Accession ID: MIRT051992 [miRNA, hsa-let-7b-5p :: EPB41L3, target gene]
pre-miRNA Information
pre-miRNA ID hsa-let-7bLinkOut: [miRBase ]
Synonyms LET7B, MIRNLET7B, hsa-let-7b, let-7b, MIRLET7B
Description Homo sapiens let-7b stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-let-7b-5p
Mature Sequence 6| UGAGGUAGUAGGUUGUGUGGUU |27
Evidence Experimental
Experiments Cloned
Putative hsa-let-7b-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol EPB41L3 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms 4.1B, DAL-1, DAL1, FLJ37633, KIAA0987
Description erythrocyte membrane protein band 4.1-like 3
Transcript NM_0123    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on EPB41L3 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of EPB41L3
(miRNA target sites are highlighted)
>EPB41L3|NM_0123|3'UTR
   1 CCAGAAGATGGAGAGGATTGACCAGAGGAATAACTTAGCTTGCACATGAATGCAGTCATGCAAACCGTTAGGAAAACCAG
  81 AGCCTATATGGAGTTCCCTCTTCTAACCCAACTGACTTGTATCTGTCCGTGGAAAATTTCAGTCCAGAAGAATTGACCTT
 161 GACCATTAATAAAGACACTGGCAGAGAGATCTTCCCATAATAAAGCAATCTGATTCAGCATCACTAAACCGATAATGCAT
 241 GAAGCAACGATAAAATTACAAAAGAGCAGCATTTTTAATTTTCACAAAATGTCTCAGTTTTCAGCTATACCTGCACGTTC
 321 ATAACCAACAATATAAACCGTGGTCTCATGTAACACATAAACAATTCATGCCTTTCATAGTTTATTATTATTAAAGTCTA
 401 AACAAAATTGCAATTTCTTAGGTAACCTTATATTTACAATAAATGAAGATTACCCTCAAATGCTAGAAGCTGTCTAGGTC
 481 CGTCCGGTGTGTCAGATTTTCCTCAGATTAGATGTGCCAATAACCAAGTTTATTCAGTAAACAACTTGTACTTGTTTCAT
 561 CTGGTTTTATTACTCTCACCCATAAACAGTAATGACTCTCTGACCCTCTGGAAATATGTAATGCTTCCAATCTTGCTTTG
 641 TGTATCTCATTTAATTTGTTATAAGGTAGTACTGATTTTAGCATATTAATGCGATTTCTTCCTTGTTGTTTGCTTTGGTC
 721 TGTGTTCAATCCAGAGAGCTTAAATTGTCATTATTTTGGGAAGAAAACCTGTATTTTTGTTAGTTTACAATATTATGAAA
 801 TTTCACTTCAGGAGAAACTGCTGGGCTTCCTGTGGCTTTGTTTTCTTAGTTACTTTTTCCGTGCCGTGTATTTTTTAATT
 881 GATTTTTCTTCTTTTACTTGAAAAGAAAGTGTTTTATTTTCAAATCTGGTCCATATTTACATTCTAGTTCAGAGCCAAGC
 961 CTTAAACTGTACAGAATTTCCACTGTAATTAAAACTATTTAGTGTTAGTTATAAATAGCCTTCAAAAAGAGAGATTCTCC
1041 ATTACACGATCACCTGCATCACAGCCCATGGTGAATGTATGTTTCTGCATAGCGAAATAAAAATGGCAAATGCACTG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uuGGUGUGUUGGAUGAUGGAGu 5'
            ::||||:|:|  ||:| || 
Target 5' caTTACACGATCACCTGCATCa 3'
1040 - 1061 120.00 -16.90
2
miRNA  3' uuGGUGU-GUUGGAUGAUGGAGu 5'
            |||:| : || | ||| :|| 
Target 5' gtCCATATTTACATTCTAGTTCa 3'
929 - 951 112.00 -13.60
3
miRNA  3' uuggUGUGUUGGAUGAUGGAGu 5'
              |::|:|::| || |||: 
Target 5' attaATGCGATTT-CTTCCTTg 3'
685 - 705 109.00 -7.50
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-let-7b-5p :: EPB41L3    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' ttGGTGTG---TTGGATGATGGAgt 5'
            ||| ||   : || ||||:||  
Target 5' caCCAGACCCTGCCCAACTATCTga 3'
4 - 28
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
944 hsa-let-7b-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000411 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 1 1
MIRT001229 CDC34 cell division cycle 34 homolog (S. cerevisiae) 5 3
MIRT001576 SLC38A1 solute carrier family 38, member 1 1 1
MIRT001578 COIL coilin 1 1
MIRT001579 VPS39 vacuolar protein sorting 39 homolog (S. cerevisiae) 2 1
MIRT001580 UHRF1 ubiquitin-like with PHD and ring finger domains 1 2 1
MIRT001581 UGT8 UDP glycosyltransferase 8 2 1
MIRT001582 TYMS thymidylate synthetase 2 1
MIRT001583 TTC9C tetratricopeptide repeat domain 9C 2 1
MIRT001584 TRMT1 TRM1 tRNA methyltransferase 1 homolog (S. cerevisiae) 2 1
MIRT001585 TMEM2 transmembrane protein 2 2 1
MIRT001586 THBS1 thrombospondin 1 2 1
MIRT001587 TAF9B TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa 2 1
MIRT001588 SPRYD4 SPRY domain containing 4 2 1
MIRT001589 SPCS3 signal peptidase complex subunit 3 homolog (S. cerevisiae) 2 1
MIRT001590 SNAP23 synaptosomal-associated protein, 23kDa 2 1
MIRT001591 SLC25A32 solute carrier family 25, member 32 2 1
MIRT001592 SLC25A24 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 24 2 1
MIRT001593 SLC25A1 solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 1 1
MIRT001594 SLC25A13 solute carrier family 25, member 13 (citrin) 3 2
MIRT001595 SLC1A4 solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 2 1
MIRT001596 SCYL1 SCY1-like 1 (S. cerevisiae) 2 1
MIRT001597 RPP38 ribonuclease P/MRP 38kDa subunit 2 1
MIRT001598 RHOG ras homolog gene family, member G (rho G) 2 1
MIRT001599 RHOB ras homolog gene family, member B 2 1
MIRT001600 RDH10 retinol dehydrogenase 10 (all-trans) 3 1
MIRT001601 RBM19 RNA binding motif protein 19 2 1
MIRT001602 PXDN peroxidasin homolog (Drosophila) 2 1
MIRT001603 PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 2 1
MIRT001604 PRIM1 primase, DNA, polypeptide 1 (49kDa) 2 1
MIRT001605 PPP1R7 protein phosphatase 1, regulatory (inhibitor) subunit 7 2 1
MIRT001606 POM121 POM121 membrane glycoprotein (rat) 3 2
MIRT001607 POLR2C polymerase (RNA) II (DNA directed) polypeptide C, 33kDa 2 1
MIRT001608 POLD2 polymerase (DNA directed), delta 2, regulatory subunit 50kDa 2 1
MIRT001609 PGRMC1 progesterone receptor membrane component 1 2 1
MIRT001611 NXN nucleoredoxin 2 1
MIRT001612 NEDD4 neural precursor cell expressed, developmentally down-regulated 4 2 1
MIRT001613 MTRR 5-methyltetrahydrofolate-homocysteine methyltransferase reductase 2 1
MIRT001614 MRPS33 mitochondrial ribosomal protein S33 2 1
MIRT001615 MRPS24 mitochondrial ribosomal protein S24 2 1
MIRT001616 MRM1 mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae) 2 1
MIRT001617 MLLT1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 2 1
MIRT001618 MARS2 methionyl-tRNA synthetase 2, mitochondrial 1 1
MIRT001620 IPO4 importin 4 3 2
MIRT001621 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 4 2
MIRT001622 F2 coagulation factor II (thrombin) 1 1
MIRT001623 IFRD1 interferon-related developmental regulator 1 2 1
MIRT001624 IFIT5 interferon-induced protein with tetratricopeptide repeats 5 2 1
MIRT001625 HMGA1 high mobility group AT-hook 1 3 2
MIRT001626 GYS1 glycogen synthase 1 (muscle) 2 1
MIRT001627 GTPBP3 GTP binding protein 3 (mitochondrial) 2 1
MIRT001628 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 3 2
MIRT001629 GPR56 G protein-coupled receptor 56 2 1
MIRT001630 GEMIN7 gem (nuclear organelle) associated protein 7 2 1
MIRT001631 FNDC3A fibronectin type III domain containing 3A 2 1
MIRT001632 FAM96A family with sequence similarity 96, member A 2 1
MIRT001633 FAM105A family with sequence similarity 105, member A 2 1
MIRT001634 FADS2 fatty acid desaturase 2 3 2
MIRT001635 DUSP23 dual specificity phosphatase 23 2 1
MIRT001636 DUSP12 dual specificity phosphatase 12 2 1
MIRT001637 DSP desmoplakin 3 2
MIRT001638 DOCK5 dedicator of cytokinesis 5 2 1
MIRT001639 DHX57 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 3 2
MIRT001640 CSNK1D casein kinase 1, delta 2 1
MIRT001641 COMMD9 COMM domain containing 9 2 1
MIRT001642 CHMP2A chromatin modifying protein 2A 2 1
MIRT001643 CDKAL1 CDK5 regulatory subunit associated protein 1-like 1 2 1
MIRT001644 CDIPT CDP-diacylglycerol--inositol 3-phosphatidyltransferase 2 1
MIRT001645 CARHSP1 calcium regulated heat stable protein 1, 24kDa 2 1
MIRT001646 CAPG capping protein (actin filament), gelsolin-like 2 1
MIRT001647 CALCOCO2 calcium binding and coiled-coil domain 2 2 1
