Accession ID: MIRT052607 [miRNA, hsa-let-7a-5p :: SLC35C1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-let-7a-1LinkOut: [miRBase ]
Synonyms LET7A1, MIRNLET7A1, let-7a-1, MIRLET7A1
Description Homo sapiens let-7a-1 stem-loop
Comment let-7a-3p cloned in has a 1 nt 3' extension (U), which is incompatible with the genome sequence.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-let-7a-5p
Mature Sequence 6| UGAGGUAGUAGGUUGUAUAGUU |27
Evidence Experimental
Experiments Northern
Putative hsa-let-7a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol SLC35C1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CDG2C, FLJ11320, FLJ14841, FUCT1
Description solute carrier family 35, member C1
Transcript NM_0011452    LinkOut: [ RefSeq ]
Other Transcripts NM_0011452 , NM_0183   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on SLC35C1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of SLC35C1
(miRNA target sites are highlighted)
>SLC35C1|NM_0011452|3'UTR
   1 TGAGCACCACAGGCACCCTGGATGGCCCGGCCCCGGGGCCCGTACACAGGCGGGGCCAGCACAGTAGTGAAGGCGGTCTC
  81 CTGGACCCCAGAAGCGTGCTGTGGTGTGGACTGGGTGCTACTTATAGACCCAATCAGAATACGGTGGTTGAGAAGGAACC
 161 AGTGTTTACAAGTAATATCAGAAAGTTGAAGGAACCAGTGTTTACAAGTAATACCAGAAAGTTGCCAAACCCTTCTCTAT
 241 CCTCTCGTATTTCTGAGTTTTTGTCCTTCCCGAGGGAGCACCCTAGTGAGAGTTGAACCCCTTCCTTCTGCCTCCAGGGC
 321 CTGTCTGCCTCCACATCACTCTGAGGACAGGGACAGGCAACAACCTTGAAGGGACAGCAATGGCAAAGCCACAAAGGCTT
 401 CACTGTACTCAGGGGAGATGGCCCTACCACAGCCACCTGGAGAGGGTTGGGAAGCCTTCCGTCTGCGGTGGGCAGGCAGC
 481 CTCACCCTGGGCCCACAGACCGGCCTTCCTTTGGAGGAAAGTGTGGCCTGGACTGAGGGAGGAAATGAGCGAGTTCCCTC
 561 TGACACCAGCAGATCCCCAGGGGCTGCTGGGCAGTGGCCTGGGAATGGGGTGGATTGTGAGAAAGTGCTCACCATCTATA
 641 CACCCTGTATGTCCAGCTTTTGAACACAAGGGAACCATGCTTCTCTTAGAGGTTAAGCAGGGTCATTAACATCCTCCCCC
 721 AGTCCCTAACATCACATTGTCCTGCGTGGCTCCTCTGGCCCTGAGTGGCACCTGTCCCTCTGGTCTCCCAGCACCTGGCC
 801 CAGGTAACAGCCTTCTGAAAGCAGAGCCAAGGAGCTGCTTCTCTCTTCTCCCAGTTCTACCTCCCCAGAAGCCTTCCTCC
 881 CCAGGTGGGGCTGATGGAGCAAGGGTCCAGACTAGGAGCCTTCCACCCCAGCTGTGTCTGGCGCCCCTAGATCTCTGCAA
 961 GGGAGGTGTTACAGCTGGTTCTGAGCCGCTTGCCTTGTGATGGTAAGACACCAACCTTTACATTCTTCCCTGAGGTTGTG
1041 GCTGACAGAGCCTGCTTGGCCCCACTGTTAGTCCAGCGAGCTCCTATATCAAAATGCCGTAGGCCGGGTGGCTTACAAAC
1121 AACAGAAACGTATTGCTCACAGTCCTGGGGGGCTGGGACGCCCAAGATCAAGAGGCCAGCAGATTCGGACTCCGCTGAGG
1201 GCTGTTTCCCGATCCATAGATGGTGCCTTCTCGCTGTATCCTCAATGGTAGAAGCACAAACAAGCAAGCTCCTTCCTGCC
1281 TCTTTTATAAGGACTCCAACCCTGTTCATGAGGGTTCCGCCCCCATGACCCAATCAGCTCCAAAGGCCCCACCTCCTAAT
1361 ACTGTCACCTTGGGGGTGAGAATTCCAATGTGAATTTGCAGGGGGAGTGGGGGACACACACAAATTTCGGGGCCATACCA
1441 CCCTTCACCACACCCTCCTGCGCTCAGGGTGGCTTGCAGTCCCTGGCCCTTCTGGTGGGCATTTGGTATGTCCTTTCTCT
1521 TGGGGTGATTTCTGATGTTTTTACTCTATATAGTGAAAAGCTAGGGAGAGCGGGTCTTCTCCCCCCTCCCTCTCCAGTCC
1601 CCTCACAATCCCAGATGGGTTCTAATGCAGCTGCTGGGGCCTGATGCCCTGAGTTGTTTGTGATTCAATAAAGAATCCAT
1681 AAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uuGAUAUGUUGG--AUGAUGGAGu 5'
            || | |  ||  | ||||||| 
Target 5' ctCTCTTCTCCCAGTTCTACCTCc 3'
