Accession ID: MIRT052723 [miRNA, hsa-miR-1260b :: CKB, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-1260bLinkOut: [miRBase ]
Description Homo sapiens miR-1260b stem-loop
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-1260b
Mature Sequence 10| AUCCCACCACUGCCACCAU |28
Evidence Experimental
Experiments Illumina
Putative hsa-miR-1260b Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CKB LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms B-CK, CKBB
Description creatine kinase, brain
Transcript NM_001823    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CKB LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CKB
(miRNA target sites are highlighted)
>CKB|NM_001823|3'UTR
   1 AGCCCGGCCCACACCCGACACCAGCCCTGCTGCTTCCTAACTTATTGCCTGGGCAGTGCCCACCATGCACCCCTGATGTT
  81 CGCCGTCTGGCGAGCCCTTAGCCTTGCTGTAGAGACTTCCGTCACCCTTGGTAGAGTTTATTTTTTTGATGGCTAAGATA
 161 CTGCTGATGCTGAAATAAACTAGGGTTTTGGCCTGCCTGCGTCTG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uaccaccgucACCACCcua 5'
                    |||| |   
Target 5' ccgtcaccctTGGTAGagt 3'
119 - 137 73.00 -5.30
2
miRNA  3' uaccaccgucaccACC-CUa 5'
                       ||| || 
Target 5' gatgttcgccgtcTGGCGAg 3'
75 - 94 68.00 -9.70
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-1260b :: CKB    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
271 hsa-miR-1260b Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT052668 TMEM167A transmembrane protein 167A 1 1
MIRT052669 CD276 CD276 molecule 1 1
MIRT052670 ACAT1 acetyl-CoA acetyltransferase 1 1 1
MIRT052671 DNMT1 DNA (cytosine-5-)-methyltransferase 1 1 1
MIRT052672 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 1 1
MIRT052673 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 1 1
MIRT052674 MCM7 minichromosome maintenance complex component 7 1 1
MIRT052675 STMN3 stathmin-like 3 1 1
MIRT052676 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 1 1
MIRT052677 C20orf24 chromosome 20 open reading frame 24 1 1
MIRT052678 PHF5A PHD finger protein 5A 1 1
MIRT052679 HLX H2.0-like homeobox 1 1
MIRT052680 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT052681 RPL3 ribosomal protein L3 1 1
MIRT052682 RPS15 ribosomal protein S15 1 1
MIRT052683 ZNF233 zinc finger protein 233 1 1
MIRT052684 EIF4G1 eukaryotic translation initiation factor 4 gamma, 1 1 1
MIRT052685 SLC25A3 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 1 1
MIRT052686 TRIM27 tripartite motif containing 27 1 1
MIRT052687 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 1 1
MIRT052688 USP12 ubiquitin specific peptidase 12 1 1
MIRT052689 RAN RAN, member RAS oncogene family 1 1
MIRT052690 GATAD2B GATA zinc finger domain containing 2B 1 2
MIRT052691 RPS6 ribosomal protein S6 1 1
MIRT052692 OTUD5 OTU domain containing 5 1 1
MIRT052693 VCPIP1 valosin containing protein (p97)/p47 complex interacting protein 1 1 1
MIRT052694 HOXD13 homeobox D13 1 1
MIRT052695 HIPK1 homeodomain interacting protein kinase 1 1 1
MIRT052696 MCM3 minichromosome maintenance complex component 3 1 1
MIRT052697 SLC7A1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT052698 MFN2 mitofusin 2 1 1
MIRT052699 ICMT isoprenylcysteine carboxyl methyltransferase 1 2
MIRT052700 KCNK13 potassium channel, subfamily K, member 13 1 1
MIRT052701 ENO1 enolase 1, (alpha) 1 1
MIRT052702 POLR2A polymerase (RNA) II (DNA directed) polypeptide A, 220kDa 1 1
MIRT052703 RPL36A ribosomal protein L36a 1 1