MIRT001649 AURKB aurora kinase B 2 1
MIRT001650 ATP6V1F ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F 2 1
MIRT001651 ATP6V0A1 ATPase, H+ transporting, lysosomal V0 subunit a1 2 1
MIRT001652 ATAD3B ATPase family, AAA domain containing 3B 2 1
MIRT001653 ANAPC1 anaphase promoting complex subunit 1 2 1
MIRT001654 AKAP8 A kinase (PRKA) anchor protein 8 2 1
MIRT001655 AARSD1 alanyl-tRNA synthetase domain containing 1 2 1
MIRT001850 MTPN myotrophin 1 1
MIRT001851 RPIA ribose 5-phosphate isomerase A 2 1
MIRT001852 ACTG1 actin, gamma 1 3 2
MIRT002082 HMGA2 high mobility group AT-hook 2 3 2
MIRT002296 CDC25A cell division cycle 25 homolog A (S. pombe) 5 3
MIRT002297 CDK6 cyclin-dependent kinase 6 4 1
MIRT002399 BCL7A B-cell CLL/lymphoma 7A 3 1
MIRT002484 CCND1 cyclin D1 4 2
MIRT003833 E2F5 E2F transcription factor 5, p130-binding 2 1
MIRT003834 LIN28B lin-28 homolog B (C. elegans) 3 2
MIRT003835 CCND2 cyclin D2 3 2
MIRT003836 NRAS neuroblastoma RAS viral (v-ras) oncogene homolog 3 3
MIRT003999 CCNA2 cyclin A2 3 1
MIRT004011 LIN28A lin-28 homolog A (C. elegans) 2 1
MIRT004614 IFNB1 interferon, beta 1, fibroblast 3 1
MIRT004618 NR2E1 nuclear receptor subfamily 2, group E, member 1 3 1
MIRT004750 Nras neuroblastoma ras oncogene 1 1
MIRT004751 Cdc25a cell division cycle 25 homolog A (S. pombe) 1 1
MIRT004952 SCAMP3 secretory carrier membrane protein 3 2 1
MIRT004954 HNRPDL heterogeneous nuclear ribonucleoprotein D-like 2 1
MIRT004955 PDGFRA platelet-derived growth factor receptor, alpha polypeptide 2 1
MIRT004956 BIRC6 baculoviral IAP repeat-containing 6 2 1
MIRT005036 CCNJ cyclin J 2 1
MIRT005037 EIF2C3 eukaryotic translation initiation factor 2C, 3 2 1
MIRT005038 PLAGL2 pleiomorphic adenoma gene-like 2 2 1
MIRT005039 PDE12 phosphodiesterase 12 2 2
MIRT005040 DZIP1 DAZ interacting protein 1 2 1
MIRT005041 SIGMAR1 sigma non-opioid intracellular receptor 1 3 2
MIRT005042 DLC1 deleted in liver cancer 1 2 1
MIRT005043 NXT2 nuclear transport factor 2-like export factor 2 2 1
MIRT005044 E2F6 E2F transcription factor 6 2 1
MIRT005045 GPX7 glutathione peroxidase 7 2 1
MIRT005046 SSR1 signal sequence receptor, alpha 1 1
MIRT005047 YAP1 Yes-associated protein 1 2 1
MIRT005048 GZF1 GDNF-inducible zinc finger protein 1 2 1
MIRT005049 SOX9 SRY (sex determining region Y)-box 9 2 1
MIRT005050 RRM2 ribonucleotide reductase M2 2 2
MIRT005051 AURKA aurora kinase A 2 2
MIRT005052 FARP1 FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived) 2 1
MIRT005053 CPED1 chromosome 7 open reading frame 58 2 1
MIRT005054 CBFB core-binding factor, beta subunit 2 1
MIRT005055 RCAN1 regulator of calcineurin 1 2 1
MIRT005056 CDCA7 cell division cycle associated 7 2 1
MIRT005057 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 3 2
MIRT005058 GTF2I general transcription factor IIi 2 1
MIRT005059 ARID3A AT rich interactive domain 3A (BRIGHT-like) 2 1
MIRT005060 DMD dystrophin 2 1
MIRT005061 CCNF cyclin F 3 2
MIRT005218 CIAO1 cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae) 2 1
MIRT005219 NCAPG2 non-SMC condensin II complex, subunit G2 2 1
MIRT005220 CCBL2 cysteine conjugate-beta lyase 2 2 1
MIRT005221 DCTPP1 dCTP pyrophosphatase 1 2 1
MIRT005222 EDEM3 ER degradation enhancer, mannosidase alpha-like 3 2 1
MIRT005223 CHPF2 chondroitin polymerizing factor 2 2 1
MIRT005224 CCDC115 coiled-coil domain containing 115 2 1
MIRT005225 ALG3 asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae) 2 1
MIRT005226 ARL15 ADP-ribosylation factor-like 15 2 1
MIRT005227 MAP7D1 MAP7 domain containing 1 2 1
MIRT005228 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 2 1
MIRT005229 NUDT19 nudix (nucleoside diphosphate linked moiety X)-type motif 19 2 1
MIRT005230 C20orf72 chromosome 20 open reading frame 72 2 1
MIRT005231 RRP1B ribosomal RNA processing 1 homolog B (S. cerevisiae) 2 1
MIRT005232 GGCT gamma-glutamylcyclotransferase 2 1
MIRT005233 MMS22L chromosome 6 open reading frame 167 2 1
MIRT005234 PRRC2A HLA-B associated transcript 2 3 2
MIRT005235 C1orf27 chromosome 1 open reading frame 27 2 1
MIRT005236 GDE1 glycerophosphodiester phosphodiesterase 1 2 1
MIRT005238 ERC1 ELKS/RAB6-interacting/CAST family member 1 2 1
MIRT005239 NAA40 N(alpha)-acetyltransferase 40, NatD catalytic subunit, homolog (S. cerevisiae) 2 1
MIRT005240 TRABD TraB domain containing 3 2
MIRT005241 IGF2BP2 insulin-like growth factor 2 mRNA binding protein 2 2 1
MIRT005242 RRP8 ribosomal RNA processing 8, methyltransferase, homolog (yeast) 2 1
MIRT005243 C2orf18 chromosome 2 open reading frame 18 2 1
MIRT005322 DICER1 dicer 1, ribonuclease type III 1 1
MIRT005436 FAM203A chromosome 8 open reading frame 30A 2 1
MIRT005513 PRDM1 PR domain containing 1, with ZNF domain 4 1
MIRT006057 HRAS v-Ha-ras Harvey rat sarcoma viral oncogene homolog 2 1
MIRT006875 CYP2J2 cytochrome P450, family 2, subfamily J, polypeptide 2 3 1
MIRT032193 POLR3B polymerase (RNA) III (DNA directed) polypeptide B 1 1
MIRT032194 NUBP2 nucleotide binding protein 2 (MinD homolog, E. coli) 1 1
MIRT032195 GFM2 G elongation factor, mitochondrial 2 1 1
MIRT032196 WDR4 WD repeat domain 4 1 1
MIRT032197 LDLR low density lipoprotein receptor 1 1
MIRT032198 DNM3 dynamin 3 1 1
MIRT032199 PIH1D1 PIH1 domain containing 1 1 1
MIRT032200 CCNK cyclin K 1 1
MIRT032201 SEMG2 semenogelin II 1 1
MIRT032202 PPM1G protein phosphatase, Mg2+/Mn2+ dependent, 1G 1 1
MIRT032203 PLXDC2 plexin domain containing 2 1 1
MIRT032204 ACACA acetyl-CoA carboxylase alpha 2 2
MIRT032205 MOB1A MOB1, Mps One Binder kinase activator-like 1B (yeast) 1 1
MIRT032206 SLC27A2 solute carrier family 27 (fatty acid transporter), member 2 1 1
MIRT032207 POLR1A polymerase (RNA) I polypeptide A, 194kDa 1 1
MIRT032208 ANXA8L1 annexin A8-like 1 1 1
MIRT032209 AGL amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase 1 1
MIRT032210 UBA3 ubiquitin-like modifier activating enzyme 3 1 1
MIRT032211 NIPBL Nipped-B homolog (Drosophila) 1 1
MIRT032212 WLS wntless homolog (Drosophila) 1 1
MIRT032213 PUS1 pseudouridylate synthase 1 1 1
MIRT032214 HEATR2 HEAT repeat containing 2 1 1
MIRT032215 MPG N-methylpurine-DNA glycosylase 1 1
MIRT032216 LRRC40 leucine rich repeat containing 40 1 1
MIRT032217 RANBP6 RAN binding protein 6 1 1
MIRT032218 EMC6 transmembrane protein 93 1 1
MIRT032219 BGLAP bone gamma-carboxyglutamate (gla) protein 1 1
MIRT032220 BAG5 BCL2-associated athanogene 5 1 1
MIRT032221 INTS5 integrator complex subunit 5 1 1
MIRT032222 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT032223 CNDP2 CNDP dipeptidase 2 (metallopeptidase M20 family) 1 1
MIRT032224 GPATCH4 G patch domain containing 4 1 1
MIRT032225 BAZ1B bromodomain adjacent to zinc finger domain, 1B 2 2
MIRT032226 DDX49 DEAD (Asp-Glu-Ala-Asp) box polypeptide 49 1 1
MIRT032227 DHX33 DEAH (Asp-Glu-Ala-His) box polypeptide 33 1 1
MIRT032228 SEC11A SEC11 homolog A (S. cerevisiae) 1 1
MIRT032229 PPID peptidylprolyl isomerase D 1 1
MIRT032230 CMC1 COX assembly mitochondrial protein homolog (S. cerevisiae) 1 1
MIRT032231 TMEM201 transmembrane protein 201 2 2
MIRT032232 ATG9A ATG9 autophagy related 9 homolog A (S. cerevisiae) 1 1
MIRT032233 ACPP acid phosphatase, prostate 1 1