841 - 864 150.00 -10.60
2
miRNA  3' uuGAUAUGUUGGAU-GAUGGAGu 5'
            ||  | ::|||: ||:|||| 
Target 5' gcCTCCAGGGCCTGTCTGCCTCc 3'
310 - 332 140.00 -15.60
3
miRNA  3' uugaUAUGUU----GGAUGAUGGAGu 5'
              | :|||    |:| ||:|||| 
Target 5' aaacAAGCAAGCTCCTTCCTGCCTCt 3'
1258 - 1283 136.00 -13.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-let-7a-5p :: SLC35C1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 5'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' ttgataTGTTGGATGATGGAGt 5'
                |:||||| ||:|||| 
Target 5' -cttcaATAACCT-CTGCCTCa 3'
1 - 20
2
miRNA  3' ttGATATGTTGGATGATGgagt 5'
            | :|::::||| ||||    
Target 5' gtCGGTGTGGCCTTCTACaatg 3'
26 - 47
Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
343 hsa-let-7a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000415 CDK6 cyclin-dependent kinase 6 2 2
MIRT000416 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT000417 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 3 5
MIRT000418 BCL2 B-cell CLL/lymphoma 2 3 1
MIRT000463 NKIRAS2 NFKB inhibitor interacting Ras-like 2 4 1
MIRT000708 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 4 1
MIRT001853 NF2 neurofibromin 2 (merlin) 5 2
MIRT001854 NRAS neuroblastoma RAS viral (v-ras) oncogene homolog 4 2
MIRT001855 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 5 4
MIRT001936 PRDM1 PR domain containing 1, with ZNF domain 4 2
MIRT002027 lin-41 abnormal cell LINeage 2 1
MIRT002077 TRIM71 tripartite motif-containing 71 2 3
MIRT002078 FOXA1 forkhead box A1 2 1
MIRT002079 NR1I2 nuclear receptor subfamily 1, group I, member 2 2 1
MIRT002080 VDR vitamin D (1,25- dihydroxyvitamin D3) receptor 2 1
MIRT002305 RAVER2 ribonucleoprotein, PTB-binding 2 3 1
MIRT002323 HMGA2 high mobility group AT-hook 2 5 8
MIRT003152 HMGA1 high mobility group AT-hook 1 5 3
MIRT003522 EIF2C4 eukaryotic translation initiation factor 2C, 4 2 1
MIRT003752 trim71 tripartite motif-containing 71 2 1
MIRT003902 APP amyloid beta (A4) precursor protein 2 1
MIRT003904 E2F1 E2F transcription factor 1 2 1
MIRT003974 wech CG42396 gene product from transcript CG42396-RC 2 1
MIRT004321 UHRF2 ubiquitin-like with PHD and ring finger domains 2 4 1
MIRT004346 DICER1 dicer 1, ribonuclease type III 4 2
MIRT004471 HRAS v-Ha-ras Harvey rat sarcoma viral oncogene homolog 4 3
MIRT004520 IGF2 insulin-like growth factor 2 (somatomedin A) 2 1
MIRT004801 LIN28A lin-28 homolog A (C. elegans) 3 2
MIRT004830 NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 3 1
MIRT004957 ZFP36L1 zinc finger protein 36, C3H type-like 1 2 1
MIRT004958 THBS1 thrombospondin 1 2 1
MIRT004959 TUSC2 tumor suppressor candidate 2 2 1
MIRT004960 SLC20A1 solute carrier family 20 (phosphate transporter), member 1 2 1
MIRT004961 NEFM neurofilament, medium polypeptide 2 1
MIRT004962 MEIS1 Meis homeobox 1 2 1
MIRT004963 EGR3 early growth response 3 2 1
MIRT004964 HNRPDL heterogeneous nuclear ribonucleoprotein D-like 2 1