MIRT052704 CTPS1 CTP synthase 1 1 1
MIRT052705 MRPL24 mitochondrial ribosomal protein L24 1 1
MIRT052706 IDH2 isocitrate dehydrogenase 2 (NADP+), mitochondrial 1 1
MIRT052707 FUS fused in sarcoma 1 1
MIRT052708 USP5 ubiquitin specific peptidase 5 (isopeptidase T) 1 1
MIRT052709 DHX30 DEAH (Asp-Glu-Ala-His) box polypeptide 30 1 1
MIRT052710 CDCA4 cell division cycle associated 4 1 1
MIRT052711 TUFM Tu translation elongation factor, mitochondrial 1 1
MIRT052712 TARDBP TAR DNA binding protein 1 1
MIRT052713 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 1
MIRT052714 MTCH1 mitochondrial carrier 1 1 1
MIRT052715 RPS7 ribosomal protein S7 1 1
MIRT052716 ZNF101 zinc finger protein 101 1 1
MIRT052717 PRKAR2A protein kinase, cAMP-dependent, regulatory, type II, alpha 1 1
MIRT052718 SETDB1 SET domain, bifurcated 1 1 1
MIRT052719 RPL10A ribosomal protein L10a 1 1
MIRT052720 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 1 1
MIRT052721 NBPF15 neuroblastoma breakpoint family, member 15 1 1
MIRT052722 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT052723 CKB creatine kinase, brain 1 1
MIRT052724 ZNF829 zinc finger protein 829 1 1
MIRT052725 UGT8 UDP glycosyltransferase 8 1 1
MIRT052726 TGIF2 TGFB-induced factor homeobox 2 1 1
MIRT052727 DDX3Y DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked 1 1
MIRT052728 LGALS3BP lectin, galactoside-binding, soluble, 3 binding protein 1 1
MIRT052729 JMJD6 jumonji domain containing 6 1 1
MIRT052730 RPL4 ribosomal protein L4 1 1
MIRT052731 ATAD1 ATPase family, AAA domain containing 1 1 1
MIRT052732 KIAA1715 KIAA1715 1 1
MIRT052733 AGPAT6 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta) 1 2
MIRT052734 SMOC1 SPARC related modular calcium binding 1 1 1
MIRT052735 APLP2 amyloid beta (A4) precursor-like protein 2 1 1
MIRT052736 FRAT2 frequently rearranged in advanced T-cell lymphomas 2 1 1
MIRT052737 CD81 CD81 molecule 1 1
MIRT052738 NSUN2 NOP2/Sun RNA methyltransferase family, member 2 1 1
MIRT052739 ALDOA aldolase A, fructose-bisphosphate 1 1
MIRT052740 COPA coatomer protein complex, subunit alpha 1 1
MIRT052741 SLC39A8 solute carrier family 39 (zinc transporter), member 8 1 1
MIRT052742 NUP43 nucleoporin 43kDa 1 1
MIRT052743 KIF1C kinesin family member 1C 1 1
MIRT052744 TMEM59 transmembrane protein 59 1 1
MIRT052745 MYO5C myosin VC 1 1
MIRT052746 PRC1 protein regulator of cytokinesis 1 1 1
MIRT052747 GTF3C1 general transcription factor IIIC, polypeptide 1, alpha 220kDa 1 1
MIRT052748 TSPYL1 TSPY-like 1 1 1
MIRT052749 PARP4 poly (ADP-ribose) polymerase family, member 4 1 1
MIRT052750 OGG1 8-oxoguanine DNA glycosylase 1 1
MIRT052751 PTPRF protein tyrosine phosphatase, receptor type, F 1 1
MIRT052752 PLOD2 procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 1 1
MIRT052753 SOGA3 SOGA family member 3 1 1
MIRT052754 NCAPG2 non-SMC condensin II complex, subunit G2 1 1
MIRT052755 NFE2L1 nuclear factor (erythroid-derived 2)-like 1 1 1
MIRT052756 PRMT3 protein arginine methyltransferase 3 1 1
MIRT052757 EPHB4 EPH receptor B4 1 1
MIRT052758 SLC3A2 solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 1 1
MIRT052759 SNF8 SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) 1 1
MIRT052760 DHCR7 7-dehydrocholesterol reductase 1 1
MIRT052761 PPIAL4B peptidylprolyl isomerase A (cyclophilin A)-like 4B 1 1
MIRT052762 SCP2 sterol carrier protein 2 1 1
MIRT052763 CCT7 chaperonin containing TCP1, subunit 7 (eta) 1 1
