Accession ID: MIRT052896 [miRNA, hsa-miR-3943 :: HSP90AA1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-3943LinkOut: [miRBase ]
Description Homo sapiens miR-3943 stem-loop
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-3943
Mature Sequence 23| UAGCCCCCAGGCUUCACUUGGCG |45
Evidence Experimental
Experiments Illumina
Putative hsa-miR-3943 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol HSP90AA1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms HSP86, HSP89A, HSP90A, HSP90N, HSPC1, HSPCA, HSPCAL1, HSPCAL4, HSPN, Hsp89, Hsp90, LAP2
Description heat shock protein 90kDa alpha (cytosolic), class A member 1
Transcript NM_001017963    LinkOut: [ RefSeq ]
Other Transcripts NM_005348   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on HSP90AA1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of HSP90AA1
(miRNA target sites are highlighted)
>HSP90AA1|NM_001017963|3'UTR
   1 TCTCTGGCTGAGGGATGACTTACCTGTTCAGTACTCTACAATTCCTCTGATAATATATTTTCAAGGATGTTTTTCTTTAT
  81 TTTTGTTAATATTAAAAAGTCTGTATGGCATGACAACTACTTTAAGGGGAAGATAAGATTTCTGTCTACTAAGTGATGCT
 161 GTGATACCTTAGGCACTAAAGCAGAGCTAGTAATGCTTTTTGAGTTTCATGTTGGTTTATTTTCACAGATTGGGGTAACG
 241 TGCACTGTAAGACGTATGTAACATGATGTTAACTTTGTGGTCTAAAGTGTTTAGCTGTCAAGCCGGATGCCTAAGTAGAC
 321 CAAATCTTGTTATTGAAGTGTTCTGAGCTGTATCTTGATGTTTAGAAAAGTATTCGTTACATCTTGTAGGATCTACTTTT
 401 TGAACTTTTCATTCCCTGTAGTTGACAATTCTGCATGTACTAGTCCTCTAGAAATAGGTTAAACTGAAGCAACTTGATGG
 481 AAGGATCTCTCCACAGGGCTTGTTTTCCAAAGAAAAGTATTGTTTGGAGGAGCAAAGTTAAAAGCCTACCTAAGCATATC
 561 GTAAAGCTGTTCAAAAATAACTCAGACCCAGTCTTGTGGATGGAAATGTAGTGCTCGAGTCACATTCTGCTTAAAGTTGT
 641 AACAAATACAGATGAGTTAAAAGATATTGTGTGACAGTGTCTTATTTAGGGGGAAAGGGGAGTATCTGGATGACAGTTAG
 721 TGCCAAAATGTAAAACATGAGGCGCTAGCAGGAGATGGTTAAACACTAGCTGCTCCAAGGGTTGACATGGTCTTCCCAGC
 801 ATGTACTCAGCAGGTGTGGGGTGGAGCACACGTAGGCACAGAAAACAGGAATGCAGACAACATGCATCCCCTGCGTCCAT
 881 GAGTTACATGTGTTCTCTTAGTGTCCACGTTGTTTTGATGTTATTCATGGAATACCTTCTGTGTTAAATACAGTCACTTA
 961 ATTCCTTGGCCTTA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gcgguUCAC---UUCGGACCCCCgau 5'
               ||||    | :: |||||   
Target 5' gtgacAGTGTCTTATTTAGGGGGaaa 3'
671 - 696 106.00 -13.02
2
miRNA  3' gcGGUU---CACUUCGGAC-CCCCGAu 5'
            ||||   || || | || || ||| 
Target 5' tgCCAAAATGTAAAACATGAGGCGCTa 3'
721 - 747 105.00 -12.10
3
miRNA  3' gcgguucacuucggaccCCCGAu 5'
                           ||||| 
Target 5' ggaaggatctctccacaGGGCTt 3'
479 - 501 100.00 -13.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-3943 :: HSP90AA1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
65 hsa-miR-3943 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT052895 RPS2 ribosomal protein S2 1 1
MIRT052896 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT052897 CD63 CD63 molecule 1 1
MIRT082808 ZNF264 zinc finger protein 264 1 2
MIRT442677 ICAM3 intercellular adhesion molecule 3 1 1
MIRT466980 STARD7 StAR-related lipid transfer (START) domain containing 7 1 2
MIRT478102 DLG5 discs, large homolog 5 (Drosophila) 1 3
MIRT480989 BBC3 BCL2 binding component 3 1 1
MIRT487822 PER3 period homolog 3 (Drosophila) 1 1
MIRT491253 HCN2 hyperpolarization activated cyclic nucleotide-gated potassium channel 2 1 1