MIRT032234 GLB1 galactosidase, beta 1 1 1
MIRT032235 USP10 ubiquitin specific peptidase 10 1 1
MIRT032236 XPO5 exportin 5 1 1
MIRT032237 LPCAT3 lysophosphatidylcholine acyltransferase 3 1 1
MIRT032238 GSPT1 G1 to S phase transition 1 1 1
MIRT032239 CUL3 cullin 3 1 1
MIRT032240 PCYT1B phosphate cytidylyltransferase 1, choline, beta 1 1
MIRT032241 BZW2 basic leucine zipper and W2 domains 2 1 1
MIRT032242 DLAT dihydrolipoamide S-acetyltransferase 1 1
MIRT032243 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 1
MIRT032244 CTPS1 CTP synthase 1 1
MIRT032245 NUP155 nucleoporin 155kDa 2 2
MIRT032246 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 2 2
MIRT032247 SLC30A1 solute carrier family 30 (zinc transporter), member 1 1 1
MIRT032248 HELLS helicase, lymphoid-specific 1 1
MIRT032249 LPGAT1 lysophosphatidylglycerol acyltransferase 1 1 1
MIRT032250 QRSL1 glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1 1 1
MIRT032251 TST thiosulfate sulfurtransferase (rhodanese) 1 1
MIRT032252 STIM1 stromal interaction molecule 1 1 1
MIRT032253 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT032254 GEMIN5 gem (nuclear organelle) associated protein 5 1 1
MIRT032255 PCCB propionyl CoA carboxylase, beta polypeptide 1 1
MIRT032256 SYNE1 spectrin repeat containing, nuclear envelope 1 1 1
MIRT032257 TCOF1 Treacher Collins-Franceschetti syndrome 1 1 1
MIRT032258 SDAD1 SDA1 domain containing 1 1 1
MIRT032259 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT032260 RNMTL1 RNA methyltransferase like 1 1 1
MIRT032261 TIMM23 translocase of inner mitochondrial membrane 23 homolog (yeast) 1 1
MIRT032262 PSMD9 proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 1 1
MIRT032263 COPG1 coatomer protein complex, subunit gamma 1 1
MIRT032264 SP100 SP100 nuclear antigen 1 1
MIRT032265 DSG2 desmoglein 2 1 1
MIRT032266 RTCA RNA terminal phosphate cyclase domain 1 2 2
MIRT032267 PDCD11 programmed cell death 11 2 2
MIRT032268 NSMCE4A non-SMC element 4 homolog A (S. cerevisiae) 1 1
MIRT032269 CHMP3 vacuolar protein sorting 24 homolog (S. cerevisiae) 1 1
MIRT032270 PAAF1 proteasomal ATPase-associated factor 1 1 1
MIRT032271 NVL nuclear VCP-like 1 1
MIRT032272 MRPL47 mitochondrial ribosomal protein L47 1 1
MIRT032273 ARCN1 archain 1 1 1
MIRT032274 ANXA8L2 annexin A8-like 2 1 1
MIRT032275 DHX16 DEAH (Asp-Glu-Ala-His) box polypeptide 16 1 1
MIRT032276 CPSF3L cleavage and polyadenylation specific factor 3-like 1 1
MIRT032277 UBE2M ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast) 1 1
MIRT032278 UNC13D unc-13 homolog D (C. elegans) 1 1
MIRT032279 CHAF1A chromatin assembly factor 1, subunit A (p150) 1 1
MIRT032280 UBE2D2 ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast) 1 1
MIRT032281 DDX41 DEAD (Asp-Glu-Ala-Asp) box polypeptide 41 1 1
MIRT032282 AKR1A1 aldo-keto reductase family 1, member A1 (aldehyde reductase) 1 1
MIRT032283 DRG2 developmentally regulated GTP binding protein 2 1 1
MIRT032284 IPO8 importin 8 1 1
MIRT032285 ACSL1 acyl-CoA synthetase long-chain family member 1 1 1
MIRT032286 WBSCR16 Williams-Beuren syndrome chromosome region 16 1 1
MIRT032287 CHRAC1 chromatin accessibility complex 1 1 1
MIRT032288 FAM213A chromosome 10 open reading frame 58 1 1
MIRT032289 SLC25A19 solute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19 1 1
MIRT032290 UBAP2L ubiquitin associated protein 2-like 2 2
MIRT032291 IGSF3 immunoglobulin superfamily, member 3 1 1
MIRT032292 MAP7 microtubule-associated protein 7 1 1
MIRT032293 GAPVD1 GTPase activating protein and VPS9 domains 1 1 1
MIRT032294 OSBPL10 oxysterol binding protein-like 10 1 1
MIRT032295 POP1 processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae) 1 1
MIRT032296 ZC3H11A zinc finger CCCH-type containing 11A 1 1
MIRT032297 IGF2BP3 insulin-like growth factor 2 mRNA binding protein 3 1 1
MIRT032298 PEX11B peroxisomal biogenesis factor 11 beta 1 1
MIRT032299 USO1 USO1 vesicle docking protein homolog (yeast) 1 1
MIRT032300 MYO1E myosin IE 1 1
MIRT032301 MIOS missing oocyte, meiosis regulator, homolog (Drosophila) 1 1
MIRT032302 RBM12B RNA binding motif protein 12B 1 1
MIRT032303 POM121C POM121 membrane glycoprotein C 1 1
MIRT032304 UBE2D3 ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) 1 1
MIRT032305 NARS2 asparaginyl-tRNA synthetase 2, mitochondrial (putative) 1 1
MIRT032306 CS citrate synthase 1 1
MIRT032307 CCNY cyclin Y 1 1
MIRT032308 ASCC3 activating signal cointegrator 1 complex subunit 3 1 1
MIRT032309 GALNT2 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2) 1 1
MIRT032310 XRN1 5'-3' exoribonuclease 1 1 1
MIRT032311 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 1 1
MIRT032312 SCD stearoyl-CoA desaturase (delta-9-desaturase) 2 2
MIRT032313 PRKAR2A protein kinase, cAMP-dependent, regulatory, type II, alpha 1 1
MIRT032314 VPS51 chromosome 11 open reading frame 2 1 1
MIRT032315 DNAJC11 DnaJ (Hsp40) homolog, subfamily C, member 11 1 1
MIRT032316 WDR74 WD repeat domain 74 1 1
MIRT032317 OXA1L oxidase (cytochrome c) assembly 1-like 1 1
MIRT032318 SCAMP1 secretory carrier membrane protein 1 1 1
MIRT032319 SLC9A3R1 solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1 1 1
MIRT032320 IDI1 isopentenyl-diphosphate delta isomerase 1 1 1
MIRT032321 XPO7 exportin 7 1 1
MIRT032322 TES testis derived transcript (3 LIM domains) 1 1
MIRT032323 TOE1 target of EGR1, member 1 (nuclear) 1 1
MIRT032324 PTCD1 pentatricopeptide repeat domain 1 1 1
MIRT032325 COX7B cytochrome c oxidase subunit VIIb 1 1
MIRT032326 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT032327 NUP35 nucleoporin 35kDa 1 1
MIRT032328 SYNGR2 synaptogyrin 2 2 2
MIRT032329 GATC glutamyl-tRNA(Gln) amidotransferase, subunit C homolog (bacterial) 1 1
MIRT032330 PDCD10 programmed cell death 10 1 1
MIRT032331 NOL6 nucleolar protein family 6 (RNA-associated) 1 1
MIRT032332 TAF9 TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa 1 1
MIRT032333 ERGIC3 ERGIC and golgi 3 1 1
MIRT032334 WDR33 WD repeat domain 33 1 1
MIRT032335 PUM1 pumilio homolog 1 (Drosophila) 2 2
MIRT032336 POLR2H polymerase (RNA) II (DNA directed) polypeptide H 1 1
MIRT032337 ELOVL1 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 1 1
MIRT032338 UBXN8 UBX domain protein 8 1 1
MIRT032339 PARVB parvin, beta 1 1
MIRT032340 MTFP1 mitochondrial protein 18 kDa 1 1
MIRT032341 DNAJC1 DnaJ (Hsp40) homolog, subfamily C, member 1 1 1
MIRT032342 KIDINS220 kinase D-interacting substrate, 220kDa 1 1
MIRT032343 LPL lipoprotein lipase 1 1
MIRT032344 DIAPH1 diaphanous homolog 1 (Drosophila) 2 2
MIRT032345 SMARCA1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 1 1
MIRT032346 CCDC134 coiled-coil domain containing 134 1 1
MIRT032347 EIF4A2 eukaryotic translation initiation factor 4A2 1 1
MIRT032348 INTS7 integrator complex subunit 7 1 1
MIRT032349 EIF2B3 eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa 1 1
MIRT032350 CHD3 chromodomain helicase DNA binding protein 3 2 2
MIRT032351 CENPB centromere protein B, 80kDa 1 1
MIRT032352 TBRG4 transforming growth factor beta regulator 4 1 1
MIRT032353 SEPT4 septin 4 1 1
MIRT032354 APRT adenine phosphoribosyltransferase 1 1
MIRT032355 NSA2 NSA2 ribosome biogenesis homolog (S. cerevisiae) 1 1