MIRT004965 AMMECR1 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 2 1
MIRT005292 CASP3 caspase 3, apoptosis-related cysteine peptidase 3 1
MIRT005293 CASP8 caspase 8, apoptosis-related cysteine peptidase 2 1
MIRT005294 CASP9 caspase 9, apoptosis-related cysteine peptidase 2 1
MIRT005420 IL6 interleukin 6 (interferon, beta 2) 4 1
MIRT005477 E2F2 E2F transcription factor 2 4 1
MIRT005478 CCND2 cyclin D2 4 1
MIRT006055 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 2 1
MIRT006056 CDC34 cell division cycle 34 homolog (S. cerevisiae) 2 1
MIRT006152 EWSR1 Ewing sarcoma breakpoint region 1 4 1
MIRT006405 MPL myeloproliferative leukemia virus oncogene 1 1
MIRT006813 CCR7 chemokine (C-C motif) receptor 7 3 1
MIRT032499 ACP1 acid phosphatase 1, soluble 1 1
MIRT032500 MED28 mediator complex subunit 28 1 1
MIRT032501 EIF3J eukaryotic translation initiation factor 3, subunit J 1 1
MIRT032502 SMOX spermine oxidase 1 1
MIRT032503 DAD1 defender against cell death 1 1 1
MIRT032504 RTCA RNA terminal phosphate cyclase domain 1 1 1
MIRT032505 TMED7 transmembrane emp24 protein transport domain containing 7 1 1
MIRT032506 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 1
MIRT035534 HAS2 hyaluronan synthase 2 1 1
MIRT035541 EGFR epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) 1 1
MIRT052360 RIOK3 RIO kinase 3 (yeast) 1 1
MIRT052361 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT052362 FAM105B family with sequence similarity 105, member B 1 1
MIRT052363 TMEM39A transmembrane protein 39A 1 1
MIRT052364 UPP2 uridine phosphorylase 2 1 1
MIRT052365 SYNPR synaptoporin 1 1
MIRT052366 ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 1 1
MIRT052367 MEPCE methylphosphate capping enzyme 1 1
MIRT052368 PSMA2 proteasome (prosome, macropain) subunit, alpha type, 2 1 1
MIRT052369 NDUFAF3 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3 1 1
MIRT052370 GP5 glycoprotein V (platelet) 1 1
MIRT052371 GPN1 GPN-loop GTPase 1 1 1
MIRT052372 CIRH1A cirrhosis, autosomal recessive 1A (cirhin) 1 1
MIRT052373 ZNF555 zinc finger protein 555 1 1
MIRT052374 UBE3C ubiquitin protein ligase E3C 1 1
MIRT052375 LHFPL2 lipoma HMGIC fusion partner-like 2 1 1
MIRT052376 MRPL15 mitochondrial ribosomal protein L15 1 1
MIRT052377 HIST2H2BF histone cluster 2, H2bf 1 1
MIRT052378 CEP170B KIAA0284 1 1
MIRT052379 SMPDL3B sphingomyelin phosphodiesterase, acid-like 3B 1 1
MIRT052380 HIST2H2BE histone cluster 2, H2be 1 1
MIRT052381 CDC7 cell division cycle 7 homolog (S. cerevisiae) 1 1
MIRT052382 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 1 1
MIRT052383 COX2 cytochrome c oxidase subunit II 1 1
MIRT052384 BCAT1 branched chain amino-acid transaminase 1, cytosolic 1 1
MIRT052385 RRM2 ribonucleotide reductase M2 1 1
MIRT052386 FNDC3A fibronectin type III domain containing 3A 1 1
MIRT052387 ZCCHC9 zinc finger, CCHC domain containing 9 1 1
MIRT052388 CD276 CD276 molecule 1 1
