Accession ID: MIRT051778 [miRNA, hsa-let-7c-5p :: EWSR1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-let-7cLinkOut: [miRBase ]
Synonyms LET7C, MIRNLET7C, hsa-let-7c, let-7c, MIRLET7C
Description Homo sapiens let-7c stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-let-7c-5p
Mature Sequence 11| UGAGGUAGUAGGUUGUAUGGUU |32
Evidence Experimental
Experiments Cloned
Putative hsa-let-7c-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol EWSR1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms EWS, bK984G1.4
Description Ewing sarcoma breakpoint region 1
Transcript NM_001163285    LinkOut: [ RefSeq ]
Other Transcripts NM_001163286 , NM_005243 , NM_013986   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on EWSR1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of EWSR1
(miRNA target sites are highlighted)
>EWSR1|NM_001163285|3'UTR
   1 CCTGAAGGCTTCCTCCCGCCACCCTTTCCGCCCCCGGGTGGTGATCGTGGCAGAGGTGGCCCTGGTGGCATGCGGGGAGG
  81 AAGAGGTGGCCTCATGGATCGTGGTGGTCCCGGTGGAATGTTCAGAGGTGGCCGTGGTGGAGACAGAGGTGGCTTCCGTG
 161 GTGGCCGGGGCATGGACCGAGGTGGCTTTGGTGGAGGAAGACGAGGTGGCCCTGGGGGGCCCCCTGGACCTTTGATGGAA
 241 CAGATGGGAGGAAGAAGAGGAGGACGTGGAGGACCTGGAAAAATGGATAAAGGCGAGCACCGTCAGGAGCGCAGAGATCG
 321 GCCCTACTAGATGCAGAGACCCCGCAGAGCTGCATTGACTACCAGATTTATTTTTTAAACCAGAAAATGTTTTAAATTTA
 401 TAATTCCATATTTATAATGTTGGCCACAACATTATGATTATTCCTTGTCTGTACTTTAGTATTTTTCACCATTTGTGAAG
 481 AAACATTAAAACAAGTTAAATGGTAGTGTGCGGAGTTTTTTTTTCTTCCTTCTTTTAAAAATGGTTGTTTAAGACTTTAA
 561 CAATGGGAACCCCTTGTGAGCATGCTCAGTATCATTGTGGAGAACCAAGAGGGCCTCTTAACTGTAACAATGTTCATGGT
 641 TGTGATGTTTTTTTTTTTTTTTTAAATAAAATTCCAAATGTTTATAAAGAGTCA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uugguAUGUUGGAUGAUGGagu 5'
               |:| |:: ||||||   
Target 5' agagcTGC-ATTGACTACCaga 3'
346 - 366 112.00 -8.52
2
miRNA  3' uugguauguuGGA----UGAUGGAGu 5'
                    |||    :|| |||| 
Target 5' ----------CCTGAAGGCTTCCTCc 3'
1 - 16 110.00 -6.70
3
miRNA  3' uuggUAUGUUGGAUGAUGGagu 5'
              || |::||  ||||:   
Target 5' agagAT-CGGCC--CTACTaga 3'
313 - 331 93.00 -9.44
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-let-7c-5p :: EWSR1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' ttggtatGTTGGATGATGGagt 5'
                 | ||| |||:||   
Target 5' -gaagacCCACCCACTGCCaag 3'
1 - 21
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
483 hsa-let-7c-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000407 CDK6 cyclin-dependent kinase 6 1 1
MIRT000408 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT000410 BCL2 B-cell CLL/lymphoma 2 1 1
MIRT000687 TGFBR1 transforming growth factor, beta receptor 1 4 1
MIRT002076 TRIM71 tripartite motif containing 71, E3 ubiquitin protein ligase 3 3
MIRT002322 HMGA2 high mobility group AT-hook 2 6 8
MIRT003748 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 3 2
MIRT004348 DICER1 dicer 1, ribonuclease type III 2 1
MIRT004491 BCL2L1 BCL2-like 1 4 2
MIRT004531 NRAS neuroblastoma RAS viral (v-ras) oncogene homolog 4 1
MIRT006403 MPL myeloproliferative leukemia virus oncogene 1 1
MIRT032187 MED28 mediator complex subunit 28 1 1
MIRT032188 EIF3J eukaryotic translation initiation factor 3, subunit J 1 1
MIRT032189 RTCA RNA 3'-terminal phosphate cyclase 1 1
MIRT032190 COPS8 COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis) 1 1
MIRT032191 GPS1 G protein pathway suppressor 1 1 1
MIRT032192 COPS6 COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) 1 1
MIRT051728 R3HDM2 R3H domain containing 2 1 1
MIRT051729 IP6K1 inositol hexakisphosphate kinase 1 1 1
MIRT051730 RFWD3 ring finger and WD repeat domain 3 1 1
MIRT051731 CEP170B KIAA0284 1 1
MIRT051732 ACTB actin, beta 1 1
MIRT051733 ZNF614 zinc finger protein 614 1 1
