PCBP2 poly(rC) binding protein 2 1 1
MIRT051449 UBAP2L ubiquitin associated protein 2-like 1 1
MIRT051450 CDCA3 cell division cycle associated 3 1 1
MIRT051451 CABLES1 Cdk5 and Abl enzyme substrate 1 1 1
MIRT051452 BTRC beta-transducin repeat containing 1 1
MIRT051453 C12orf49 chromosome 12 open reading frame 49 1 1
MIRT051454 TIMP3 TIMP metallopeptidase inhibitor 3 1 1
MIRT051455 WBSCR16 Williams-Beuren syndrome chromosome region 16 1 1
MIRT051456 SLC2A11 solute carrier family 2 (facilitated glucose transporter), member 11 1 1
MIRT051457 NF1 neurofibromin 1 1 1
MIRT051458 LRRC8A leucine rich repeat containing 8 family, member A 1 1
MIRT051459 RUNX1T1 runt-related transcription factor 1; translocated to, 1 (cyclin D-related) 1 1
MIRT051460 DTNB dystrobrevin, beta 1 1
MIRT051461 SCMH1 sex comb on midleg homolog 1 (Drosophila) 1 1
MIRT051462 YWHAG tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide 1 1
MIRT051463 RHBDD2 rhomboid domain containing 2 1 1
MIRT051464 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT051465 NDST1 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 1 1
MIRT051466 IGF2BP3 insulin-like growth factor 2 mRNA binding protein 3 1 1
MIRT051467 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT051468 BAHCC1 BAH domain and coiled-coil containing 1 1 1
MIRT051469 CARM1 coactivator-associated arginine methyltransferase 1 1 1
MIRT051470 DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 1 1
MIRT051471 ND3 NADH dehydrogenase, subunit 3 (complex I) 1 1
MIRT051472 PIGS phosphatidylinositol glycan anchor biosynthesis, class S 1 1
MIRT051473 ALG13 asparagine-linked glycosylation 13 homolog (S. cerevisiae) 1 1
MIRT051474 RPN2 ribophorin II 1 1
MIRT051475 RPL12 ribosomal protein L12 1 1
MIRT051476 NME4 non-metastatic cells 4, protein expressed in 1 1
MIRT051477 IVD isovaleryl-CoA dehydrogenase 1 1
MIRT051478 JAZF1 JAZF zinc finger 1 1 1
MIRT051479 ND4 NADH dehydrogenase, subunit 4 (complex I) 1 1
MIRT051480 VARS valyl-tRNA synthetase 1 1
MIRT051481 RNF26 ring finger protein 26 1 1
MIRT051482 LHFPL2 lipoma HMGIC fusion partner-like 2 1 1
MIRT051483 ARCN1 archain 1 1 1
MIRT051484 COX1 cytochrome c oxidase subunit I 1 1
MIRT051485 SLC12A4 solute carrier family 12 (potassium/chloride transporters), member 4 1 1
MIRT051486 AEBP2 AE binding protein 2 1 1
MIRT051487 PET112 PET112-like (yeast) 1 1
MIRT051488 UROC1 urocanase domain containing 1 1 1
MIRT051489 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT051490 BSDC1 BSD domain containing 1 1 1
MIRT051491 PTK2 PTK2 protein tyrosine kinase 2 1 1
MIRT051492 CDC5L CDC5 cell division cycle 5-like (S. pombe) 1 1
MIRT051493 EN2 engrailed homeobox 2 1 1
MIRT051494 SSB Sjogren syndrome antigen B (autoantigen La) 1 1
MIRT051495 SLCO3A1 solute carrier organic anion transporter family, member 3A1 1 1
MIRT051496 RRAGC Ras-related GTP binding C 1 1
MIRT051497 ZNF236 zinc finger protein 236 1 1
MIRT051498 SEMA4B sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B 1 1
MIRT051499 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT051500 XIAP X-linked inhibitor of apoptosis 1 1