MIRT052389 PHF6 PHD finger protein 6 1 1
MIRT052390 FAM13C family with sequence similarity 13, member C 1 1
MIRT052391 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT052392 ACVR1B activin A receptor, type IB 1 1
MIRT052393 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 1
MIRT052394 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT052395 UBAP2 ubiquitin associated protein 2 1 1
MIRT052396 RPL9 ribosomal protein L9 1 1
MIRT052397 TRIM5 tripartite motif-containing 5 1 1
MIRT052398 DNAJC6 DnaJ (Hsp40) homolog, subfamily C, member 6 1 1
MIRT052399 GLUL glutamate-ammonia ligase 1 1
MIRT052400 HIST1H4D histone cluster 1, H4d 1 1
MIRT052401 FOXJ3 forkhead box J3 1 1
MIRT052402 PHTF2 putative homeodomain transcription factor 2 1 1
MIRT052403 ACTB actin, beta 1 1
MIRT052404 NID2 nidogen 2 (osteonidogen) 1 1
MIRT052405 ANO6 anoctamin 6 1 1
MIRT052406 CS citrate synthase 1 1
MIRT052407 BTBD1 BTB (POZ) domain containing 1 1 1
MIRT052408 NCBP1 nuclear cap binding protein subunit 1, 80kDa 1 1
MIRT052409 LMNA lamin A/C 1 1
MIRT052410 RBMXL1 RNA binding motif protein, X-linked-like 1 1 1
MIRT052411 JAZF1 JAZF zinc finger 1 1 1
MIRT052412 RPS3A ribosomal protein S3A 1 1
MIRT052413 ZNF629 zinc finger protein 629 1 1
MIRT052414 SIK1 salt-inducible kinase 1 1 1
MIRT052415 HIST1H1D histone cluster 1, H1d 1 1
MIRT052416 SESN2 sestrin 2 1 1
MIRT052417 EIF3C eukaryotic translation initiation factor 3, subunit C 1 1
MIRT052418 GPM6B glycoprotein M6B 1 1
MIRT052419 RPL30 ribosomal protein L30 1 1
MIRT052420 ARL6IP6 ADP-ribosylation-like factor 6 interacting protein 6 1 1
MIRT052421 FBXW2 F-box and WD repeat domain containing 2 1 1
MIRT052422 POU3F2 POU class 3 homeobox 2 1 1
MIRT052423 TTC22 tetratricopeptide repeat domain 22 1 1
MIRT052424 LRRC37A2 leucine rich repeat containing 37, member A2 1 1
MIRT052425 GCN1L1 GCN1 general control of amino-acid synthesis 1-like 1 (yeast) 1 1
MIRT052426 IVD isovaleryl-CoA dehydrogenase 1 1
MIRT052427 RQCD1 RCD1 required for cell differentiation1 homolog (S. pombe) 1 1
MIRT052428 KIAA2026 KIAA2026 1 1
MIRT052429 COX1 cytochrome c oxidase subunit I 1 1
MIRT052430 NAA35 N(alpha)-acetyltransferase 35, NatC auxiliary subunit 1 1
MIRT052431 SHMT2 serine hydroxymethyltransferase 2 (mitochondrial) 1 1
MIRT052432 ATP6 ATP synthase F0 subunit 6 1 1
MIRT052433 GTF2I general transcription factor IIi 1 1
MIRT052434 KRTAP19-1 keratin associated protein 19-1 1 1
MIRT052435 RPL4 ribosomal protein L4 1 1
MIRT052436 TMEM165 transmembrane protein 165 1 1
MIRT052437 GTF3C5 general transcription factor IIIC, polypeptide 5, 63kDa 1 1
MIRT052438 KIAA1147 KIAA1147 1 1
MIRT052439 C9orf37 chromosome 9 open reading frame 37 1 1
MIRT052440 C11orf57 chromosome 11 open reading frame 57 1 1
MIRT052441 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT052442 ZNF609 zinc finger protein 609 1 1
MIRT052443 TMEM64 transmembrane protein 64 1 1
MIRT052444 EXPH5 exophilin 5 1 1