MIRT051734 SAFB scaffold attachment factor B 1 1
MIRT051735 FOXO3 forkhead box O3 1 1
MIRT051736 ND2 MTND2 1 1
MIRT051737 METAP2 methionyl aminopeptidase 2 1 1
MIRT051738 KIAA0141 KIAA0141 1 1
MIRT051739 CCNF cyclin F 1 1
MIRT051740 C5orf24 chromosome 5 open reading frame 24 1 1
MIRT051741 CSTF2T cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant 1 1
MIRT051742 TAZ tafazzin 1 1
MIRT051743 ND4L NADH dehydrogenase, subunit 4L (complex I) 1 1
MIRT051744 PRRC2A proline-rich coiled-coil 2A 1 1
MIRT051745 COX3 cytochrome c oxidase III 1 1
MIRT051746 RYR2 ryanodine receptor 2 (cardiac) 1 1
MIRT051747 ACTN4 actinin, alpha 4 1 1
MIRT051748 SMARCD1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 1 1
MIRT051749 VWA9 von Willebrand factor A domain containing 9 1 1
MIRT051750 RAB10 RAB10, member RAS oncogene family 1 1
MIRT051751 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT051752 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT051753 PPP2R5E protein phosphatase 2, regulatory subunit B', epsilon isoform 1 1
MIRT051754 BCOR BCL6 corepressor 1 1
MIRT051755 CACNG8 calcium channel, voltage-dependent, gamma subunit 8 1 1
MIRT051756 CDC42BPA CDC42 binding protein kinase alpha (DMPK-like) 1 1
MIRT051757 CBL Cbl proto-oncogene, E3 ubiquitin protein ligase 1 1
MIRT051758 ATP6 ATP synthase F0 subunit 6 1 1
MIRT051759 PEX6 peroxisomal biogenesis factor 6 1 1
MIRT051760 RPS4Y1 ribosomal protein S4, Y-linked 1 1 1
MIRT051761 NME4 NME/NM23 nucleoside diphosphate kinase 4 1 1
MIRT051762 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT051763 RPL18A ribosomal protein L18a 1 1
MIRT051764 NUDT21 nudix (nucleoside diphosphate linked moiety X)-type motif 21 1 1
MIRT051765 KRTAP19-1 keratin associated protein 19-1 1 1
MIRT051766 PAK4 p21 protein (Cdc42/Rac)-activated kinase 4 1 1
MIRT051767 LECT2 leukocyte cell-derived chemotaxin 2 1 1
MIRT051768 TMEM165 transmembrane protein 165 1 1
MIRT051769 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT051770 ITGA10 integrin, alpha 10 1 1
MIRT051771 DNAJC16 DnaJ (Hsp40) homolog, subfamily C, member 16 1 1
MIRT051772 METTL25 methyltransferase like 25 1 1
MIRT051773 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT051774 SLK STE20-like kinase 1 1
MIRT051775 EIF3C eukaryotic translation initiation factor 3, subunit C 1 1
MIRT051776 EIF3A eukaryotic translation initiation factor 3, subunit A 1 1
MIRT051777 SLC25A1 solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 1 1
MIRT051778 EWSR1 Ewing sarcoma breakpoint region 1 1 1
MIRT051779 DUSP7 dual specificity phosphatase 7 1 1
MIRT051780 DDX18 DEAD (Asp-Glu-Ala-Asp) box polypeptide 18 1 1
MIRT051781 CACHD1 cache domain containing 1 1 1
MIRT051782 MBTPS1 membrane-bound transcription factor peptidase, site 1 1 1
MIRT051783 CNOT3 CCR4-NOT transcription complex, subunit 3 1 1
MIRT051784 IPO7 importin 7 1 1
MIRT051785 EYA3 eyes absent homolog 3 (Drosophila) 1 1
MIRT051786 SBDS Shwachman-Bodian-Diamond syndrome 1 1
MIRT051787 RPL3 ribosomal protein L3 1 1
MIRT051788 WDR61 WD repeat domain 61 1 1
MIRT051789 ND4 NADH dehydrogenase, subunit 4 (complex I) 1 1
MIRT051790 SIRT1 sirtuin 1 1 1
MIRT051791 RAB5B RAB5B, member RAS oncogene family 1 1
MIRT051792 CCNC cyclin C 1 1
MIRT051793 SNW1 SNW domain containing 1 1 1
MIRT051794 COPS3 COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis) 1 1
MIRT051795 FKBP10 FK506 binding protein 10, 65 kDa 1 1
MIRT051796 GSK3A glycogen synthase kinase 3 alpha 1 1
MIRT051797 PTP4A2 protein tyrosine phosphatase type IVA, member 2 1 1
MIRT051798 PSMG2 proteasome (prosome, macropain) assembly chaperone 2 1 1
MIRT051799 COX1 cytochrome c oxidase subunit I 1 1
MIRT051800 BSDC1 BSD domain containing 1 1 1
MIRT051801 ACVR1B activin A receptor, type IB 1 1