MIRT051501 GTF2I general transcription factor IIi 1 1
MIRT051502 JMJD1C jumonji domain containing 1C 1 1
MIRT051503 OTUD5 OTU domain containing 5 1 1
MIRT051504 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT051505 PPIG peptidylprolyl isomerase G (cyclophilin G) 1 1
MIRT051506 PSMD2 proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 1 1
MIRT051507 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 1 1
MIRT051508 VAMP2 vesicle-associated membrane protein 2 (synaptobrevin 2) 1 1
MIRT051509 LSR lipolysis stimulated lipoprotein receptor 1 1
MIRT051510 KIAA0355 KIAA0355 1 1
MIRT051511 RPSA ribosomal protein SA 1 1
MIRT051512 DCAF6 DDB1 and CUL4 associated factor 6 1 1
MIRT051513 UHRF1BP1 UHRF1 binding protein 1 1 1
MIRT051514 OTUB1 OTU domain, ubiquitin aldehyde binding 1 1 1
MIRT051515 PIGP phosphatidylinositol glycan anchor biosynthesis, class P 1 1
MIRT051516 LMLN leishmanolysin-like (metallopeptidase M8 family) 1 1
MIRT051517 PPP2R1A protein phosphatase 2, regulatory subunit A, alpha 1 1
MIRT051518 HIPK1 homeodomain interacting protein kinase 1 1 1
MIRT051519 SERF2 small EDRK-rich factor 2 1 1
MIRT051520 RBM4 RNA binding motif protein 4 1 1
MIRT051521 RBM14 RNA binding motif protein 14 1 1
MIRT051522 HMGB1 high-mobility group box 1 1 1
MIRT051523 GMPS guanine monphosphate synthetase 1 1
MIRT051524 DIAPH1 diaphanous homolog 1 (Drosophila) 1 1
MIRT051525 STAM signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 1 1
MIRT051526 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide 1 1
MIRT051527 APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 1 1
MIRT051528 MARCH5 membrane-associated ring finger (C3HC4) 5 1 1
MIRT051529 SQLE squalene epoxidase 1 1
MIRT051530 TIMM50 translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) 1 1
MIRT051531 NDUFA3 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa 1 1
MIRT051532 NDUFS5 NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase) 1 1
MIRT051533 NRSN2 neurensin 2 1 1
MIRT051534 SALL1 sal-like 1 (Drosophila) 1 1
MIRT051535 COX3 cytochrome c oxidase III 1 1
MIRT051536 RABL6 chromosome 9 open reading frame 86 1 1
MIRT051537 SUPT4H1 suppressor of Ty 4 homolog 1 (S. cerevisiae) 1 1
MIRT051538 PACS2 phosphofurin acidic cluster sorting protein 2 1 1
MIRT051539 MTMR14 myotubularin related protein 14 1 1
MIRT051540 LUZP1 leucine zipper protein 1 1 1
MIRT051541 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT051542 SUZ12 suppressor of zeste 12 homolog (Drosophila) 1 1
MIRT051543 PAPD4 PAP associated domain containing 4 1 1
MIRT051544 QSOX1 quiescin Q6 sulfhydryl oxidase 1 1 1
MIRT051545 SPATA13 spermatogenesis associated 13 1 1
MIRT051546 DHX57 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 1 1
MIRT051547 KATNB1 katanin p80 (WD repeat containing) subunit B 1 1 1
MIRT051548 COL6A1 collagen, type VI, alpha 1 1 1
MIRT051549 DHX15 DEAH (Asp-Glu-Ala-His) box polypeptide 15 1 1
MIRT051550 MTCH2 mitochondrial carrier homolog 2 (C. elegans) 1 1
MIRT051551 KIAA0100 KIAA0100 1 1