MIRT032356 PDK1 pyruvate dehydrogenase kinase, isozyme 1 1 1
MIRT032357 GLTSCR2 glioma tumor suppressor candidate region gene 2 1 1
MIRT032358 PAFAH1B3 platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa) 1 1
MIRT032359 GYS2 glycogen synthase 2 (liver) 1 1
MIRT032360 REEP4 receptor accessory protein 4 1 1
MIRT032361 NDUFAF7 chromosome 2 open reading frame 56 1 1
MIRT032362 SEC23B Sec23 homolog B (S. cerevisiae) 1 1
MIRT032363 ATG4B ATG4 autophagy related 4 homolog B (S. cerevisiae) 1 1
MIRT032364 BAZ1A bromodomain adjacent to zinc finger domain, 1A 1 1
MIRT032365 GLO1 glyoxalase I 1 1
MIRT032366 FAM49B family with sequence similarity 49, member B 1 1
MIRT032367 POLR1B polymerase (RNA) I polypeptide B, 128kDa 1 1
MIRT032368 RIOK2 RIO kinase 2 (yeast) 1 1
MIRT032369 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 2 2
MIRT032370 NUP214 nucleoporin 214kDa 2 2
MIRT032371 CLPX ClpX caseinolytic peptidase X homolog (E. coli) 1 1
MIRT032372 RNMT RNA (guanine-7-) methyltransferase 1 1
MIRT032373 QARS glutaminyl-tRNA synthetase 1 1
MIRT032374 MYCBP c-myc binding protein 1 1
MIRT032375 SLC38A2 solute carrier family 38, member 2 1 1
MIRT032376 AHCTF1 AT hook containing transcription factor 1 1 1
MIRT032377 MKRN2 makorin ring finger protein 2 1 1
MIRT032378 VWA8 KIAA0564 1 1
MIRT032379 PMF1 polyamine-modulated factor 1 1 1
MIRT032380 CA12 carbonic anhydrase XII 1 1
MIRT032381 ORC4 origin recognition complex, subunit 4-like (yeast) 1 1
MIRT032382 RBM34 RNA binding motif protein 34 1 1
MIRT032383 PYCRL pyrroline-5-carboxylate reductase-like 1 1
MIRT032384 FOXK1 forkhead box K1 1 1
MIRT032385 ENG endoglin 1 1
MIRT032386 TPBG trophoblast glycoprotein 1 1
MIRT032387 RAB38 RAB38, member RAS oncogene family 1 1
MIRT032388 TIMM8A translocase of inner mitochondrial membrane 8 homolog A (yeast) 1 1
MIRT032389 FOXRED1 FAD-dependent oxidoreductase domain containing 1 1 1
MIRT032390 MOB1B MOB1, Mps One Binder kinase activator-like 1A (yeast) 1 1
MIRT032391 CENPV centromere protein V 1 1
MIRT032392 POLR2L polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa 1 1
MIRT032393 ANKZF1 ankyrin repeat and zinc finger domain containing 1 1 1
MIRT032394 LLPH LLP homolog, long-term synaptic facilitation (Aplysia) 1 1
MIRT032395 MIPEP mitochondrial intermediate peptidase 1 1
MIRT032396 VAMP3 vesicle-associated membrane protein 3 (cellubrevin) 1 1
MIRT032397 PRPS1 phosphoribosyl pyrophosphate synthetase 1 1 1
MIRT032398 IMPDH2 IMP (inosine 5'-monophosphate) dehydrogenase 2 1 1
MIRT032399 SH3GLB1 SH3-domain GRB2-like endophilin B1 1 1
MIRT032400 DDX28 DEAD (Asp-Glu-Ala-Asp) box polypeptide 28 1 1
MIRT032401 UBE2I ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) 1 1
MIRT032402 COPS2 COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) 1 1
MIRT032403 KRT19 keratin 19 1 1
MIRT032404 DCD dermcidin 1 1
MIRT032405 USP15 ubiquitin specific peptidase 15 1 1
MIRT032406 ANXA8 annexin A8 1 1
MIRT032407 MAT2B methionine adenosyltransferase II, beta 1 1
MIRT032408 TUBGCP2 tubulin, gamma complex associated protein 2 1 1
MIRT032409 ARFIP2 ADP-ribosylation factor interacting protein 2 1 1
MIRT032410 DDX10 DEAD (Asp-Glu-Ala-Asp) box polypeptide 10 1 1
MIRT032411 TRUB2 TruB pseudouridine (psi) synthase homolog 2 (E. coli) 1 1
MIRT032412 NLE1 notchless homolog 1 (Drosophila) 1 1
MIRT032413 RNF40 ring finger protein 40 1 1
MIRT032414 DDX21 DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 1 1
MIRT032415 TRIP12 thyroid hormone receptor interactor 12 1 1
MIRT032416 GSR glutathione reductase 2 2
MIRT032417 SLC38A5 solute carrier family 38, member 5 1 1
MIRT032418 PLCB3 phospholipase C, beta 3 (phosphatidylinositol-specific) 1 1
MIRT032419 PGM3 phosphoglucomutase 3 1 1
MIRT032420 RRP7A ribosomal RNA processing 7 homolog A (S. cerevisiae) 1 1
MIRT032421 LSM6 LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae) 1 1
MIRT032422 TMED5 transmembrane emp24 protein transport domain containing 5 1 1
MIRT032423 PIGU phosphatidylinositol glycan anchor biosynthesis, class U 1 1
MIRT032424 CPSF1 cleavage and polyadenylation specific factor 1, 160kDa 1 1
MIRT032425 NAA15 N(alpha)-acetyltransferase 15, NatA auxiliary subunit 1 1
MIRT032426 NOP14 NOP14 nucleolar protein homolog (yeast) 1 1
MIRT032427 FLAD1 FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae) 2 2
MIRT032428 CUL1 cullin 1 1 1
MIRT032429 CDCA8 cell division cycle associated 8 1 1
MIRT032430 SLC30A7 solute carrier family 30 (zinc transporter), member 7 1 1
MIRT032431 DPF2 D4, zinc and double PHD fingers family 2 1 1
MIRT032432 KIF2A kinesin heavy chain member 2A 1 1
MIRT032433 ERGIC2 ERGIC and golgi 2 1 1
MIRT032434 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT032435 SPRYD7 chromosome 13 open reading frame 1 1 1
MIRT032436 CHD4 chromodomain helicase DNA binding protein 4 2 2
MIRT032437 SMARCD1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 2 2
MIRT032438 TMEM65 transmembrane protein 65 1 1
MIRT032439 NME6 non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase) 1 1
MIRT032440 RBFOX1 ataxin 2-binding protein 1 1 1
MIRT032441 CLUH KIAA0664 2 2
MIRT032442 RDX radixin 1 1
MIRT032443 LBR lamin B receptor 1 1
MIRT032444 CCNA1 cyclin A1 1 1
MIRT032445 SEC16A SEC16 homolog A (S. cerevisiae) 1 1
MIRT032446 TBC1D15 TBC1 domain family, member 15 1 1
MIRT032447 NAF1 nuclear assembly factor 1 homolog (S. cerevisiae) 1 1
MIRT032448 LRRC47 leucine rich repeat containing 47 1 1
MIRT032449 VWA9 chromosome 15 open reading frame 44 1 1
MIRT032450 UTP15 UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) 1 1
MIRT032451 TROVE2 TROVE domain family, member 2 1 1
MIRT032452 TBC1D13 TBC1 domain family, member 13 1 1
MIRT032453 MCAT malonyl CoA:ACP acyltransferase (mitochondrial) 1 1
MIRT032454 TRNT1 tRNA nucleotidyl transferase, CCA-adding, 1 1 1
MIRT032455 TIMM9 translocase of inner mitochondrial membrane 9 homolog (yeast) 1 1
MIRT032456 KCTD12 potassium channel tetramerisation domain containing 12 1 1
MIRT032457 SCRN1 secernin 1 1 1
MIRT032458 SCAF4 splicing factor, arginine/serine-rich 15 1 1
MIRT032459 MAP2K2 mitogen-activated protein kinase kinase 2 1 1
MIRT032460 INPPL1 inositol polyphosphate phosphatase-like 1 1 1
MIRT032461 CHD1 chromodomain helicase DNA binding protein 1 1 1
MIRT032462 UCK2 uridine-cytidine kinase 2 1 1
MIRT032463 LZIC leucine zipper and CTNNBIP1 domain containing 1 1
MIRT032464 SPR sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase) 1 1
MIRT032465 SLC25A12 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 1 1
MIRT032466 TRIM24 tripartite motif-containing 24 2 2
MIRT032467 GTF3C4 general transcription factor IIIC, polypeptide 4, 90kDa 1 1
MIRT032468 TTLL12 tubulin tyrosine ligase-like family, member 12 1 1
MIRT032469 PITHD1 chromosome 1 open reading frame 128 1 1
MIRT032470 LRRC8A leucine rich repeat containing 8 family, member A 1 1
MIRT032471 EEF1E1 eukaryotic translation elongation factor 1 epsilon 1 1 1
MIRT032472 EHD4 EH-domain containing 4 1 1
MIRT032473 LSG1 large subunit GTPase 1 homolog (S. cerevisiae) 1 1
MIRT032474 PAPSS1 3'-phosphoadenosine 5'-phosphosulfate synthase 1 1 1
MIRT032475 PCYT1A phosphate cytidylyltransferase 1, choline, alpha 1 1