MIRT051802 RPS13 ribosomal protein S13 1 1
MIRT051803 FAM103A1 family with sequence similarity 103, member A1 1 1
MIRT051804 TAF5L TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa 1 1
MIRT051805 SLC10A3 solute carrier family 10 (sodium/bile acid cotransporter family), member 3 1 1
MIRT051806 SH3D19 SH3 domain containing 19 1 1
MIRT051807 BRD2 bromodomain containing 2 1 1
MIRT051808 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT051809 C9orf40 chromosome 9 open reading frame 40 1 1
MIRT051810 SLC35A4 solute carrier family 35, member A4 1 1
MIRT051811 ZNF581 zinc finger protein 581 1 1
MIRT051812 ANKRD17 ankyrin repeat domain 17 1 1
MIRT051813 JARID2 jumonji, AT rich interactive domain 2 1 1
MIRT051814 CBX6 chromobox homolog 6 1 1
MIRT051815 GORASP2 golgi reassembly stacking protein 2, 55kDa 1 1
MIRT051816 TMEM184B transmembrane protein 184B 1 1
MIRT051817 CHST6 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6 1 1
MIRT051818 CHD1 chromodomain helicase DNA binding protein 1 1 1
MIRT051819 SUPT16H suppressor of Ty 16 homolog (S. cerevisiae) 1 1
MIRT051820 NUPL1 nucleoporin like 1 1 1
MIRT051821 LTA4H leukotriene A4 hydrolase 1 1
MIRT051822 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT051823 PCGF3 polycomb group ring finger 3 1 4
MIRT051824 BPTF bromodomain PHD finger transcription factor 1 1
MIRT051825 ARMC8 armadillo repeat containing 8 1 1
MIRT051826 ARL6IP1 ADP-ribosylation factor-like 6 interacting protein 1 1 1
MIRT051827 LDHA lactate dehydrogenase A 1 1
MIRT051828 RAB34 RAB34, member RAS oncogene family 1 1
MIRT051829 PTGES2 prostaglandin E synthase 2 1 1
MIRT051830 LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 1 1
MIRT051831 KIF1B kinesin family member 1B 1 1
MIRT051832 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT051833 DNAJC6 DnaJ (Hsp40) homolog, subfamily C, member 6 1 1
MIRT051834 SNUPN snurportin 1 1 1
MIRT051835 SF3B4 splicing factor 3b, subunit 4, 49kDa 1 1
MIRT051836 PCF11 PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae) 1 1
MIRT051837 WDR3 WD repeat domain 3 1 1
MIRT051838 MKRN1 makorin ring finger protein 1 1 1
MIRT051839 ZNF526 zinc finger protein 526 1 1
MIRT051840 PSMB2 proteasome (prosome, macropain) subunit, beta type, 2 1 1
MIRT051841 RAPGEFL1 Rap guanine nucleotide exchange factor (GEF)-like 1 1 1
MIRT051842 DCTN5 dynactin 5 (p25) 1 1
MIRT051843 ND1 NADH dehydrogenase, subunit 1 (complex I) 1 1
MIRT051844 PPAN-P2RY11 PPAN-P2RY11 readthrough 1 1
MIRT051845 COX2 cytochrome c oxidase subunit II 1 1
MIRT051846 DOT1L DOT1-like, histone H3 methyltransferase (S. cerevisiae) 1 1
MIRT051847 AGO1 eukaryotic translation initiation factor 2C, 1 4 2
MIRT051848 TAF5 TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa 1 1
MIRT051849 FANCI Fanconi anemia, complementation group I 1 1
MIRT051850 NOTCH2 notch 2 1 1
MIRT051851 PRAF2 PRA1 domain family, member 2 1 1
MIRT051852 MEF2C myocyte enhancer factor 2C 1 1
MIRT051853 UBA52 ubiquitin A-52 residue ribosomal protein fusion product 1 1 1
MIRT051854 CSNK2A1 casein kinase 2, alpha 1 polypeptide 1 1
MIRT051855 RPS24 ribosomal protein S24 1 1
MIRT051856 GARS glycyl-tRNA synthetase 1 1
MIRT051857 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 1 1
MIRT051858 IRF2BP2 interferon regulatory factor 2 binding protein 2 1 1
MIRT051859 MESDC1 mesoderm development candidate 1 1 1
MIRT051860 BAZ1B bromodomain adjacent to zinc finger domain, 1B 1 1
MIRT051861 TRRAP transformation/transcription domain-associated protein 1 1
MIRT051862 GTF3C1 general transcription factor IIIC, polypeptide 1, alpha 220kDa 1 1
MIRT051863 FUT10 fucosyltransferase 10 (alpha (1,3) fucosyltransferase) 1 2
MIRT051864 MYO9A myosin IXA 1 1