MIRT052445 AKAP17A splicing factor, arginine/serine-rich 17A 1 1
MIRT052446 ATG4C ATG4 autophagy related 4 homolog C (S. cerevisiae) 1 1
MIRT052447 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT052448 WWP2 WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT052449 RPS15A ribosomal protein S15a 1 1
MIRT052450 RPS10 ribosomal protein S10 1 1
MIRT052451 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT052452 AOC2 amine oxidase, copper containing 2 (retina-specific) 1 1
MIRT052453 SP1 Sp1 transcription factor 1 1
MIRT052454 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT052455 CAMK2D calcium/calmodulin-dependent protein kinase II delta 1 1
MIRT052456 CD2AP CD2-associated protein 1 1
MIRT052457 H1F0 H1 histone family, member 0 1 1
MIRT052458 VAV2 vav 2 guanine nucleotide exchange factor 1 1
MIRT052459 RPSA ribosomal protein SA 1 1
MIRT052460 NEU3 sialidase 3 (membrane sialidase) 1 1
MIRT052461 UBAP2L ubiquitin associated protein 2-like 1 1
MIRT052462 GORASP2 golgi reassembly stacking protein 2, 55kDa 1 1
MIRT052463 ANKRD17 ankyrin repeat domain 17 1 1
MIRT052464 IPO7 importin 7 1 1
MIRT052465 CFL2 cofilin 2 (muscle) 1 1
MIRT052466 ZMYM3 zinc finger, MYM-type 3 1 1
MIRT052467 RBM6 RNA binding motif protein 6 1 1
MIRT052468 TAF9B TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa 1 1
MIRT052469 SKA3 spindle and kinetochore associated complex subunit 3 1 1
MIRT052470 DDX18 DEAD (Asp-Glu-Ala-Asp) box polypeptide 18 1 1
MIRT052471 FARSA phenylalanyl-tRNA synthetase, alpha subunit 1 1
MIRT052472 BNIP3L BCL2/adenovirus E1B 19kDa interacting protein 3-like 1 1
MIRT052473 VGLL4 vestigial like 4 (Drosophila) 1 1
MIRT052474 BUD13 BUD13 homolog (S. cerevisiae) 1 1
MIRT052475 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT052476 NUDT4 nudix (nucleoside diphosphate linked moiety X)-type motif 4 1 1
MIRT052477 SNRPC small nuclear ribonucleoprotein polypeptide C 1 1
MIRT052478 SPATS2 spermatogenesis associated, serine-rich 2 1 1
MIRT052479 REPS1 RALBP1 associated Eps domain containing 1 1 1
MIRT052480 TRAF7 TNF receptor-associated factor 7 1 1
MIRT052481 CD55 CD55 molecule, decay accelerating factor for complement (Cromer blood group) 1 1
MIRT052482 PNRC1 proline-rich nuclear receptor coactivator 1 1 1
MIRT052483 SETD7 SET domain containing (lysine methyltransferase) 7 1 1
MIRT052484 ERN1 endoplasmic reticulum to nucleus signaling 1 1 1
MIRT052485 NDUFS2 NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase) 1 1
MIRT052486 MRS2 MRS2 magnesium homeostasis factor homolog (S. cerevisiae) 1 1
MIRT052487 TARS threonyl-tRNA synthetase 1 1
MIRT052488 HUWE1 HECT, UBA and WWE domain containing 1 1 1
MIRT052489 PAXBP1 GC-rich sequence DNA-binding factor 1 1 1
MIRT052490 LIX1L Lix1 homolog (mouse)-like 1 1
MIRT052491 RAD21 RAD21 homolog (S. pombe) 1 1
MIRT052492 ND1 NADH dehydrogenase, subunit 1 (complex I) 1 1
MIRT052493 ZNF644 zinc finger protein 644 1 1
MIRT052494 SAMD4B sterile alpha motif domain containing 4B 1 1