MIRT051552 SUGP2 splicing factor, arginine/serine-rich 14 1 1
MIRT051553 NCLN nicalin homolog (zebrafish) 1 1
MIRT051554 ATXN2L ataxin 2-like 1 1
MIRT051555 CHD9 chromodomain helicase DNA binding protein 9 1 1
MIRT051556 PES1 pescadillo homolog 1, containing BRCT domain (zebrafish) 1 1
MIRT051557 NUP155 nucleoporin 155kDa 1 1
MIRT051558 GNG5 guanine nucleotide binding protein (G protein), gamma 5 1 1
MIRT051559 ARHGAP19 Rho GTPase activating protein 19 1 1
MIRT051560 MTFR1 mitochondrial fission regulator 1 1 1
MIRT051561 IRS2 insulin receptor substrate 2 1 1
MIRT051562 IRS4 insulin receptor substrate 4 1 1
MIRT051563 PPP1R10 protein phosphatase 1, regulatory (inhibitor) subunit 10 1 1
MIRT051564 ZNF284 zinc finger protein 284 1 1
MIRT051565 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 1
MIRT051566 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT051567 FDPS farnesyl diphosphate synthase (farnesyl pyrophosphate synthetase, dimethylallyltranstransferase, geranyltranstransferase) 1 1
MIRT051568 KRBOX4 zinc finger family member 673 1 1
MIRT051569 BRI3 brain protein I3 1 1
MIRT051570 CHD7 chromodomain helicase DNA binding protein 7 1 1
MIRT051571 PYCR1 pyrroline-5-carboxylate reductase 1 1 1
MIRT051572 SMAP2 small ArfGAP2 1 1
MIRT051573 WDFY3 WD repeat and FYVE domain containing 3 1 1
MIRT051574 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 1 1
MIRT051575 SRSF2 splicing factor, arginine/serine-rich 2 1 1
MIRT051576 PGD phosphogluconate dehydrogenase 1 1
MIRT051577 RMND5A required for meiotic nuclear division 5 homolog A (S. cerevisiae) 1 1
MIRT051578 ZNF652 zinc finger protein 652 1 1
MIRT051579 PSMA6 proteasome (prosome, macropain) subunit, alpha type, 6 1 1
MIRT051580 SLC38A2 solute carrier family 38, member 2 1 1
MIRT051581 LRRC41 leucine rich repeat containing 41 1 1
MIRT051582 RANBP2 RAN binding protein 2 1 1
MIRT051583 SVIL supervillin 1 1
MIRT051584 CCNG1 cyclin G1 1 1
MIRT051585 ZNF256 zinc finger protein 256 1 1
MIRT051586 COPG1 coatomer protein complex, subunit gamma 1 1
MIRT051587 PDCD11 programmed cell death 11 1 1
MIRT051588 CNBP CCHC-type zinc finger, nucleic acid binding protein 1 1
MIRT051589 USP37 ubiquitin specific peptidase 37 1 1
MIRT051590 UBE2V2 ubiquitin-conjugating enzyme E2 variant 2 1 1
MIRT051591 UBE2H ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast) 1 1
MIRT051592 LMNA lamin A/C 1 1
MIRT051593 STAT3 signal transducer and activator of transcription 3 (acute-phase response factor) 1 1
MIRT051594 TRPV1 transient receptor potential cation channel, subfamily V, member 1 1 1
MIRT051595 MATR3 matrin 3 1 1
MIRT051596 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 1 1
MIRT051597 HS6ST2 heparan sulfate 6-O-sulfotransferase 2 1 1
MIRT051598 WDR48 WD repeat domain 48 1 1
MIRT051599 RBM8A RNA binding motif protein 8A 1 1
MIRT051600 SCYL1 SCY1-like 1 (S. cerevisiae) 1 1
MIRT051601 C19orf48 chromosome 19 open reading frame 48 1 1
MIRT051602 FOXD4L6 forkhead box D4-like 6 1 1
MIRT051603 PIGN phosphatidylinositol glycan anchor biosynthesis, class N 1 1