MIRT051865 SLC12A2 solute carrier family 12 (sodium/potassium/chloride transporters), member 2 1 1
MIRT051866 CCNB2 cyclin B2 1 1
MIRT051867 PTK2 PTK2 protein tyrosine kinase 2 1 1
MIRT051868 AIDA axin interactor, dorsalization associated 1 1
MIRT051869 WBP11 WW domain binding protein 11 1 1
MIRT051870 RALGAPA2 Ral GTPase activating protein, alpha subunit 2 (catalytic) 1 1
MIRT051871 FLNB filamin B, beta 1 1
MIRT051872 QKI QKI, KH domain containing, RNA binding 1 1
MIRT051873 FZD8 frizzled family receptor 8 1 1
MIRT051874 CCNG1 cyclin G1 1 1
MIRT051875 NPTX1 neuronal pentraxin I 1 1
MIRT051876 DHX9 DEAH (Asp-Glu-Ala-His) box polypeptide 9 1 1
MIRT053087 IGF1R insulin-like growth factor 1 receptor 4 5
MIRT054066 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 3 1
MIRT054069 MAP4K3 mitogen-activated protein kinase kinase kinase kinase 3 3 1
MIRT054365 IL10 interleukin 10 2 1
MIRT063193 ADIPOR2 adiponectin receptor 2 1 1
MIRT065686 ESPL1 extra spindle pole bodies homolog 1 (S. cerevisiae) 1 2
MIRT067398 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT068152 TXLNA taxilin alpha 1 1
MIRT068527 NHLRC3 NHL repeat containing 3 1 3
MIRT068787 FNDC3A fibronectin type III domain containing 3A 1 1
MIRT073004 ARID3B AT rich interactive domain 3B (BRIGHT-like) 1 3
MIRT076221 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 1 3
MIRT077615 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 1 1
MIRT080397 ONECUT2 one cut homeobox 2 1 1
MIRT083298 ZCCHC3 zinc finger, CCHC domain containing 3 1 1
MIRT084974 BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 1 1
MIRT094458 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 1 2
MIRT095764 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 5
MIRT100093 ABT1 activator of basal transcription 1 1 4
MIRT112240 MDM4 Mdm4 p53 binding protein homolog (mouse) 1 2
MIRT118584 STK4 serine/threonine kinase 4 1 1
MIRT120919 PDE12 phosphodiesterase 12 1 4
MIRT123315 CALU calumenin 1 1
MIRT123974 POLR3D polymerase (RNA) III (DNA directed) polypeptide D, 44kDa 1 1
MIRT152270 TNFSF9 tumor necrosis factor (ligand) superfamily, member 9 1 1
MIRT153845 NCOA3 nuclear receptor coactivator 3 1 1
MIRT168581 HMGA1 high mobility group AT-hook 1 1 2
MIRT180601 CRY2 cryptochrome 2 (photolyase-like) 1 1
MIRT187715 SUOX sulfite oxidase 1 1
MIRT191402 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 1 1
MIRT193099 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT215718 C5ORF51 chromosome 5 open reading frame 51 1 5
MIRT218813 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 1
MIRT225969 E2F5 E2F transcription factor 5, p130-binding 0 1
MIRT240328 UBXN2B UBX domain protein 2B 1 1
MIRT244067 EDN1 endothelin 1 1 1
MIRT252328 SALL3 sal-like 3 (Drosophila) 1 1
MIRT255312 CDV3 CDV3 homolog (mouse) 1 1
MIRT259275 PGRMC1 progesterone receptor membrane component 1 1 1
MIRT259477 TXLNG taxilin gamma 1 1
MIRT260705 CLDN12 claudin 12 1 3
MIRT261876 BCCIP BRCA2 and CDKN1A interacting protein 0 1
MIRT264692 C11ORF57 chromosome 11 open reading frame 57 1 2
MIRT266210 PEX11B peroxisomal biogenesis factor 11 beta 1 1
MIRT266624 CHTOP chromatin target of PRMT1 1 1
MIRT268837 C1ORF21 chromosome 1 open reading frame 21 1 1
MIRT284526 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT294444 ZNF264 zinc finger protein 264 1 1
MIRT297011 RRM2 ribonucleotide reductase M2 1 1
MIRT297442 SLC20A1 solute carrier family 20 (phosphate transporter), member 1 1 2
MIRT300035 BZW1 basic leucine zipper and W2 domains 1 1 2
MIRT300891 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT303318 MXD1 MAX dimerization protein 1 1 1
MIRT309844 NAT8L N-acetyltransferase 8-like (GCN5-related, putative) 1 1
