Accession ID: MIRT052670 [miRNA, hsa-miR-1260b :: ACAT1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-1260bLinkOut: [miRBase ]
Description Homo sapiens miR-1260b stem-loop
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-1260b
Mature Sequence 10| AUCCCACCACUGCCACCAU |28
Evidence Experimental
Experiments Solexa
Putative hsa-miR-1260b Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol ACAT1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ACAT, MAT, T2, THIL
Description acetyl-CoA acetyltransferase 1
Transcript NM_0000    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on ACAT1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of ACAT1
(miRNA target sites are highlighted)
>ACAT1|NM_0000|3'UTR
   1 TAGACAACCTCTGCTATTTAAGGAGACAACCCTATGTGACCAGAAGGCCTGCTGTAATCAGTGTGACTACTGTGGGTCAG
  81 CTTATATTCAGATAAGCTGTTTCATTTTTTATTATTTTCTATGTTAACTTTTAAAAATCAAAATGATGAAATCCCAAAAC
 161 ATTTTGAAATTAAAAATAAATTTCTTCTTCTGCTTTTTTCTTGGTAACCTTGAAAAGTTTGATACATTTTTGCATTCTGA
 241 GTCTATACTTATCGAAATATGGTAGAAATACCAATGTGTAATATTAGTGACTTACATAAGTAGCTAGAAGTTTCCATTTG
 321 TGAGAACACATTTATATTTTTGAGGATTGTTAAAGGTCAAGTGAATGCTCTTTATAGGTAATTTACATTTAGTAAATTAC
 401 GGTAAATTAAATTACTTCTCTTTACAGTAAGAGTTGGCTATTCTGGACAAACTAGCAGTGCTTCATATAATCACTCAAAC
 481 CACAGTGTGTGCAGCAGTACTAGAAACAAGACAGAAGCCCATGTCCTCAGGGTCTAGAGTGGGGGCAATTTCTTATAACC
 561 TCAACATTCAGGGTTGGGGGAGGTCAAGCAGAAAACCCTGGAGTTTGGGCTCTGAATTACTATAGCAGCATAGAGAGTGG
 641 GAAGGGAGGTAGAAACTGATATGCTGAATGGATATATAAAAAAGGGAACAGATCACCACTTCCAATACACGACAATGCCT
 721 GTTCTTAAGCAGGACAGACTGTAACAGAAGTATCTCGCATTGCATTTTATCTGGGAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uaccaccgucacCACCCUa 5'
                      |||||| 
Target 5' gcagcatagagaGTGGGAa 3'
625 - 643 120.00 -10.50
2
miRNA  3' uaccaccgucacCACCCUa 5'
                      |||||: 
Target 5' tcagggtctagaGTGGGGg 3'
527 - 545 104.00 -14.60
3
miRNA  3' uaccaccGUCACCACCCUa 5'
                 ||| | ||||: 
Target 5' caacattCAGGGTTGGGGg 3'
562 - 580 104.00 -12.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-1260b :: ACAT1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
118 hsa-miR-1260b Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT052668 TMEM167A transmembrane protein 167A 1 1
MIRT052669 CD276 CD276 molecule 1 1
MIRT052670 ACAT1 acetyl-CoA acetyltransferase 1 1 1
MIRT052671 DNMT1 DNA (cytosine-5-)-methyltransferase 1 1 1
MIRT052672 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 1 1
MIRT052673 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 1 1
MIRT052674 MCM7 minichromosome maintenance complex component 7 1 1
MIRT052675 STMN3 stathmin-like 3 1 1
MIRT052676 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 1 1
MIRT052677 C20orf24 chromosome 20 open reading frame 24 1 1
MIRT052678 PHF5A PHD finger protein 5A 1 1
MIRT052679 HLX H2.0-like homeobox 1 1
MIRT052680 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT052681 RPL3 ribosomal protein L3 1 1
MIRT052682 RPS15 ribosomal protein S15 1 1
MIRT052683 ZNF233 zinc finger protein 233 1 1
MIRT052684 EIF4G1 eukaryotic translation initiation factor 4 gamma, 1 1 1
MIRT052685 SLC25A3 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 1 1
MIRT052686 TRIM27 tripartite motif-containing 27 1 1
MIRT052687 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 1 1
MIRT052688 USP12 ubiquitin specific peptidase 12 1 1
MIRT052689 RAN RAN, member RAS oncogene family 1 1
MIRT052690 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT052691 RPS6 ribosomal protein S6 1 1
MIRT052692 OTUD5 OTU domain containing 5 1 1
MIRT052693 VCPIP1 valosin containing protein (p97)/p47 complex interacting protein 1 1 1
MIRT052694 HOXD13 homeobox D13 1 1
MIRT052695 HIPK1 homeodomain interacting protein kinase 1 1 1
MIRT052696 MCM3 minichromosome maintenance complex component 3 1 1
MIRT052697 SLC7A1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT052698 MFN2 mitofusin 2 1 1
MIRT052699 ICMT isoprenylcysteine carboxyl methyltransferase 1 1
MIRT052700 KCNK13 potassium channel, subfamily K, member 13 1 1
MIRT052701 ENO1 enolase 1, (alpha) 1 1
MIRT052702 POLR2A polymerase (RNA) II (DNA directed) polypeptide A, 220kDa 1 1
MIRT052703 RPL36A ribosomal protein L36a 1 1
MIRT052704 CTPS1 CTP synthase 1 1
MIRT052705 MRPL24 mitochondrial ribosomal protein L24 1 1
MIRT052706 IDH2 isocitrate dehydrogenase 2 (NADP+), mitochondrial 1 1
MIRT052707 FUS fused in sarcoma 1 1
MIRT052708 USP5 ubiquitin specific peptidase 5 (isopeptidase T) 1 1