MIRT052495 ASPM asp (abnormal spindle) homolog, microcephaly associated (Drosophila) 1 1
MIRT052496 ZNF746 zinc finger protein 746 1 1
MIRT052497 ND2 MTND2 1 1
MIRT052498 RPS4X ribosomal protein S4, X-linked 1 1
MIRT052499 NPC1 Niemann-Pick disease, type C1 1 1
MIRT052500 ITM2B integral membrane protein 2B 1 1
MIRT052501 RPS13 ribosomal protein S13 1 1
MIRT052502 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1 1 1
MIRT052503 CARHSP1 calcium regulated heat stable protein 1, 24kDa 1 1
MIRT052504 CNTRL centrosomal protein 110kDa 1 1
MIRT052505 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 1 1
MIRT052506 ARID3B AT rich interactive domain 3B (BRIGHT-like) 1 1
MIRT052507 LILRB4 leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 1 1
MIRT052508 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 1
MIRT052509 SRSF2 splicing factor, arginine/serine-rich 2 1 1
MIRT052510 CLPB ClpB caseinolytic peptidase B homolog (E. coli) 1 1
MIRT052511 DEGS1 degenerative spermatocyte homolog 1, lipid desaturase (Drosophila) 1 1
MIRT052512 LTA4H leukotriene A4 hydrolase 1 1
MIRT052513 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT052514 HDAC5 histone deacetylase 5 1 1
MIRT052515 MTFR1L family with sequence similarity 54, member B 1 1
MIRT052516 NUDT5 nudix (nucleoside diphosphate linked moiety X)-type motif 5 1 1
MIRT052517 JPH4 junctophilin 4 1 1
MIRT052518 TAF5L TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa 1 1
MIRT052519 MED13L mediator complex subunit 13-like 1 1
MIRT052520 FKBP8 FK506 binding protein 8, 38kDa 1 1
MIRT052521 ZNF780A zinc finger protein 780A 1 1
MIRT052522 BSDC1 BSD domain containing 1 1 1
MIRT052523 HMGN2 high-mobility group nucleosomal binding domain 2 1 1
MIRT052524 SLC35A4 solute carrier family 35, member A4 1 1
MIRT052525 UBE2Q1 ubiquitin-conjugating enzyme E2Q family member 1 1 1
MIRT052526 B4GALNT3 beta-1,4-N-acetyl-galactosaminyl transferase 3 1 1
MIRT052527 USP14 ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase) 1 1
MIRT052528 HOXC4 homeobox C4 1 1
MIRT052529 PTGES2 prostaglandin E synthase 2 1 1
MIRT052530 HSF2 heat shock transcription factor 2 1 1
MIRT052531 FAM171A2 family with sequence similarity 171, member A2 1 1
MIRT052532 CAND2 cullin-associated and neddylation-dissociated 2 (putative) 1 1
MIRT052533 TMEM241 chromosome 18 open reading frame 45 1 1
MIRT052534 S100PBP S100P binding protein 1 1
MIRT052535 AIDA axin interactor, dorsalization associated 1 1
MIRT052536 RANBP2 RAN binding protein 2 1 1
MIRT052537 MAPK11 mitogen-activated protein kinase 11 1 1
MIRT052538 BMPR1B bone morphogenetic protein receptor, type IB 1 1
MIRT052539 ADSL adenylosuccinate lyase 1 1
MIRT052540 SNX2 sorting nexin 2 1 1
MIRT052541 MTUS1 microtubule associated tumor suppressor 1 1 1
MIRT052542 PIGN phosphatidylinositol glycan anchor biosynthesis, class N 1 1
MIRT052543 HOXA6 homeobox A6 1 1