MIRT322426 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 1
MIRT324729 ACER2 alkaline ceramidase 2 1 1
MIRT402055 ATP6V1F ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F 1 2
MIRT437347 MTOR mechanistic target of rapamycin (serine/threonine kinase) 1 1
MIRT437348 RICTOR RPTOR independent companion of MTOR, complex 2 1 1
MIRT437806 CEBPB CCAAT/enhancer binding protein (C/EBP), beta 1 1
MIRT438050 IL6 interleukin 6 (interferon, beta 2) 2 1
MIRT438622 PBX2 pre-B-cell leukemia homeobox 2 3 1
MIRT438634 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 2 1
MIRT438664 TRIB2 tribbles homolog 2 (Drosophila) 3 1
MIRT439138 XBP1 X-box binding protein 1 0 1
MIRT439139 USF2 upstream transcription factor 2, c-fos interacting 0 1
MIRT439140 TTF1 transcription termination factor, RNA polymerase I 0 1
MIRT439141 STAT2 signal transducer and activator of transcription 2, 113kDa 1 2
MIRT439142 SREBF1 sterol regulatory element binding transcription factor 1 0 1
MIRT439143 SMAD6 SMAD family member 6 0 1
MIRT439144 SPDEF SAM pointed domain containing ets transcription factor 0 1
MIRT439145 SETDB1 SET domain, bifurcated 1 0 1
MIRT439146 RNF7 ring finger protein 7 0 1
MIRT439147 RHOV ras homolog family member V 0 1
MIRT439148 RFX6 regulatory factor X, 6 0 1
MIRT439149 RHOB ras homolog family member B 0 1
MIRT439150 RARB retinoic acid receptor, beta 0 1
MIRT439151 PBX3 pre-B-cell leukemia homeobox 3 0 1
MIRT439152 OLFM4 olfactomedin 4 0 1
MIRT439153 MYCL1 v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived (avian) 0 1
MIRT439154 NRM nurim (nuclear envelope membrane protein) 0 1
MIRT439155 MICB MHC class I polypeptide-related sequence B 0 1
MIRT439156 MAF1 MAF1 homolog (S. cerevisiae) 0 1
MIRT439157 ID1 inhibitor of DNA binding 1, dominant negative helix-loop-helix protein 0 1
MIRT439158 HOXD1 homeobox D1 0 1
MIRT439159 HSF1 heat shock transcription factor 1 0 1
MIRT439160 HHAT hedgehog acyltransferase 0 1
MIRT439161 HES5 hairy and enhancer of split 5 (Drosophila) 0 1
MIRT439162 EZH2 enhancer of zeste homolog 2 (Drosophila) 0 1
MIRT439163 ETNK2 ethanolamine kinase 2 0 1
MIRT439164 EN2 engrailed homeobox 2 0 1
MIRT439165 DNMT1 DNA (cytosine-5-)-methyltransferase 1 0 1
MIRT439166 DLX4 distal-less homeobox 4 0 1
MIRT439167 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 0 1
MIRT439168 CNNM2 cyclin M2 0 1
MIRT439169 CREM cAMP responsive element modulator 0 1
MIRT439170 BHLHB9 basic helix-loop-helix domain containing, class B, 9 0 1
MIRT439171 ARID3A AT rich interactive domain 3A (BRIGHT-like) 1 2
MIRT442022 NDUFA4P1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa, pseudogene 1 1 1
MIRT445660 ATP6V1G1 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 1 3
MIRT447138 KIF27 kinesin family member 27 1 1
MIRT448257 ZNF774 zinc finger protein 774 1 1
MIRT449007 ANKRD46 ankyrin repeat domain 46 1 1
MIRT449955 FMNL3 formin-like 3 1 1
MIRT451157 C19orf53 chromosome 19 open reading frame 53 1 1
MIRT451626 MEIS3P1 Meis homeobox 3 pseudogene 1 1 1
MIRT451695 C1RL complement component 1, r subcomponent-like 1 1
MIRT452094 NUCB2 nucleobindin 2 1 1
MIRT452433 QDPR quinoid dihydropteridine reductase 1 1
MIRT452945 DISC1 disrupted in schizophrenia 1 1 1
MIRT453403 RHD Rh blood group, D antigen 1 3
MIRT454166 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT454282 FXN frataxin 1 1
MIRT454542 RABL2A RAB, member of RAS oncogene family-like 2A 1 1
MIRT454856 ACOT9 acyl-CoA thioesterase 9 1 2
MIRT455678 GLO1 glyoxalase I 1 1
MIRT457250 RABL2B RAB, member of RAS oncogene family-like 2B 1 1
MIRT457679 ZNF587 zinc finger protein 587 1 1
MIRT457889 THEM6 thioesterase superfamily member 6 1 2
MIRT458018 MRPL12 mitochondrial ribosomal protein L12 1 1
MIRT459738 RRM1 ribonucleotide reductase M1 1 1