MIRT052709 DHX30 DEAH (Asp-Glu-Ala-His) box polypeptide 30 1 1
MIRT052710 CDCA4 cell division cycle associated 4 1 1
MIRT052711 TUFM Tu translation elongation factor, mitochondrial 1 1
MIRT052712 TARDBP TAR DNA binding protein 1 1
MIRT052713 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 1
MIRT052714 MTCH1 mitochondrial carrier homolog 1 (C. elegans) 1 1
MIRT052715 RPS7 ribosomal protein S7 1 1
MIRT052716 ZNF101 zinc finger protein 101 1 1
MIRT052717 PRKAR2A protein kinase, cAMP-dependent, regulatory, type II, alpha 1 1
MIRT052718 SETDB1 SET domain, bifurcated 1 1 1
MIRT052719 RPL10A ribosomal protein L10a 1 1
MIRT052720 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 1 1
MIRT052721 NBPF15 neuroblastoma breakpoint family, member 15 1 1
MIRT052722 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT052723 CKB creatine kinase, brain 1 1
MIRT052724 ZNF829 zinc finger protein 829 1 1
MIRT052725 UGT8 UDP glycosyltransferase 8 1 1
MIRT052726 TGIF2 TGFB-induced factor homeobox 2 1 1
MIRT052727 DDX3Y DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked 1 1
MIRT052728 LGALS3BP lectin, galactoside-binding, soluble, 3 binding protein 1 1
MIRT052729 JMJD6 jumonji domain containing 6 1 1
MIRT052730 RPL4 ribosomal protein L4 1 1
MIRT052731 ATAD1 ATPase family, AAA domain containing 1 1 1
MIRT052732 KIAA1715 KIAA1715 1 1
MIRT052733 AGPAT6 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta) 1 1
MIRT052734 SMOC1 SPARC related modular calcium binding 1 1 1
MIRT052735 APLP2 amyloid beta (A4) precursor-like protein 2 1 1
MIRT052736 FRAT2 frequently rearranged in advanced T-cell lymphomas 2 1 1
MIRT052737 CD81 CD81 molecule 1 1
MIRT052738 NSUN2 NOP2/Sun domain family, member 2 1 1
MIRT052739 ALDOA aldolase A, fructose-bisphosphate 1 1
MIRT052740 COPA coatomer protein complex, subunit alpha 1 1
MIRT052741 SLC39A8 solute carrier family 39 (zinc transporter), member 8 1 1
MIRT052742 NUP43 nucleoporin 43kDa 1 1
MIRT052743 KIF1C kinesin family member 1C 1 1
MIRT052744 TMEM59 transmembrane protein 59 1 1
MIRT052745 MYO5C myosin VC 1 1
MIRT052746 PRC1 protein regulator of cytokinesis 1 1 1
MIRT052747 GTF3C1 general transcription factor IIIC, polypeptide 1, alpha 220kDa 1 1
MIRT052748 TSPYL1 TSPY-like 1 1 1
MIRT052749 PARP4 poly (ADP-ribose) polymerase family, member 4 1 1
MIRT052750 OGG1 8-oxoguanine DNA glycosylase 1 1
MIRT052751 PTPRF protein tyrosine phosphatase, receptor type, F 1 1
MIRT052752 PLOD2 procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 1 1
MIRT052753 SOGA3 chromosome 6 open reading frame 174 1 1
MIRT052754 NCAPG2 non-SMC condensin II complex, subunit G2 1 1
MIRT052755 NFE2L1 nuclear factor (erythroid-derived 2)-like 1 1 1
MIRT052756 PRMT3 protein arginine methyltransferase 3 1 1
MIRT052757 EPHB4 EPH receptor B4 1 1
MIRT052758 SLC3A2 solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 1 1
MIRT052759 SNF8 SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) 1 1
MIRT052760 DHCR7 7-dehydrocholesterol reductase 1 1
MIRT052761 PPIAL4B peptidylprolyl isomerase A (cyclophilin A)-like 4B 1 1
MIRT052762 SCP2 sterol carrier protein 2 1 1
MIRT052763 CCT7 chaperonin containing TCP1, subunit 7 (eta) 1 1
MIRT052764 WDR62 WD repeat domain 62 1 1
MIRT052765 SET SET nuclear oncogene 1 1
MIRT052766 APBB2 amyloid beta (A4) precursor protein-binding, family B, member 2 1 1
MIRT052767 PSAT1 phosphoserine aminotransferase 1 1 1
MIRT052768 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT052769 SP3 Sp3 transcription factor 1 1
MIRT052770 HNRNPK heterogeneous nuclear ribonucleoprotein K 1 1
MIRT052771 PDHB pyruvate dehydrogenase (lipoamide) beta 1 1
MIRT052772 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9) 1 1
MIRT052773 MDN1 MDN1, midasin homolog (yeast) 1 1
MIRT052774 FAM134B family with sequence similarity 134, member B 1 1
MIRT052775 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) 1 1
MIRT052776 SF3B1 splicing factor 3b, subunit 1, 155kDa 1 1
MIRT052777 APP amyloid beta (A4) precursor protein 1 1
MIRT052778 RPE ribulose-5-phosphate-3-epimerase 1 1
MIRT052779 RBMXL1 RNA binding motif protein, X-linked-like 1 1 1
MIRT052780 SEC61G Sec61 gamma subunit 1 1
MIRT052781 KIAA1161 KIAA1161 1 1
MIRT052782 NOL8 nucleolar protein 8 1 1
MIRT052783 PKM pyruvate kinase, muscle 1 1
MIRT052784 CLCN2 chloride channel 2 1 1
MIRT052785 BZW1 basic leucine zipper and W2 domains 1 1 1