MIRT032476 ARHGAP17 Rho GTPase activating protein 17 1 1
MIRT032477 PSME3 proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) 2 2
MIRT032478 PDHX pyruvate dehydrogenase complex, component X 1 1
MIRT032479 OXNAD1 oxidoreductase NAD-binding domain containing 1 1 1
MIRT032480 TPP2 tripeptidyl peptidase II 1 1
MIRT032481 HS2ST1 heparan sulfate 2-O-sulfotransferase 1 1 1
MIRT032482 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT032483 ABCC1 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 1 1
MIRT032484 SMARCA4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 2 2
MIRT032485 UTP6 UTP6, small subunit (SSU) processome component, homolog (yeast) 1 1
MIRT032486 TMEM33 transmembrane protein 33 1 1
MIRT032487 WDR75 WD repeat domain 75 1 1
MIRT032488 ABCB10 ATP-binding cassette, sub-family B (MDR/TAP), member 10 1 1
MIRT032489 MARS methionyl-tRNA synthetase 1 1
MIRT032490 PVR poliovirus receptor 1 1
MIRT032491 ANP32E acidic (leucine-rich) nuclear phosphoprotein 32 family, member E 1 1
MIRT032492 WARS2 tryptophanyl tRNA synthetase 2, mitochondrial 1 1
MIRT032493 RAB3GAP2 RAB3 GTPase activating protein subunit 2 (non-catalytic) 1 1
MIRT032494 ERO1L ERO1-like (S. cerevisiae) 1 1
MIRT032495 IMPDH1 IMP (inosine 5'-monophosphate) dehydrogenase 1 1 1
MIRT032496 TMEM167A transmembrane protein 167A 1 1
MIRT032497 PDPR pyruvate dehydrogenase phosphatase regulatory subunit 1 1
MIRT032498 RBFOX2 RNA binding motif protein 9 2 2
MIRT051877 SPATA12 spermatogenesis associated 12 1 1
MIRT051878 DRAXIN chromosome 1 open reading frame 187 1 1
MIRT051879 CCNB1 cyclin B1 1 1
MIRT051880 DENR density-regulated protein 1 1
MIRT051881 IP6K1 inositol hexakisphosphate kinase 1 1 1
MIRT051882 GATA6 GATA binding protein 6 1 1
MIRT051883 PAK1 p21 protein (Cdc42/Rac)-activated kinase 1 1 1
MIRT051884 DDX17 DEAD (Asp-Glu-Ala-Asp) box polypeptide 17 1 1
MIRT051885 ATXN1L ataxin 1-like 1 1
MIRT051886 PLXNB2 plexin B2 1 1
MIRT051887 IBA57 chromosome 1 open reading frame 69 1 1
MIRT051888 ND2 MTND2 1 1
MIRT051889 CCNB2 cyclin B2 1 1
MIRT051890 CLCA2 chloride channel accessory 2 1 1
MIRT051891 NOMO3 NODAL modulator 3 1 1
MIRT051892 IGSF8 immunoglobulin superfamily, member 8 1 1
MIRT051893 DBNL drebrin-like 1 1
MIRT051894 SZRD1 chromosome 1 open reading frame 144 1 1
MIRT051895 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT051896 HIST1H1C histone cluster 1, H1c 1 1
MIRT051897 AUP1 ancient ubiquitous protein 1 1 1
MIRT051898 ABCB8 ATP-binding cassette, sub-family B (MDR/TAP), member 8 1 1
MIRT051899 PPRC1 peroxisome proliferator-activated receptor gamma, coactivator-related 1 1 1
MIRT051900 ATOX1 ATX1 antioxidant protein 1 homolog (yeast) 1 1
MIRT051901 MIEN1 chromosome 17 open reading frame 37 1 1
MIRT051902 DDX20 DEAD (Asp-Glu-Ala-Asp) box polypeptide 20 1 1
MIRT051903 APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 1 1
MIRT051904 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT051905 SLC25A4 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4 1 1
MIRT051906 PFN1 profilin 1 1 1
MIRT051907 PRTG protogenin homolog (Gallus gallus) 1 1
MIRT051908 MRPS11 mitochondrial ribosomal protein S11 1 1
MIRT051909 BRPF3 bromodomain and PHD finger containing, 3 1 1
MIRT051910 SRCAP Snf2-related CREBBP activator protein 1 1
MIRT051911 BAG6 HLA-B associated transcript 3 1 1
MIRT051912 POTEG POTE ankyrin domain family, member G 1 1
MIRT051913 ACTB actin, beta 1 1
MIRT051914 ZNF841 zinc finger protein 841 1 1
MIRT051915 DCTD dCMP deaminase 1 1
MIRT051916 UBE2A ubiquitin-conjugating enzyme E2A (RAD6 homolog) 1 1
MIRT051917 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT051918 E2F3 E2F transcription factor 3 1 1
MIRT051919 ZNF629 zinc finger protein 629 1 1
MIRT051920 MAB21L1 mab-21-like 1 (C. elegans) 1 1
MIRT051921 POLR2A polymerase (RNA) II (DNA directed) polypeptide A, 220kDa 1 1
MIRT051922 FSTL1 follistatin-like 1 1 1
MIRT051923 NCAPD2 non-SMC condensin I complex, subunit D2 1 1
MIRT051924 HNRNPL heterogeneous nuclear ribonucleoprotein L 1 1
MIRT051925 PEX6 peroxisomal biogenesis factor 6 1 1
MIRT051926 SUMO2 SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) 1 1
MIRT051927 BBS7 Bardet-Biedl syndrome 7 1 1
MIRT051928 MMACHC methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria 1 1
MIRT051929 CD99 CD99 molecule 1 1
MIRT051930 C5orf24 chromosome 5 open reading frame 24 1 1
MIRT051931 NPTN neuroplastin 1 1
MIRT051932 ALDH7A1 aldehyde dehydrogenase 7 family, member A1 1 1
MIRT051933 KIFC1 kinesin family member C1 1 1
MIRT051934 CTBP2 C-terminal binding protein 2 1 1
MIRT051935 ND4 NADH dehydrogenase, subunit 4 (complex I) 1 1
MIRT051936 HIF1A hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) 1 1
MIRT051937 SMARCB1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 1 1
MIRT051938 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT051939 MIER2 mesoderm induction early response 1, family member 2 1 1
MIRT051940 ACTN4 actinin, alpha 4 1 1
MIRT051941 BFSP1 beaded filament structural protein 1, filensin 1 1
MIRT051942 TJP1 tight junction protein 1 (zona occludens 1) 1 1
MIRT051943 CNOT2 CCR4-NOT transcription complex, subunit 2 1 1
MIRT051944 EIF3C eukaryotic translation initiation factor 3, subunit C 1 1
MIRT051945 TNFSF12 tumor necrosis factor (ligand) superfamily, member 12 1 1
MIRT051946 PTPN23 protein tyrosine phosphatase, non-receptor type 23 1 1
MIRT051947 GDPD5 glycerophosphodiester phosphodiesterase domain containing 5 1 1
MIRT051948 ABL1 c-abl oncogene 1, receptor tyrosine kinase 1 1
MIRT051949 RNF115 ring finger protein 115 1 1
MIRT051950 UBE2Q1 ubiquitin-conjugating enzyme E2Q family member 1 1 1
MIRT051951 EFCAB14 KIAA0494 1 1
MIRT051952 AP3M1 adaptor-related protein complex 3, mu 1 subunit 1 1
MIRT051953 TUBB tubulin, beta 1 1
MIRT051954 COX1 cytochrome c oxidase subunit I 1 1
MIRT051955 RPL18 ribosomal protein L18 1 1
MIRT051956 HOXD11 homeobox D11 1 1
MIRT051957 STIP1 stress-induced-phosphoprotein 1 1 1
MIRT051958 GLTPD1 glycolipid transfer protein domain containing 1 1 1
MIRT051959 KIF1C kinesin family member 1C 1 1
MIRT051960 WASL Wiskott-Aldrich syndrome-like 1 1
MIRT051961 PPP1R12C protein phosphatase 1, regulatory (inhibitor) subunit 12C 1 1
MIRT051962 CD2BP2 CD2 (cytoplasmic tail) binding protein 2 1 1
MIRT051963 WDR25 WD repeat domain 25 1 1
MIRT051964 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 1
MIRT051965 SNRPE small nuclear ribonucleoprotein polypeptide E 1 1
MIRT051966 HUWE1 HECT, UBA and WWE domain containing 1 1 1
MIRT051967 RPSA ribosomal protein SA 1 1
MIRT051968 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT051969 ZNF507 zinc finger protein 507 1 1
MIRT051970 PPARGC1A peroxisome proliferator-activated receptor gamma, coactivator 1 alpha 1 1
MIRT051971 ARPP19 cAMP-regulated phosphoprotein, 19kDa 1 1
MIRT051972 UBA1 ubiquitin-like modifier activating enzyme 1 1 1
MIRT051973 PRPF19 PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae) 1 1
MIRT051974 ATXN2L ataxin 2-like 1 1
MIRT051975 PLK1 polo-like kinase 1 (Drosophila) 1 1
MIRT051976 COX3 cytochrome c oxidase III 1 1
MIRT051977 NDUFA10 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa 1 1
MIRT051978 RIOK3 RIO kinase 3 (yeast) 1 1