MIRT460455 NOM1 nucleolar protein with MIF4G domain 1 1 2
MIRT460502 FAM105A family with sequence similarity 105, member A 1 3
MIRT460940 NOA1 nitric oxide associated 1 1 2
MIRT461094 OPA3 optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) 1 1
MIRT461170 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 2
MIRT461366 COL8A1 collagen, type VIII, alpha 1 1 1
MIRT462384 YAE1D1 Yae1 domain containing 1 1 1
MIRT462782 ZNF8 zinc finger protein 8 1 1
MIRT463421 ZC3HAV1L zinc finger CCCH-type, antiviral 1-like 1 1
MIRT463664 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT464267 VCL vinculin 1 1
MIRT465124 TSC22D2 TSC22 domain family, member 2 1 2
MIRT466188 TMED5 transmembrane emp24 protein transport domain containing 5 1 2
MIRT466726 SYNJ2BP synaptojanin 2 binding protein 1 1
MIRT469104 RNF144B ring finger protein 144B 1 1
MIRT469712 RAB40C RAB40C, member RAS oncogene family 1 1
MIRT470419 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT470678 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 1 2
MIRT470859 PLXND1 plexin D1 1 1
MIRT471277 PGM2L1 phosphoglucomutase 2-like 1 1 1
MIRT471959 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 1
MIRT472670 NAA20 N(alpha)-acetyltransferase 20, NatB catalytic subunit 1 1
MIRT472736 MTUS1 microtubule associated tumor suppressor 1 1 3
MIRT473137 MLLT10 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 1 1
MIRT473241 SMCR7L Smith-Magenis syndrome chromosome region, candidate 7-like 1 4
MIRT473830 MAP2K7 mitogen-activated protein kinase kinase 7 1 1
MIRT473942 LYN v-yes-1 Yamaguchi sarcoma viral related oncogene homolog 1 1
MIRT474023 LRRC20 leucine rich repeat containing 20 1 1
MIRT474500 KLHDC8B kelch domain containing 8B 1 1
MIRT474767 KIAA0930 KIAA0930 1 1
MIRT474907 KCTD21 potassium channel tetramerisation domain containing 21 1 1
MIRT475333 IFNLR1 interleukin 28 receptor, alpha (interferon, lambda receptor) 1 1
MIRT475381 ICOSLG inducible T-cell co-stimulator ligand 1 1
MIRT475735 HERPUD1 homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 1 2
MIRT476550 GABPB1 GA binding protein transcription factor, beta subunit 1 1 2
MIRT476976 FAM83G family with sequence similarity 83, member G 1 2
MIRT477535 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 2
MIRT477677 EFHD2 EF-hand domain family, member D2 1 1
MIRT479747 CCND1 cyclin D1 1 1
MIRT481193 ATXN7L3B ataxin 7-like 3B 1 2
MIRT481237 ATXN7L3 ataxin 7-like 3 1 1
MIRT481365 ATG9A autophagy related 9A 1 1
MIRT481390 ATG12 autophagy related 12 1 1
MIRT481654 AREL1 KIAA0317 1 1
MIRT481852 AP1S1 adaptor-related protein complex 1, sigma 1 subunit 1 1
MIRT482186 AHR aryl hydrocarbon receptor 1 1
MIRT482222 AHCYL2 adenosylhomocysteinase-like 2 1 1
MIRT485299 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT486661 ZNF28 zinc finger protein 28 1 1
MIRT489415 TUBB2A tubulin, beta 2A class IIa 1 1
MIRT491864 ZBTB5 zinc finger and BTB domain containing 5 1 4
MIRT492218 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT492631 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT493321 LIMD2 LIM domain containing 2 1 1
MIRT493903 FAM43A family with sequence similarity 43, member A 1 2
MIRT494264 CEP120 centrosomal protein 120kDa 1 1
MIRT495970 TBC1D19 TBC1 domain family, member 19 1 1
MIRT496114 SNX17 sorting nexin 17 1 1
MIRT497877 SLC12A7 solute carrier family 12 (potassium/chloride transporters), member 7 1 1
MIRT498124 PLEKHO1 pleckstrin homology domain containing, family O member 1 1 2
MIRT499407 PLCG2 phospholipase C, gamma 2 (phosphatidylinositol-specific) 1 2
MIRT499495 GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT499655 SDR42E1 short chain dehydrogenase/reductase family 42E, member 1 1 1