MIRT052544 DHX57 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 1 1
MIRT052545 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 1
MIRT052546 PCIF1 PDX1 C-terminal inhibiting factor 1 1 1
MIRT052547 UBOX5 U-box domain containing 5 1 1
MIRT052548 PEX14 peroxisomal biogenesis factor 14 1 1
MIRT052549 TMX2 thioredoxin-related transmembrane protein 2 1 1
MIRT052550 RAVER1 ribonucleoprotein, PTB-binding 1 1 1
MIRT052551 BCL2L11 BCL2-like 11 (apoptosis facilitator) 1 1
MIRT052552 G2E3 G2/M-phase specific E3 ubiquitin ligase 1 1
MIRT052553 BAZ1B bromodomain adjacent to zinc finger domain, 1B 1 1
MIRT052554 DYNC2H1 dynein, cytoplasmic 2, heavy chain 1 1 1
MIRT052555 CDC25B cell division cycle 25 homolog B (S. pombe) 1 1
MIRT052556 TTC26 tetratricopeptide repeat domain 26 1 1
MIRT052557 LRRC42 leucine rich repeat containing 42 1 1
MIRT052558 NME4 non-metastatic cells 4, protein expressed in 1 1
MIRT052559 GGPS1 geranylgeranyl diphosphate synthase 1 1 1
MIRT052560 LARP1 La ribonucleoprotein domain family, member 1 1 1
MIRT052561 MTHFD1 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase 1 1
MIRT052562 WDR46 WD repeat domain 46 1 1
MIRT052563 TRRAP transformation/transcription domain-associated protein 1 1
MIRT052564 ARRDC3 arrestin domain containing 3 1 1
MIRT052565 MAP3K1 mitogen-activated protein kinase kinase kinase 1 1 1
MIRT052566 EZH2 enhancer of zeste homolog 2 (Drosophila) 1 1
MIRT052567 HOXB4 homeobox B4 1 1
MIRT052568 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT052569 SF3A1 splicing factor 3a, subunit 1, 120kDa 1 1
MIRT052570 F2R coagulation factor II (thrombin) receptor 1 1
MIRT052571 SNX6 sorting nexin 6 1 1
MIRT052572 GADD45GIP1 growth arrest and DNA-damage-inducible, gamma interacting protein 1 1 1
MIRT052573 MCM3AP minichromosome maintenance complex component 3 associated protein 1 1
MIRT052574 KDM6B lysine (K)-specific demethylase 6B 1 1
MIRT052575 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT052576 ANGEL2 angel homolog 2 (Drosophila) 1 1
MIRT052577 RPL35A ribosomal protein L35a 1 1
MIRT052578 FNIP1 folliculin interacting protein 1 1 1
MIRT052579 ATP2B1 ATPase, Ca++ transporting, plasma membrane 1 1 1
MIRT052580 TAF5 TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa 1 1
MIRT052581 ASCC3 activating signal cointegrator 1 complex subunit 3 1 1
MIRT052582 BPTF bromodomain PHD finger transcription factor 1 1
MIRT052583 PAQR5 progestin and adipoQ receptor family member V 1 1
MIRT052584 SPTBN1 spectrin, beta, non-erythrocytic 1 1 1
MIRT052585 MIB1 mindbomb homolog 1 (Drosophila) 1 1
MIRT052586 RPS24 ribosomal protein S24 1 1
MIRT052587 WDR6 WD repeat domain 6 1 1
MIRT052588 CYP2R1 cytochrome P450, family 2, subfamily R, polypeptide 1 1 1
MIRT052589 TCERG1 transcription elongation regulator 1 1 1
MIRT052590 GBF1 golgi brefeldin A resistant guanine nucleotide exchange factor 1 1 1
MIRT052591 CSNK2A1 casein kinase 2, alpha 1 polypeptide 1 1