MIRT051979 NCOA5 nuclear receptor coactivator 5 1 1
MIRT051980 ZNF148 zinc finger protein 148 1 1
MIRT051981 DENND4B DENN/MADD domain containing 4B 1 1
MIRT051982 FAM178A family with sequence similarity 178, member A 1 1
MIRT051983 PPP2R5E protein phosphatase 2, regulatory subunit B', epsilon isoform 1 1
MIRT051984 HARS histidyl-tRNA synthetase 1 1
MIRT051985 ZNF687 zinc finger protein 687 1 1
MIRT051986 OTUB1 OTU domain, ubiquitin aldehyde binding 1 1 1
MIRT051987 ATE1 arginyltransferase 1 1 1
MIRT051988 L3MBTL4 l(3)mbt-like 4 (Drosophila) 1 1
MIRT051989 PTGFRN prostaglandin F2 receptor negative regulator 1 1
MIRT051990 TMEM115 transmembrane protein 115 1 1
MIRT051991 HES1 hairy and enhancer of split 1, (Drosophila) 1 1
MIRT051992 EPB41L3 erythrocyte membrane protein band 4.1-like 3 1 1
MIRT051993 KIAA1429 KIAA1429 1 1
MIRT051994 ITGB5 integrin, beta 5 1 1
MIRT051995 EP300 E1A binding protein p300 1 1
MIRT051996 NBPF15 neuroblastoma breakpoint family, member 15 1 1
MIRT051997 RPL12 ribosomal protein L12 1 1
MIRT051998 RXRB retinoid X receptor, beta 1 1
MIRT051999 JAG1 jagged 1 (Alagille syndrome) 1 1
MIRT052000 POLR3G polymerase (RNA) III (DNA directed) polypeptide G (32kD) 1 1
MIRT052001 FAM126A family with sequence similarity 126, member A 1 1
MIRT052002 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT052003 ND1 NADH dehydrogenase, subunit 1 (complex I) 1 1
MIRT052004 RRBP1 ribosome binding protein 1 homolog 180kDa (dog) 1 1
MIRT052005 CNNM3 cyclin M3 1 1
MIRT052006 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT052007 C5orf15 chromosome 5 open reading frame 15 1 1
MIRT052008 WASF1 WAS protein family, member 1 1 1
MIRT052009 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT052010 SUPT20H family with sequence similarity 48, member A 1 1
MIRT052011 ZCCHC9 zinc finger, CCHC domain containing 9 1 1
MIRT052012 ZNF426 zinc finger protein 426 1 1
MIRT052013 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT052014 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT052015 TUBA1B tubulin, alpha 1b 1 1
MIRT052016 AR androgen receptor 1 1
MIRT052017 FLII flightless I homolog (Drosophila) 1 1
MIRT052018 HADHA hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit 1 1
MIRT052019 GNAS GNAS complex locus 1 1
MIRT052020 ST13 suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) 1 1
MIRT052021 HSPA8 heat shock 70kDa protein 8 1 1
MIRT052022 NUP153 nucleoporin 153kDa 1 1
MIRT052023 PHKA1 phosphorylase kinase, alpha 1 (muscle) 1 1
MIRT052024 BIRC5 baculoviral IAP repeat-containing 5 1 1
MIRT052025 ADRM1 adhesion regulating molecule 1 1 1
MIRT052026 DFFA DNA fragmentation factor, 45kDa, alpha polypeptide 1 1
MIRT052027 BRD2 bromodomain containing 2 1 1
MIRT052028 FAM131A family with sequence similarity 131, member A 1 1
MIRT052029 PRRC2B HLA-B associated transcript 2-like 1 1 1
MIRT052030 FAM136A family with sequence similarity 136, member A 1 1
MIRT052031 STK38 serine/threonine kinase 38 1 1
MIRT052032 KIAA1377 KIAA1377 1 1
MIRT052033 TSEN15 tRNA splicing endonuclease 15 homolog (S. cerevisiae) 1 1
MIRT052034 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1 1 1
MIRT052035 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative function) 1 1
MIRT052036 KIAA0141 KIAA0141 1 1
MIRT052037 TIMM50 translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) 1 1
MIRT052038 NCOR1 nuclear receptor corepressor 1 1 1
MIRT052039 SCAF8 RNA binding motif protein 16 1 1
MIRT052040 HCFC1 host cell factor C1 (VP16-accessory protein) 1 1
MIRT052041 BRPF1 bromodomain and PHD finger containing, 1 1 1
MIRT052042 ATP6 ATP synthase F0 subunit 6 1 1
MIRT052043 ETFA electron-transfer-flavoprotein, alpha polypeptide 1 1
MIRT052044 ARHGAP26 Rho GTPase activating protein 26 1 1
MIRT052045 FANCD2 Fanconi anemia, complementation group D2 1 1
MIRT052046 SALL2 sal-like 2 (Drosophila) 1 1
MIRT052047 RBM12 RNA binding motif protein 12 1 1
MIRT052048 TOX3 TOX high mobility group box family member 3 1 1
MIRT052049 GNB1 guanine nucleotide binding protein (G protein), beta polypeptide 1 1 1
MIRT052050 FOXRED2 FAD-dependent oxidoreductase domain containing 2 1 1
MIRT052051 PALD1 KIAA1274 1 1
MIRT052052 MARCH6 membrane-associated ring finger (C3HC4) 6 1 1
MIRT052053 KCNC4 potassium voltage-gated channel, Shaw-related subfamily, member 4 1 1
MIRT052054 SFMBT1 Scm-like with four mbt domains 1 1 1
MIRT052055 CACNG8 calcium channel, voltage-dependent, gamma subunit 8 1 1
MIRT052056 KLHL11 kelch-like 11 (Drosophila) 1 1
MIRT052057 HIST1H3B histone cluster 1, H3b 1 1
MIRT052058 ARID3B AT rich interactive domain 3B (BRIGHT-like) 1 1
MIRT052059 DYNC1H1 dynein, cytoplasmic 1, heavy chain 1 1 1
MIRT052060 SYNE2 spectrin repeat containing, nuclear envelope 2 1 1
MIRT052061 TPT1 tumor protein, translationally-controlled 1 1 1
MIRT052062 AGFG2 ArfGAP with FG repeats 2 1 1
MIRT052063 TUBGCP3 tubulin, gamma complex associated protein 3 1 1
MIRT052064 ND4L NADH dehydrogenase, subunit 4L (complex I) 1 1
MIRT052065 RAB10 RAB10, member RAS oncogene family 1 1
MIRT052066 AFF4 AF4/FMR2 family, member 4 1 1
MIRT052067 BTG2 BTG family, member 2 1 1
MIRT052068 TRIM28 tripartite motif-containing 28 1 1
MIRT052069 NABP2 oligonucleotide/oligosaccharide-binding fold containing 2B 1 1
MIRT052070 CHD7 chromodomain helicase DNA binding protein 7 1 1
MIRT052071 HIPK1 homeodomain interacting protein kinase 1 1 1
MIRT052072 PA2G4 proliferation-associated 2G4, 38kDa 1 1
MIRT052073 USP22 ubiquitin specific peptidase 22 1 1
MIRT052074 ZER1 zer-1 homolog (C. elegans) 1 1
MIRT052075 ZNF805 zinc finger protein 805 1 1
MIRT052076 SMARCC2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 1 1
MIRT052077 ASPSCR1 alveolar soft part sarcoma chromosome region, candidate 1 1 1
MIRT052078 ADCY1 adenylate cyclase 1 (brain) 1 1
MIRT052079 FEN1 flap structure-specific endonuclease 1 1 1
MIRT052080 ZNF652 zinc finger protein 652 1 1
MIRT052081 PAX3 paired box 3 1 1
MIRT052082 MBD6 methyl-CpG binding domain protein 6 1 1
MIRT052083 HSF2 heat shock transcription factor 2 1 1
MIRT052084 TENM3 odz, odd Oz/ten-m homolog 3 (Drosophila) 1 1
MIRT052085 YLPM1 YLP motif containing 1 1 1
MIRT052086 ASNA1 arsA arsenite transporter, ATP-binding, homolog 1 (bacterial) 1 1
MIRT052087 GPATCH1 G patch domain containing 1 1 1
MIRT052088 IARS2 isoleucyl-tRNA synthetase 2, mitochondrial 1 1
MIRT052089 BCAS4 breast carcinoma amplified sequence 4 1 1
MIRT052090 MPND MPN domain containing 1 1
MIRT052091 DDX18 DEAD (Asp-Glu-Ala-Asp) box polypeptide 18 1 1
MIRT052092 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 1
MIRT052093 ZFHX4 zinc finger homeobox 4 1 1
MIRT052094 NAA20 N(alpha)-acetyltransferase 20, NatB catalytic subunit 1 1
MIRT052095 WDR55 WD repeat domain 55 1 1
MIRT052096 LACTB2 lactamase, beta 2 1 1
MIRT052097 SON SON DNA binding protein 1 1
MIRT052098 SH3PXD2A SH3 and PX domains 2A 1 1
MIRT052099 BNIP3L BCL2/adenovirus E1B 19kDa interacting protein 3-like 1 1
MIRT052100 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT052101 PIGG phosphatidylinositol glycan anchor biosynthesis, class G 1 1
MIRT052102 DNAJC8 DnaJ (Hsp40) homolog, subfamily C, member 8 1 1