MIRT499944 MFSD8 major facilitator superfamily domain containing 8 1 1
MIRT499999 HIST1H2BD histone cluster 1, H2bd 1 2
MIRT500817 THBS1 thrombospondin 1 1 1
MIRT500898 STRN striatin, calmodulin binding protein 1 2
MIRT501119 SLC5A6 solute carrier family 5 (sodium-dependent vitamin transporter), member 6 1 2
MIRT501172 SLC10A7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 3
MIRT501210 SUMO1 SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) 1 1
MIRT501248 SEMA4C sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C 1 3
MIRT501326 RNFT1 ring finger protein, transmembrane 1 1 1
MIRT501351 RNF44 ring finger protein 44 1 2
MIRT501389 RBFOX2 RNA binding protein, fox-1 homolog (C. elegans) 2 1 5
MIRT501444 RAB11FIP4 RAB11 family interacting protein 4 (class II) 1 1
MIRT501757 NSD1 nuclear receptor binding SET domain protein 1 1 1
MIRT501946 MBD2 methyl-CpG binding domain protein 2 1 4
MIRT502100 KPNA5 karyopherin alpha 5 (importin alpha 6) 1 4
MIRT502122 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 2
MIRT502789 CEP135 centrosomal protein 135kDa 1 1
MIRT502847 CELF1 CUGBP, Elav-like family member 1 1 1
MIRT504790 C12orf4 chromosome 12 open reading frame 4 1 1
MIRT505018 ZNF644 zinc finger protein 644 1 1
MIRT505576 SMC1A structural maintenance of chromosomes 1A 1 3
MIRT506361 NUP155 nucleoporin 155kDa 1 3
MIRT506941 IGDCC4 immunoglobulin superfamily, DCC subclass, member 4 1 3
MIRT507245 FIGN fidgetin 1 4
MIRT507688 COIL coilin 1 3
MIRT508403 C1orf210 chromosome 1 open reading frame 210 1 3
MIRT508667 DIABLO diablo, IAP-binding mitochondrial protein 1 2
MIRT508934 AK4 adenylate kinase 4 1 2
MIRT510391 ZNF566 zinc finger protein 566 1 3
MIRT510516 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 3
MIRT511388 IKZF3 IKAROS family zinc finger 3 (Aiolos) 1 2
MIRT512746 CD59 CD59 molecule, complement regulatory protein 1 2
MIRT515956 C9orf156 chromosome 9 open reading frame 156 1 1
MIRT516085 ZBTB8OS zinc finger and BTB domain containing 8 opposite strand 1 2
MIRT521391 RDX radixin 1 2
MIRT522350 NCKIPSD NCK interacting protein with SH3 domain 1 2
MIRT523625 FZD9 frizzled family receptor 9 1 2
MIRT523735 FBXW2 F-box and WD repeat domain containing 2 1 2
MIRT523987 DVL3 dishevelled, dsh homolog 3 (Drosophila) 1 1
MIRT524118 DNA2 DNA replication helicase 2 homolog (yeast) 1 1
MIRT525729 SOD2 superoxide dismutase 2, mitochondrial 1 1
MIRT527765 RRAD Ras-related associated with diabetes 1 1
MIRT529729 OPRL1 opiate receptor-like 1 1 1
MIRT533188 WASL Wiskott-Aldrich syndrome-like 1 3
MIRT536380 LEFTY1 left-right determination factor 1 1 1
MIRT543787 RBM12B RNA binding motif protein 12B 1 2
MIRT543870 SLC16A9 solute carrier family 16, member 9 (monocarboxylic acid transporter 9) 1 1
MIRT545389 PM20D2 peptidase M20 domain containing 2 1 1
MIRT545887 ZNF200 zinc finger protein 200 1 2
MIRT546326 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT547370 MSI2 musashi homolog 2 (Drosophila) 1 1
MIRT547572 LRIG3 leucine-rich repeats and immunoglobulin-like domains 3 1 2
MIRT547836 IGF2BP3 insulin-like growth factor 2 mRNA binding protein 3 1 2
MIRT548267 FBXL20 F-box and leucine-rich repeat protein 20 1 1
MIRT548344 EPHA4 EPH receptor A4 1 1
MIRT548536 DUSP1 dual specificity phosphatase 1 1 1
MIRT548555 DNAL1 dynein, axonemal, light chain 1 1 1
MIRT548782 COLEC12 collectin sub-family member 12 1 1
MIRT548971 CCNT2 cyclin T2 1 1
MIRT549021 CBX5 chromobox homolog 5 1 1
MIRT549206 BEND4 BEN domain containing 4 1 2
MIRT549765 ZNF611 zinc finger protein 611 1 3
MIRT549801 KIAA0391 KIAA0391 1 1
MIRT549849 ECHDC1 enoyl CoA hydratase domain containing 1 1 1
MIRT550728 PMPCA peptidase (mitochondrial processing) alpha 1 2