MIRT491290 DLL4 delta-like 4 (Drosophila) 1 1
MIRT494840 ADCY9 adenylate cyclase 9 1 1
MIRT496003 EMP1 epithelial membrane protein 1 1 1
MIRT500035 ABCF2 ATP-binding cassette, sub-family F (GCN20), member 2 1 4
MIRT504379 IRF4 interferon regulatory factor 4 1 3
MIRT505574 SMC1A structural maintenance of chromosomes 1A 1 3
MIRT512718 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT513666 SURF4 surfeit 4 1 1
MIRT515500 GTF2F1 general transcription factor IIF, polypeptide 1, 74kDa 1 1
MIRT520903 STMN1 stathmin 1 1 1
MIRT522232 NPFFR1 neuropeptide FF receptor 1 1 1
MIRT527987 TSLP thymic stromal lymphopoietin 1 1
MIRT528955 PNMA5 paraneoplastic Ma antigen family member 5 1 1
MIRT535019 PRMT7 protein arginine methyltransferase 7 1 2
MIRT535558 OTUB2 OTU domain, ubiquitin aldehyde binding 2 1 1
MIRT535611 NUDCD3 NudC domain containing 3 1 1
MIRT538988 BCL2L2 BCL2-like 2 1 1
MIRT553260 TVP23C family with sequence similarity 18, member B2 1 1
MIRT553279 TVP23B family with sequence similarity 18, member B1 1 1
MIRT555156 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT564041 BIRC5 baculoviral IAP repeat containing 5 1 1
MIRT566052 REST RE1-silencing transcription factor 1 1
MIRT566200 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 1
MIRT566525 PARP16 poly (ADP-ribose) polymerase family, member 16 1 1
MIRT570825 RPL7L1 ribosomal protein L7-like 1 1 1
MIRT612216 TMEM109 transmembrane protein 109 1 1
MIRT613874 COBLL1 COBL-like 1 1 2
MIRT613910 FOXP4 forkhead box P4 1 1
MIRT614347 KIF26A kinesin family member 26A 1 1
MIRT632801 KIAA2022 KIAA2022 1 1
MIRT639410 BCAS2 breast carcinoma amplified sequence 2 1 1
MIRT650063 CCDC134 coiled-coil domain containing 134 1 1
MIRT651662 VWA1 von Willebrand factor A domain containing 1 1 1
MIRT651949 UBE2Z ubiquitin-conjugating enzyme E2Z 1 1
MIRT652282 TOM1L2 target of myb1-like 2 (chicken) 1 1
MIRT653799 SIRPA signal-regulatory protein alpha 1 1
MIRT667197 NODAL nodal homolog (mouse) 1 1
MIRT683368 FANCA Fanconi anemia, complementation group A 1 1
MIRT684832 SCAI suppressor of cancer cell invasion 1 1
MIRT687293 PARP2 poly (ADP-ribose) polymerase 2 1 1
MIRT698602 TEX261 testis expressed 261 1 1
MIRT701338 NSD1 nuclear receptor binding SET domain protein 1 1 1
MIRT701749 MSL2 male-specific lethal 2 homolog (Drosophila) 1 1
MIRT701941 MLLT1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 1 1
MIRT703340 GDPD5 glycerophosphodiester phosphodiesterase domain containing 5 1 1
MIRT716243 METTL21A methyltransferase like 21A 1 1
MIRT716295 MTMR1 myotubularin related protein 1 1 1
MIRT717585 VTA1 Vps20-associated 1 homolog (S. cerevisiae) 1 1
MIRT719172 KIF6 kinesin family member 6 1 1
MIRT720623 PIANP PILR alpha associated neural protein 1 1
MIRT720683 SLC39A13 solute carrier family 39 (zinc transporter), member 13 1 1
MIRT722147 SLC2A8 solute carrier family 2 (facilitated glucose transporter), member 8 1 1
MIRT722453 RXFP4 relaxin/insulin-like family peptide receptor 4 1 1
MIRT725089 UNC13A unc-13 homolog A (C. elegans) 1 1
MIRT725220 PEA15 phosphoprotein enriched in astrocytes 15 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*