MIRT052103 SPTBN2 spectrin, beta, non-erythrocytic 2 1 1
MIRT052104 GALNT11 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11) 1 1
MIRT052105 MYO1C myosin IC 1 1
MIRT052106 ANTXR1 anthrax toxin receptor 1 1 1
MIRT052107 PRKAA2 protein kinase, AMP-activated, alpha 2 catalytic subunit 1 1
MIRT052108 SMC1A structural maintenance of chromosomes 1A 1 1
MIRT052109 RFFL ring finger and FYVE-like domain containing 1 1 1
MIRT052110 NEK9 NIMA (never in mitosis gene a)- related kinase 9 1 1
MIRT052111 NUSAP1 nucleolar and spindle associated protein 1 1 1
MIRT052112 AMPH amphiphysin 1 1
MIRT052113 EIF2AK1 eukaryotic translation initiation factor 2-alpha kinase 1 1 1
MIRT052114 PAPOLA poly(A) polymerase alpha 1 1
MIRT052115 FBXW2 F-box and WD repeat domain containing 2 1 1
MIRT052116 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT052117 DEDD death effector domain containing 1 1
MIRT052118 MED14 mediator complex subunit 14 1 1
MIRT052119 RALGAPB Ral GTPase activating protein, beta subunit (non-catalytic) 1 1
MIRT052120 VPS41 vacuolar protein sorting 41 homolog (S. cerevisiae) 1 1
MIRT052121 LACE1 lactation elevated 1 1 1
MIRT052122 SC5D sterol-C5-desaturase (ERG3 delta-5-desaturase homolog, S. cerevisiae)-like 1 1
MIRT052123 SAFB scaffold attachment factor B 1 1
MIRT052124 LPHN2 latrophilin 2 1 1
MIRT052125 HAND1 heart and neural crest derivatives expressed 1 1 1
MIRT052126 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 1
MIRT052127 SUPT16H suppressor of Ty 16 homolog (S. cerevisiae) 1 1
MIRT052128 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT052129 NFKBIA nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha 1 1
MIRT052130 ZC3HAV1 zinc finger CCCH-type, antiviral 1 1 1
MIRT052131 TPM4 tropomyosin 4 1 1
MIRT052132 TRAPPC1 trafficking protein particle complex 1 1 1
MIRT052133 AHCYL1 adenosylhomocysteinase-like 1 1 1
MIRT052134 ZNF606 zinc finger protein 606 1 1
MIRT052135 MIDN midnolin 1 1
MIRT052136 NAA10 N(alpha)-acetyltransferase 10, NatA catalytic subunit 1 1
MIRT052137 UNC13B unc-13 homolog B (C. elegans) 1 1
MIRT052138 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT052139 TXNL4A thioredoxin-like 4A 1 1
MIRT052140 OXR1 oxidation resistance 1 1 1
MIRT052141 MTSS1L metastasis suppressor 1-like 1 1
MIRT052142 KIAA1549 KIAA1549 1 1
MIRT052143 LTA4H leukotriene A4 hydrolase 1 1
MIRT052144 ZMYM2 zinc finger, MYM-type 2 1 1
MIRT052145 C12orf49 chromosome 12 open reading frame 49 1 1
MIRT052146 WDR26 WD repeat domain 26 1 1
MIRT052147 BAHD1 bromo adjacent homology domain containing 1 1 1
MIRT052148 TMEM55B transmembrane protein 55B 1 1
MIRT052149 PTTG1 pituitary tumor-transforming 1 1 1
MIRT052150 YTHDC1 YTH domain containing 1 1 1
MIRT052151 CD81 CD81 molecule 1 1
MIRT052152 PRKD1 protein kinase D1 1 1
MIRT052153 SLC10A3 solute carrier family 10 (sodium/bile acid cotransporter family), member 3 1 1
MIRT052154 CLINT1 clathrin interactor 1 1 1
MIRT052155 TIAM1 T-cell lymphoma invasion and metastasis 1 1 1
MIRT052156 SF3B1 splicing factor 3b, subunit 1, 155kDa 1 1
MIRT052157 NFATC1 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1 1 1
MIRT052158 YEATS2 YEATS domain containing 2 1 1
MIRT052159 KHSRP KH-type splicing regulatory protein 1 1
MIRT052160 STEAP3 STEAP family member 3 1 1
MIRT052161 ADCK2 aarF domain containing kinase 2 1 1
MIRT052162 GPI glucose-6-phosphate isomerase 1 1
MIRT052163 GDF11 growth differentiation factor 11 1 1
MIRT052164 ATXN2 ataxin 2 1 1
MIRT052165 EAF1 ELL associated factor 1 1 1
MIRT052166 HMGB1 high-mobility group box 1 1 1
MIRT052168 CYP1A2 cytochrome P450, family 1, subfamily A, polypeptide 2 1 1
MIRT052169 USP54 ubiquitin specific peptidase 54 1 1
MIRT052170 MED25 mediator complex subunit 25 1 1
MIRT052171 ERCC1 excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence) 1 1
MIRT052172 BTBD9 BTB (POZ) domain containing 9 1 1
MIRT052173 PPP1R16B protein phosphatase 1, regulatory (inhibitor) subunit 16B 1 1
MIRT052174 TBC1D20 TBC1 domain family, member 20 1 1
MIRT052175 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT052176 MCM4 minichromosome maintenance complex component 4 1 1
MIRT052177 IPO7 importin 7 1 1
MIRT052178 KIAA1586 KIAA1586 1 1
MIRT052179 E2F7 E2F transcription factor 7 1 1
MIRT052180 BCOR BCL6 corepressor 1 1
MIRT052181 CCND3 cyclin D3 1 1
MIRT052182 NME4 non-metastatic cells 4, protein expressed in 1 1
MIRT052183 TERF2IP telomeric repeat binding factor 2, interacting protein 1 1
MIRT052184 FLNA filamin A, alpha 1 1
MIRT052185 ERAP2 endoplasmic reticulum aminopeptidase 2 1 1
MIRT052186 MDM4 Mdm4 p53 binding protein homolog (mouse) 1 1
MIRT052187 FXR2 fragile X mental retardation, autosomal homolog 2 1 1
MIRT052188 ZNF106 zinc finger protein 106 homolog (mouse) 1 1
MIRT052189 MIB1 mindbomb homolog 1 (Drosophila) 1 1
MIRT052190 CKB creatine kinase, brain 1 1
MIRT052191 PCYT2 phosphate cytidylyltransferase 2, ethanolamine 1 1
MIRT052192 MED13 mediator complex subunit 13 1 1
MIRT052193 MFSD3 major facilitator superfamily domain containing 3 1 1
MIRT052194 DPYSL5 dihydropyrimidinase-like 5 1 1
MIRT052195 MRPL37 mitochondrial ribosomal protein L37 1 1
MIRT052196 XYLT2 xylosyltransferase II 1 1
MIRT052197 RNASE10 ribonuclease, RNase A family, 10 (non-active) 1 1
MIRT052198 MSN moesin 1 1
MIRT052199 BCORL1 BCL6 corepressor-like 1 1 1
MIRT052200 C2orf44 chromosome 2 open reading frame 44 1 1
MIRT052201 INTS1 integrator complex subunit 1 1 1
MIRT052202 MED28 mediator complex subunit 28 1 1
MIRT052203 ABCF1 ATP-binding cassette, sub-family F (GCN20), member 1 1 1
MIRT052204 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT052205 PTGES2 prostaglandin E synthase 2 1 1
MIRT052206 NACA nascent polypeptide-associated complex alpha subunit 1 1
MIRT052207 DBNDD2 dysbindin (dystrobrevin binding protein 1) domain containing 2 1 1
MIRT052208 TLN1 talin 1 1 1
MIRT052209 QKI quaking homolog, KH domain RNA binding (mouse) 1 1
MIRT052210 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT052211 EIF3D eukaryotic translation initiation factor 3, subunit D 1 1
MIRT052212 PTP4A2 protein tyrosine phosphatase type IVA, member 2 1 1
MIRT052213 ANKRD52 ankyrin repeat domain 52 1 1
MIRT052214 KXD1 chromosome 19 open reading frame 50 1 1
MIRT052215 CYSTM1 chromosome 5 open reading frame 32 1 1
MIRT052216 PCBP2 poly(rC) binding protein 2 1 1
MIRT052217 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 1 1
MIRT052218 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 1
MIRT052219 IRS2 insulin receptor substrate 2 1 1
MIRT052220 PSD3 pleckstrin and Sec7 domain containing 3 1 1
MIRT052221 HGS hepatocyte growth factor-regulated tyrosine kinase substrate 1 1
MIRT052222 ZNF317 zinc finger protein 317 1 1
MIRT052223 RPAP1 RNA polymerase II associated protein 1 1 1
MIRT052224 UTRN utrophin 1 1
MIRT052225 SIKE1 suppressor of IKBKE 1 1 1
MIRT052226 CKAP2 cytoskeleton associated protein 2 1 1
MIRT052227 WDR3 WD repeat domain 3 1 1
MIRT052228 ADIPOR2 adiponectin receptor 2 1 1
MIRT052229 ELMOD2 ELMO/CED-12 domain containing 2 1 1
MIRT052230 DNMBP dynamin binding protein 1 1
MIRT052231 PGM1 phosphoglucomutase 1 1 1
MIRT052232 HAUS6 HAUS augmin-like complex, subunit 6 1 1