MIRT052592 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT052593 QKI quaking homolog, KH domain RNA binding (mouse) 1 1
MIRT052594 UBA6 ubiquitin-like modifier activating enzyme 6 1 1
MIRT052595 ALDH7A1 aldehyde dehydrogenase 7 family, member A1 1 1
MIRT052596 ILKAP integrin-linked kinase-associated serine/threonine phosphatase 2C 1 1
MIRT052597 DPH5 DPH5 homolog (S. cerevisiae) 1 1
MIRT052598 CNBP CCHC-type zinc finger, nucleic acid binding protein 1 1
MIRT052599 TRIO triple functional domain (PTPRF interacting) 1 1
MIRT052600 NDUFAF7 chromosome 2 open reading frame 56 1 1
MIRT052601 NFATC2IP nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein 1 1
MIRT052602 PREB prolactin regulatory element binding 1 1
MIRT052603 BIRC6 baculoviral IAP repeat-containing 6 1 1
MIRT052604 MYO9A myosin IXA 1 1
MIRT052605 RAB13 RAB13, member RAS oncogene family 1 1
MIRT052606 SMG7 Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans) 1 1
MIRT052607 SLC35C1 solute carrier family 35, member C1 1 1
MIRT052608 GTF3C1 general transcription factor IIIC, polypeptide 1, alpha 220kDa 1 1
MIRT052609 NPTX1 neuronal pentraxin I 1 1
MIRT052610 MRPS2 mitochondrial ribosomal protein S2 1 1
MIRT052611 DHX9 DEAH (Asp-Glu-Ala-His) box polypeptide 9 1 1
MIRT052612 NUPL1 nucleoporin like 1 1 1
MIRT052613 UNK unkempt homolog (Drosophila) 1 1
MIRT052614 COPZ1 coatomer protein complex, subunit zeta 1 1 1
MIRT052615 UHRF1 ubiquitin-like with PHD and ring finger domains 1 1 1
MIRT052616 TSPAN3 tetraspanin 3 1 1
MIRT052617 KCTD1 potassium channel tetramerisation domain containing 1 1 1
MIRT052618 PLOD1 procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1 1 1
MIRT052619 RBFOX2 RNA binding motif protein 9 1 1
MIRT052620 COX14 chromosome 12 open reading frame 62 1 1
MIRT052621 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT052622 C7orf60 chromosome 7 open reading frame 60 1 1
MIRT052623 C2CD4A C2 calcium-dependent domain containing 4A 1 1
MIRT052624 DSC3 desmocollin 3 1 1
MIRT052625 PDE4DIP phosphodiesterase 4D interacting protein 1 1
MIRT052626 SEL1L3 sel-1 suppressor of lin-12-like 3 (C. elegans) 1 1
MIRT052627 PALD1 KIAA1274 1 1
MIRT052628 METTL6 methyltransferase like 6 1 1
MIRT052629 CRYBG3 beta-gamma crystallin domain containing 3 1 1
MIRT052630 ZNF264 zinc finger protein 264 1 1
MIRT052631 CTDP1 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1 1 1
MIRT052632 ATXN2L ataxin 2-like 1 1
MIRT052633 BCOR BCL6 corepressor 1 1
MIRT052634 IARS isoleucyl-tRNA synthetase 1 1
MIRT052635 SYVN1 synovial apoptosis inhibitor 1, synoviolin 1 1
MIRT052636 ZNF260 zinc finger protein 260 1 1
MIRT052637 CCNB2 cyclin B2 1 1
MIRT052638 SFSWAP splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot homolog, Drosophila) 1 1
MIRT052639 ACAD8 acyl-CoA dehydrogenase family, member 8 1 1
MIRT052640 INTS12 integrator complex subunit 12 1 1
MIRT052641 NIPBL Nipped-B homolog (Drosophila) 1 1
MIRT052642 SESN1 sestrin 1 1 1
MIRT052643 CCNG1 cyclin G1 1 1