MIRT051604 SPCS3 signal peptidase complex subunit 3 homolog (S. cerevisiae) 1 1
MIRT051605 TNFAIP1 tumor necrosis factor, alpha-induced protein 1 (endothelial) 1 1
MIRT051606 MS4A10 membrane-spanning 4-domains, subfamily A, member 10 1 1
MIRT051607 MSMO1 sterol-C4-methyl oxidase-like 1 1
MIRT051608 ARID1A AT rich interactive domain 1A (SWI-like) 1 1
MIRT051609 NCKIPSD NCK interacting protein with SH3 domain 1 1
MIRT051610 NCBP1 nuclear cap binding protein subunit 1, 80kDa 1 1
MIRT051611 COX16 COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) 1 1
MIRT051612 NUDT8 nudix (nucleoside diphosphate linked moiety X)-type motif 8 1 1
MIRT051613 PHKA1 phosphorylase kinase, alpha 1 (muscle) 1 1
MIRT051614 TXNRD1 thioredoxin reductase 1 1 1
MIRT051615 ELMSAN1 chromosome 14 open reading frame 43 1 1
MIRT051616 CTSA cathepsin A 1 1
MIRT051617 PRRC2A HLA-B associated transcript 2 1 1
MIRT051618 SPAG9 sperm associated antigen 9 1 1
MIRT051619 AGMAT agmatine ureohydrolase (agmatinase) 1 1
MIRT051620 NCKAP5L NCK-associated protein 5-like 1 1
MIRT051621 ZFP62 zinc finger protein 62 homolog (mouse) 1 1
MIRT051622 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 1 1
MIRT051623 POLR3D polymerase (RNA) III (DNA directed) polypeptide D, 44kDa 1 1
MIRT051624 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT051625 ATP6 ATP synthase F0 subunit 6 1 1
MIRT051626 ZFAND5 zinc finger, AN1-type domain 5 1 1
MIRT051627 BAZ1B bromodomain adjacent to zinc finger domain, 1B 1 1
MIRT051628 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT051629 BMP2K BMP2 inducible kinase 1 1
MIRT051630 SPN sialophorin 1 1
MIRT051631 PA2G4 proliferation-associated 2G4, 38kDa 1 1
MIRT051632 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT051633 TUBB4B tubulin, beta 2C 1 1
MIRT051634 TRRAP transformation/transcription domain-associated protein 1 1
MIRT051635 SLCO4A1 solute carrier organic anion transporter family, member 4A1 1 1
MIRT051636 CCRN4L CCR4 carbon catabolite repression 4-like (S. cerevisiae) 1 1
MIRT051637 USE1 unconventional SNARE in the ER 1 homolog (S. cerevisiae) 1 1
MIRT051638 STARD7 StAR-related lipid transfer (START) domain containing 7 1 1
MIRT051639 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT051640 CLTC clathrin, heavy chain (Hc) 1 1
MIRT051641 TERF1 telomeric repeat binding factor (NIMA-interacting) 1 1 1
MIRT051642 PAX3 paired box 3 1 1
MIRT051643 CCDC97 coiled-coil domain containing 97 1 1
MIRT051644 HLA-C major histocompatibility complex, class I, C 1 1
MIRT051645 GTPBP8 GTP-binding protein 8 (putative) 1 1
MIRT051646 VGLL4 vestigial like 4 (Drosophila) 1 1
MIRT051647 ANKRD40 ankyrin repeat domain 40 1 1
MIRT051648 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT051649 ND1 NADH dehydrogenase, subunit 1 (complex I) 1 1
MIRT051650 DSP desmoplakin 1 1
MIRT051651 UBN2 ubinuclein 2 1 1
MIRT051652 ZNF805 zinc finger protein 805 1 1
MIRT051653 RBBP4 retinoblastoma binding protein 4 1 1
MIRT051655 CBX5 chromobox homolog 5 (HP1 alpha homolog, Drosophila) 1 1