MIRT550900 ACTA1 actin, alpha 1, skeletal muscle 1 1
MIRT551285 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 1 3
MIRT551320 GSG2 germ cell associated 2 (haspin) 1 3
MIRT551933 AKAP8 A kinase (PRKA) anchor protein 8 1 2
MIRT552005 RAD18 RAD18 homolog (S. cerevisiae) 1 1
MIRT552412 ZNF460 zinc finger protein 460 1 2
MIRT553019 USP38 ubiquitin specific peptidase 38 1 1
MIRT555541 PLEKHA3 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3 1 1
MIRT555718 PDZD8 PDZ domain containing 8 1 1
MIRT557375 HAND1 heart and neural crest derivatives expressed 1 1 1
MIRT557962 FAM222B family with sequence similarity 222, member B 1 1
MIRT559089 C19orf47 chromosome 19 open reading frame 47 1 2
MIRT559499 ARIH1 ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) 1 1
MIRT561770 PEG10 paternally expressed 10 1 1
MIRT564404 EMILIN2 elastin microfibril interfacer 2 1 2
MIRT565451 SURF4 surfeit 4 1 1
MIRT566520 PARP16 poly (ADP-ribose) polymerase family, member 16 1 1
MIRT567431 GNG5 guanine nucleotide binding protein (G protein), gamma 5 1 1
MIRT567719 E2F6 E2F transcription factor 6 1 1
MIRT568656 ABHD17C family with sequence similarity 108, member C1 1 1
MIRT569500 THYN1 thymocyte nuclear protein 1 1 1
MIRT573822 TGOLN2 trans-golgi network protein 2 1 1
MIRT574365 ZBTB37 zinc finger and BTB domain containing 37 1 1
MIRT574748 GOLGA4 golgin A4 1 1
MIRT574789 FAM104A family with sequence similarity 104, member A 1 1
MIRT576087 Poteg POTE ankyrin domain family, member G 1 1
MIRT576810 Thbs1 thrombospondin 1 1 1
MIRT616372 RWDD1 RWD domain containing 1 1 1
MIRT617853 FMO4 flavin containing monooxygenase 4 1 1
MIRT642396 ZNF556 zinc finger protein 556 1 1
MIRT680521 PRIM2 primase, DNA, polypeptide 2 (58kDa) 1 1
MIRT680549 ZNF584 zinc finger protein 584 1 1
MIRT680802 ZNF578 zinc finger protein 578 1 1
MIRT680840 ARL8B ADP-ribosylation factor-like 8B 1 1
MIRT681143 INTS7 integrator complex subunit 7 1 1
MIRT681273 RFC2 replication factor C (activator 1) 2, 40kDa 1 1
MIRT681325 ZFAND4 zinc finger, AN1-type domain 4 1 2
MIRT681361 BRI3BP BRI3 binding protein 1 1
MIRT681538 ZNF738 zinc finger protein 738 1 1
MIRT681660 DTX3L deltex 3-like (Drosophila) 1 1
MIRT681740 RAB19 RAB19, member RAS oncogene family 1 2
MIRT681762 CDKAL1 CDK5 regulatory subunit associated protein 1-like 1 1 1
MIRT681799 EIF4A3 eukaryotic translation initiation factor 4A3 1 1
MIRT681871 DNAH9 dynein, axonemal, heavy chain 9 1 1
MIRT681943 SLC19A3 solute carrier family 19, member 3 1 1
MIRT682104 ITGA3 integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) 1 2
MIRT682183 SLC38A7 solute carrier family 38, member 7 1 1
MIRT682240 SAR1A SAR1 homolog A (S. cerevisiae) 1 1
MIRT682386 PHACTR4 phosphatase and actin regulator 4 1 1
MIRT682446 MTX3 metaxin 3 1 1
MIRT682608 CPA4 carboxypeptidase A4 1 1
MIRT682642 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT689329 FPR1 formyl peptide receptor 1 1 1
MIRT689732 ATXN2 ataxin 2 1 1
MIRT691038 ZNF799 zinc finger protein 799 1 1
MIRT691937 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 1
MIRT694886 ZNF417 zinc finger protein 417 1 1
MIRT695257 ZNF443 zinc finger protein 443 1 1
MIRT695415 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 1 1
MIRT700585 PRSS22 protease, serine, 22 1 1
MIRT701429 NHLRC2 NHL repeat containing 2 1 1
MIRT702486 KIAA1328 KIAA1328 1 1
MIRT702713 IPO9 importin 9 1 1
MIRT704029 EDEM3 ER degradation enhancer, mannosidase alpha-like 3 1 1
MIRT704419 CTPS1 CTP synthase 1 1 1
MIRT705752 AMD1 adenosylmethionine decarboxylase 1 1 1
MIRT712371 NAP1L1 nucleosome assembly protein 1-like 1 1 1
MIRT713522 PAFAH2 platelet-activating factor acetylhydrolase 2, 40kDa 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*