MIRT052764 WDR62 WD repeat domain 62 1 1
MIRT052765 SET SET nuclear oncogene 1 1
MIRT052766 APBB2 amyloid beta (A4) precursor protein-binding, family B, member 2 1 1
MIRT052767 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT052768 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT052769 SP3 Sp3 transcription factor 1 1
MIRT052770 HNRNPK heterogeneous nuclear ribonucleoprotein K 1 1
MIRT052771 PDHB pyruvate dehydrogenase (lipoamide) beta 1 1
MIRT052772 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9) 1 1
MIRT052773 MDN1 MDN1, midasin homolog (yeast) 1 1
MIRT052774 FAM134B family with sequence similarity 134, member B 1 1
MIRT052775 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) 1 1
MIRT052776 SF3B1 splicing factor 3b, subunit 1, 155kDa 1 1
MIRT052777 APP amyloid beta (A4) precursor protein 1 1
MIRT052778 RPE ribulose-5-phosphate-3-epimerase 1 1
MIRT052779 RBMXL1 RNA binding motif protein, X-linked-like 1 1 1
MIRT052780 SEC61G Sec61 gamma subunit 1 1
MIRT052781 KIAA1161 KIAA1161 1 1
MIRT052782 NOL8 nucleolar protein 8 1 1
MIRT052783 PKM pyruvate kinase, muscle 1 1
MIRT052784 CLCN2 chloride channel, voltage-sensitive 2 1 1
MIRT052785 BZW1 basic leucine zipper and W2 domains 1 1 1
MIRT052899 SFRP1 secreted frizzled-related protein 1 3 2
MIRT053327 DKK2 dickkopf 2 homolog (Xenopus laevis) 3 1
MIRT053328 SMAD4 SMAD family member 4 3 2
MIRT055129 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT090909 ARHGEF26 Rho guanine nucleotide exchange factor (GEF) 26 1 1
MIRT350956 BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 1 1
MIRT376808 IKZF2 IKAROS family zinc finger 2 (Helios) 1 1
MIRT409384 SLC31A1 solute carrier family 31 (copper transporters), member 1 1 1
MIRT460765 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 1
MIRT463085 ZNF618 zinc finger protein 618 1 1
MIRT464409 UNC13A unc-13 homolog A (C. elegans) 1 3
MIRT467596 SLC7A5 solute carrier family 7 (amino acid transporter light chain, L system), member 5 1 1
MIRT469422 REL v-rel reticuloendotheliosis viral oncogene homolog (avian) 1 1
MIRT471794 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT476223 GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 1 1
MIRT479086 CNNM4 cyclin M4 1 1
MIRT488861 AUTS8 Autism, susceptibility to, 8 1 1
MIRT494448 BTG2 BTG family, member 2 1 1
MIRT495518 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT497694 ARL6IP6 ADP-ribosylation-like factor 6 interacting protein 6 1 1
MIRT497802 GABRB1 gamma-aminobutyric acid (GABA) A receptor, beta 1 1 1
MIRT498760 C3orf38 chromosome 3 open reading frame 38 1 4
MIRT508912 TNK2 tyrosine kinase, non-receptor, 2 1 1
MIRT514405 RSL1D1 ribosomal L1 domain containing 1 1 1
MIRT517915 F2 coagulation factor II (thrombin) 1 2
MIRT526739 HLA-DOB major histocompatibility complex, class II, DO beta 1 1
MIRT526849 KIFC1 kinesin family member C1 1 1
MIRT527573 BRD7 bromodomain containing 7 1 2
MIRT528749 RPS27 ribosomal protein S27 1 3
MIRT530112 SLC25A42 solute carrier family 25, member 42 1 1
MIRT530733 AMDHD2 amidohydrolase domain containing 2 1 1
MIRT530803 GPR182 G protein-coupled receptor 182 1 1
MIRT530820 TMED3 transmembrane emp24 protein transport domain containing 3 1 1
MIRT532275 TNFSF14 tumor necrosis factor (ligand) superfamily, member 14 1 1
MIRT532742 CMTM6 CKLF-like MARVEL transmembrane domain containing 6 1 1