MIRT051656 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT051657 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT051658 SUB1 SUB1 homolog (S. cerevisiae) 1 1
MIRT051659 RSL1D1 ribosomal L1 domain containing 1 1 1
MIRT051660 SEC23IP SEC23 interacting protein 1 1
MIRT051661 RNMT RNA (guanine-7-) methyltransferase 1 1
MIRT051662 SGSM3 small G protein signaling modulator 3 1 1
MIRT051663 ZFP3 zinc finger protein 3 homolog (mouse) 1 1
MIRT051664 GLUL glutamate-ammonia ligase 1 1
MIRT051665 POLD1 polymerase (DNA directed), delta 1, catalytic subunit 125kDa 1 1
MIRT051666 WDR4 WD repeat domain 4 1 1
MIRT051667 PPP1R2 protein phosphatase 1, regulatory (inhibitor) subunit 2 1 1
MIRT051668 RAI2 retinoic acid induced 2 1 1
MIRT051669 PLCXD1 phosphatidylinositol-specific phospholipase C, X domain containing 1 1 1
MIRT051670 UTP15 UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) 1 1
MIRT051671 THADA thyroid adenoma associated 1 1
MIRT051672 ZNF451 zinc finger protein 451 1 1
MIRT051673 CREBBP CREB binding protein 1 1
MIRT051674 ZNF770 zinc finger protein 770 1 1
MIRT051675 CLDN4 claudin 4 1 1
MIRT051676 ZKSCAN7 zinc finger protein 167 1 1
MIRT051677 NICN1 nicolin 1 1 1
MIRT051678 RPLP2 ribosomal protein, large, P2 1 1
MIRT051679 DCBLD2 discoidin, CUB and LCCL domain containing 2 1 1
MIRT051680 IRGQ immunity-related GTPase family, Q 1 1
MIRT051681 CA5B carbonic anhydrase VB, mitochondrial 1 1
MIRT051682 COX14 chromosome 12 open reading frame 62 1 1
MIRT051683 PSD3 pleckstrin and Sec7 domain containing 3 1 1
MIRT051684 RPL27A ribosomal protein L27a 1 1
MIRT051685 CWC15 CWC15 spliceosome-associated protein homolog (S. cerevisiae) 1 1
MIRT051686 NT5DC2 5'-nucleotidase domain containing 2 1 1
MIRT051687 OR7D2 olfactory receptor, family 7, subfamily D, member 2 1 1
MIRT051688 HIF1AN hypoxia inducible factor 1, alpha subunit inhibitor 1 1
MIRT051689 NUDT15 nudix (nucleoside diphosphate linked moiety X)-type motif 15 1 1
MIRT051690 CDH18 cadherin 18, type 2 1 1
MIRT051691 FAM160B1 family with sequence similarity 160, member B1 1 1
MIRT051692 DZIP1 DAZ interacting protein 1 1 1
MIRT051693 TDRD7 tudor domain containing 7 1 1
MIRT051694 TCF4 transcription factor 4 1 1
MIRT051695 ENSA endosulfine alpha 1 1
MIRT051696 GTF3C1 general transcription factor IIIC, polypeptide 1, alpha 220kDa 1 1
MIRT051697 TNFRSF1A tumor necrosis factor receptor superfamily, member 1A 1 1
MIRT051698 CCDC113 coiled-coil domain containing 113 1 1
MIRT051699 MYO9B myosin IXB 1 1
MIRT051700 COX10 COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) 1 1
MIRT051701 PRAMEF13 PRAME family member 13 1 1
MIRT051702 PMPCA peptidase (mitochondrial processing) alpha 1 1
MIRT051703 MRPS2 mitochondrial ribosomal protein S2 1 1
MIRT051704 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT051705 CCDC106 coiled-coil domain containing 106 1 1
MIRT051706 CYP2B6 cytochrome P450, family 2, subfamily B, polypeptide 6 1 1
MIRT051707 CDKAL1 CDK5 regulatory subunit associated protein 1-like 1 1 1
MIRT051708 PSME4 proteasome (prosome, macropain) activator subunit 4 1 1
MIRT051709 SETD1A SET domain containing 1A 1 1