MIRT052233 RPS4X ribosomal protein S4, X-linked 1 1
MIRT052234 MAP4 microtubule-associated protein 4 1 1
MIRT052235 RALB v-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protein) 1 1
MIRT052236 GSK3A glycogen synthase kinase 3 alpha 1 1
MIRT052237 NRD1 nardilysin (N-arginine dibasic convertase) 1 1
MIRT052238 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT052239 TUBA1C tubulin, alpha 1c 1 1
MIRT052240 ZNF3 zinc finger protein 3 1 1
MIRT052241 NT5DC2 5'-nucleotidase domain containing 2 1 1
MIRT052242 IRS4 insulin receptor substrate 4 1 1
MIRT052243 SNX12 sorting nexin 12 1 1
MIRT052244 FAM57A family with sequence similarity 57, member A 1 1
MIRT052245 CIZ1 CDKN1A interacting zinc finger protein 1 1 1
MIRT052246 MSANTD2 chromosome 11 open reading frame 61 1 1
MIRT052247 GYG1 glycogenin 1 1 1
MIRT052248 REPS1 RALBP1 associated Eps domain containing 1 1 1
MIRT052249 ADNP activity-dependent neuroprotector homeobox 1 1
MIRT052250 BMP7 bone morphogenetic protein 7 1 1
MIRT052251 SLC35F1 solute carrier family 35, member F1 1 1
MIRT052252 LRRC41 leucine rich repeat containing 41 1 1
MIRT052253 IGHMBP2 immunoglobulin mu binding protein 2 1 1
MIRT052254 FTO fat mass and obesity associated 1 1
MIRT052255 OSTM1 osteopetrosis associated transmembrane protein 1 1 1
MIRT052256 RAI1 retinoic acid induced 1 1 1
MIRT052257 KDM4A lysine (K)-specific demethylase 4A 1 1
MIRT052258 PSMG4 proteasome (prosome, macropain) assembly chaperone 4 1 1
MIRT052259 ARHGEF5 Rho guanine nucleotide exchange factor (GEF) 5 1 1
MIRT052260 RPS24 ribosomal protein S24 1 1
MIRT052261 PABPC1 poly(A) binding protein, cytoplasmic 1 1 1
MIRT052262 MEF2C myocyte enhancer factor 2C 1 1
MIRT052263 ISOC2 isochorismatase domain containing 2 1 1
MIRT052264 SP1 Sp1 transcription factor 1 1
MIRT052265 ZNF207 zinc finger protein 207 1 1
MIRT052266 SMG7 Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans) 1 1
MIRT052267 GABPB2 GA binding protein transcription factor, beta subunit 2 1 1
MIRT052268 ASIC1 amiloride-sensitive cation channel 2, neuronal 1 1
MIRT052269 PFKM phosphofructokinase, muscle 1 1
MIRT052270 CKS2 CDC28 protein kinase regulatory subunit 2 1 1
MIRT052271 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT052272 CSNK2A1 casein kinase 2, alpha 1 polypeptide 1 1
MIRT052273 ZNF581 zinc finger protein 581 1 1
MIRT052274 C6orf62 chromosome 6 open reading frame 62 1 1
MIRT052275 UCK1 uridine-cytidine kinase 1 1 1
MIRT052276 CD151 CD151 molecule (Raph blood group) 1 1
MIRT052277 CNOT1 CCR4-NOT transcription complex, subunit 1 1 1
MIRT052278 PER1 period homolog 1 (Drosophila) 1 1
MIRT052279 THOC5 THO complex 5 1 1
MIRT052280 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT052281 PDS5A PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) 1 1
MIRT052282 IRF2BP2 interferon regulatory factor 2 binding protein 2 1 1
MIRT052283 ANKRD17 ankyrin repeat domain 17 1 1
MIRT052284 PRDM4 PR domain containing 4 1 1
MIRT052285 TMEM63B transmembrane protein 63B 1 1
MIRT052286 FAM84B family with sequence similarity 84, member B 1 1
MIRT052287 GPM6B glycoprotein M6B 1 1
MIRT052288 NFATC3 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3 1 1
MIRT052289 ELK4 ELK4, ETS-domain protein (SRF accessory protein 1) 1 1
MIRT052290 COX2 cytochrome c oxidase subunit II 1 1
MIRT052291 NFU1 NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) 1 1
MIRT052292 GPHN gephyrin 1 1
MIRT052293 BCAT1 branched chain amino-acid transaminase 1, cytosolic 1 1
MIRT052294 NSUN2 NOP2/Sun domain family, member 2 1 1
MIRT052295 MSI1 musashi homolog 1 (Drosophila) 1 1
MIRT052296 DAB2IP DAB2 interacting protein 1 1
MIRT052297 ARL6IP1 ADP-ribosylation factor-like 6 interacting protein 1 1 1
MIRT052298 MANSC1 MANSC domain containing 1 1 1
MIRT052299 KDELR1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 1 1
MIRT052300 YIPF3 Yip1 domain family, member 3 1 1
MIRT052301 ASPA aspartoacylase (Canavan disease) 1 1
MIRT052302 GTF3C1 general transcription factor IIIC, polypeptide 1, alpha 220kDa 1 1
MIRT052303 SCML2 sex comb on midleg-like 2 (Drosophila) 1 1
MIRT052304 PDCL3 phosducin-like 3 1 1
MIRT052305 RBBP6 retinoblastoma binding protein 6 1 1
MIRT052306 IPO11 importin 11 1 1
MIRT052307 PRAF2 PRA1 domain family, member 2 1 1
MIRT052308 TPD52L2 tumor protein D52-like 2 1 1
MIRT052309 VPS28 vacuolar protein sorting 28 homolog (S. cerevisiae) 1 1
MIRT052310 CBX6 chromobox homolog 6 1 1
MIRT052311 CTCF CCCTC-binding factor (zinc finger protein) 1 1
MIRT052312 LARP1 La ribonucleoprotein domain family, member 1 1 1
MIRT052313 RPL18A ribosomal protein L18a 1 1
MIRT052314 AIDA axin interactor, dorsalization associated 1 1
MIRT052315 CUL2 cullin 2 1 1
MIRT052316 SMG1 SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) 1 1
MIRT052317 SNRPA small nuclear ribonucleoprotein polypeptide A 1 1
MIRT052318 CBX5 chromobox homolog 5 (HP1 alpha homolog, Drosophila) 1 1
MIRT052319 TNPO1 transportin 1 1 1
MIRT052320 MCM7 minichromosome maintenance complex component 7 1 1
MIRT052321 GGPS1 geranylgeranyl diphosphate synthase 1 1 1
MIRT052322 ZCCHC11 zinc finger, CCHC domain containing 11 1 1
MIRT052323 SETD5 SET domain containing 5 1 1
MIRT052324 GCN1L1 GCN1 general control of amino-acid synthesis 1-like 1 (yeast) 1 1
MIRT052325 RBM22 RNA binding motif protein 22 1 1
MIRT052326 TXLNA taxilin alpha 1 1
MIRT052327 IL17RC interleukin 17 receptor C 1 1
MIRT052328 SPN sialophorin 1 1
MIRT052329 IPCEF1 interaction protein for cytohesin exchange factors 1 1 1
MIRT052330 TOR4A chromosome 9 open reading frame 167 1 1
MIRT052331 WBP11 WW domain binding protein 11 1 1
MIRT052332 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 1 1
MIRT052333 CTR9 Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT052334 GBF1 golgi brefeldin A resistant guanine nucleotide exchange factor 1 1 1
MIRT052335 C11orf52 chromosome 11 open reading frame 52 1 1
MIRT052336 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble) 1 1
MIRT052337 HK1 hexokinase 1 1 1
MIRT052338 HTT huntingtin 1 1
MIRT052339 PCGF3 polycomb group ring finger 3 1 1
MIRT052340 TSPAN3 tetraspanin 3 1 1
MIRT052341 USP14 ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase) 1 1
MIRT052342 CUX1 cut-like homeobox 1 1 1
MIRT052343 SOX13 SRY (sex determining region Y)-box 13 1 1
MIRT052344 MESDC1 mesoderm development candidate 1 1 1
MIRT052345 ATP1A1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 1 1
MIRT052346 FGFRL1 fibroblast growth factor receptor-like 1 1 1
MIRT052347 LMAN2 lectin, mannose-binding 2 1 1
MIRT052348 MTUS1 microtubule associated tumor suppressor 1 1 1
MIRT052349 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT052350 NHSL1 NHS-like 1 1 1
MIRT052351 NDRG1 N-myc downstream regulated 1 1 1
MIRT052352 CCDC71 coiled-coil domain containing 71 1 1
MIRT052353 AATF apoptosis antagonizing transcription factor 1 1
MIRT052354 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT052355 MOV10 Mov10, Moloney leukemia virus 10, homolog (mouse) 1 1
MIRT052356 DHX9 DEAH (Asp-Glu-Ala-His) box polypeptide 9 1 1
MIRT052357 C10orf118 chromosome 10 open reading frame 118 1 1
MIRT052358 CCNG1 cyclin G1 1 1
MIRT052359 WNK1 WNK lysine deficient protein kinase 1 1 1