MIRT533218 VPS4A vacuolar protein sorting 4 homolog A (S. cerevisiae) 1 1
MIRT533333 UNC119B unc-119 homolog B (C. elegans) 1 1
MIRT534302 SKIDA1 SKI/DACH domain containing 1 1 1
MIRT535520 PALM2 paralemmin 2 1 1
MIRT536058 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT540127 BCAS4 breast carcinoma amplified sequence 4 1 1
MIRT540566 CEP89 centrosomal protein 89kDa 1 1
MIRT540664 MIS18A MIS18 kinetochore protein homolog A (S. pombe) 1 1
MIRT542580 ZC3H12C zinc finger CCCH-type containing 12C 1 2
MIRT542633 TIMM8A translocase of inner mitochondrial membrane 8 homolog A (yeast) 1 1
MIRT544373 TOMM20 translocase of outer mitochondrial membrane 20 homolog (yeast) 1 1
MIRT544888 OSBPL1A oxysterol binding protein-like 1A 1 1
MIRT547631 LCLAT1 lysocardiolipin acyltransferase 1 1 2
MIRT555260 PRDM4 PR domain containing 4 1 1
MIRT556641 KRBOX4 zinc finger family member 673 1 1
MIRT560217 PRNP prion protein 1 1
MIRT563390 KIF3A kinesin family member 3A 1 1
MIRT567459 GCC1 GRIP and coiled-coil domain containing 1 1 1
MIRT567725 E2F3 E2F transcription factor 3 1 1
MIRT571525 ZNF367 zinc finger protein 367 1 1
MIRT571900 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT571968 KIF21A kinesin family member 21A 1 1
MIRT573345 TRPM3 transient receptor potential cation channel, subfamily M, member 3 1 1
MIRT574382 WBP11 WW domain binding protein 11 1 1
MIRT575517 Map4 microtubule-associated protein 4 1 1
MIRT609735 VIPR1 vasoactive intestinal peptide receptor 1 1 1
MIRT613967 PPP1R3D protein phosphatase 1, regulatory subunit 3D 1 2
MIRT621227 LMAN1 lectin, mannose-binding, 1 1 1
MIRT621527 ZNF507 zinc finger protein 507 1 1
MIRT621539 ZNF500 zinc finger protein 500 1 1
MIRT623395 LHFPL2 lipoma HMGIC fusion partner-like 2 1 1
MIRT624113 DNAH10OS dynein, axonemal, heavy chain 10 opposite strand 1 1
MIRT624334 CISD1 CDGSH iron sulfur domain 1 1 1
MIRT625197 GSTCD glutathione S-transferase, C-terminal domain containing 1 1
MIRT628193 GAN gigaxonin 1 1
MIRT631496 TAF8 TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa 1 1
MIRT636332 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 1
MIRT637844 SLC2A9 solute carrier family 2 (facilitated glucose transporter), member 9 1 1
MIRT638489 NNT nicotinamide nucleotide transhydrogenase 1 1
MIRT639049 FPR1 formyl peptide receptor 1 1 1
MIRT639144 POLR3G polymerase (RNA) III (DNA directed) polypeptide G (32kD) 1 1
MIRT639370 ZCCHC24 zinc finger, CCHC domain containing 24 1 2
MIRT642436 CLUAP1 clusterin associated protein 1 1 1
MIRT643594 SPAG16 sperm associated antigen 16 1 1
MIRT643608 KANSL3 KAT8 regulatory NSL complex subunit 3 1 1
MIRT643637 EZH2 enhancer of zeste homolog 2 (Drosophila) 1 1
MIRT643677 AMER3 family with sequence similarity 123C 1 1
MIRT644735 CCDC174 coiled-coil domain containing 174 1 1
MIRT644759 TXNRD3NB thioredoxin reductase 3 neighbor 1 1
MIRT644881 C2orf48 chromosome 2 open reading frame 48 1 1
MIRT645287 ANGPTL7 angiopoietin-like 7 1 1
MIRT645435 ATF6B activating transcription factor 6 beta 1 1
MIRT645465 SPIN3 spindlin family, member 3 1 1
MIRT645661 ADK adenosine kinase 1 1
MIRT646079 MGST3 microsomal glutathione S-transferase 3 1 1
MIRT646847 SLC35E4 solute carrier family 35, member E4 1 1
MIRT647588 FAM109B family with sequence similarity 109, member B 1 1
MIRT648568 CAPN13 calpain 13 1 1
MIRT650394 ORMDL2 ORM1-like 2 (S. cerevisiae) 1 1
MIRT651229 ZNF207 zinc finger protein 207 1 1
MIRT651596 WDFY2 WD repeat and FYVE domain containing 2 1 1
MIRT652470 TMEM181 transmembrane protein 181 1 1
MIRT654279 RCAN3 RCAN family member 3 1 1
MIRT654501 RABIF RAB interacting factor 1 1
MIRT654582 PURA purine-rich element binding protein A 1 1
MIRT654925 POLR3D polymerase (RNA) III (DNA directed) polypeptide D, 44kDa 1 1
MIRT655962 NDNF neuron-derived neurotrophic factor 1 1
MIRT656084 MTA3 metastasis associated 1 family, member 3 1 1
MIRT656264 MEX3A mex-3 homolog A (C. elegans) 1 1
MIRT656310 MESDC1 mesoderm development candidate 1 1 1
MIRT656384 MCU mitochondrial calcium uniporter 1 1
MIRT656710 LMX1B LIM homeobox transcription factor 1, beta 1 1
MIRT656839 KLF7 Kruppel-like factor 7 (ubiquitous) 1 1
MIRT657959 GAPVD1 GTPase activating protein and VPS9 domains 1 1 1
MIRT658349 FAM65B family with sequence similarity 65, member B 1 1
MIRT658555 ERGIC1 endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 1 1
MIRT658614 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 1 1
MIRT658750 ELAVL3 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) 1 1
MIRT659444 CNNM2 cyclin M2 1 1
MIRT659696 CD200 CD200 molecule 1 1
MIRT659881 CAPN7 calpain 7 1 1
MIRT660966 ABI2 abl-interactor 2 1 1
MIRT660983 ABHD2 abhydrolase domain containing 2 1 1
MIRT664736 METTL16 methyltransferase like 16 1 1
MIRT664893 EMC7 ER membrane protein complex subunit 7 1 1
MIRT667872 IP6K1 inositol hexakisphosphate kinase 1 1 1
MIRT680189 KIAA1551 KIAA1551 1 1
MIRT684595 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT685547 TXK TXK tyrosine kinase 1 1
MIRT687387 NSUN4 NOP2/Sun domain family, member 4 1 1
MIRT695792 RAB19 RAB19, member RAS oncogene family 1 1
MIRT696375 SLC27A1 solute carrier family 27 (fatty acid transporter), member 1 1 1
MIRT698013 TSC22D2 TSC22 domain family, member 2 1 1
MIRT698665 TEF thyrotrophic embryonic factor 1 1
MIRT698786 STK38 serine/threonine kinase 38 1 1
MIRT701832 MRPL37 mitochondrial ribosomal protein L37 1 1
MIRT703887 EPT1 ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific) 1 1
MIRT704448 CSNK2A1 casein kinase 2, alpha 1 polypeptide 1 1
MIRT705820 AIFM2 apoptosis-inducing factor, mitochondrion-associated, 2 1 1
MIRT708696 TFDP2 transcription factor Dp-2 (E2F dimerization partner 2) 1 1
MIRT709950 TRUB2 TruB pseudouridine (psi) synthase homolog 2 (E. coli) 1 1
MIRT713820 NUP98 nucleoporin 98kDa 1 1
MIRT713928 PIGR polymeric immunoglobulin receptor 1 1
MIRT714915 PPP1R12C protein phosphatase 1, regulatory subunit 12C 1 1
MIRT715101 SORBS3 sorbin and SH3 domain containing 3 1 1
MIRT716080 RNF150 ring finger protein 150 1 1
MIRT717072 ESM1 endothelial cell-specific molecule 1 1 1
MIRT717967 PXMP4 peroxisomal membrane protein 4, 24kDa 1 1
MIRT717975 MAFK v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) 1 1
MIRT718852 LRSAM1 leucine rich repeat and sterile alpha motif containing 1 1 1
MIRT718964 GTPBP4 GTP binding protein 4 1 1
MIRT719919 PRKAB1 protein kinase, AMP-activated, beta 1 non-catalytic subunit 1 1
MIRT720784 PRKRIP1 PRKR interacting protein 1 (IL11 inducible) 1 1
MIRT721187 FAIM3 Fas apoptotic inhibitory molecule 3 1 1
MIRT722303 DHCR24 24-dehydrocholesterol reductase 1 1
MIRT722559 C1orf95 chromosome 1 open reading frame 95 1 1
MIRT722600 CCDC152 coiled-coil domain containing 152 1 1
MIRT723849 MN1 meningioma (disrupted in balanced translocation) 1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*